ID: 955271715

View in Genome Browser
Species Human (GRCh38)
Location 3:57506154-57506176
Sequence AACAACATGGTAAAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 334}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955271712_955271715 6 Left 955271712 3:57506125-57506147 CCTGGTACAGAAAATGTTCCAGA 0: 1
1: 0
2: 0
3: 21
4: 217
Right 955271715 3:57506154-57506176 AACAACATGGTAAAGACTGAAGG 0: 1
1: 0
2: 2
3: 34
4: 334
955271711_955271715 7 Left 955271711 3:57506124-57506146 CCCTGGTACAGAAAATGTTCCAG 0: 1
1: 0
2: 1
3: 14
4: 180
Right 955271715 3:57506154-57506176 AACAACATGGTAAAGACTGAAGG 0: 1
1: 0
2: 2
3: 34
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955271715 Original CRISPR AACAACATGGTAAAGACTGA AGG Intronic
900751518 1:4400854-4400876 AACAACATGGCAGAGAAAGAGGG - Intergenic
901418448 1:9133762-9133784 AACAGCAAGGAAATGACTGAGGG - Intergenic
902782843 1:18715956-18715978 AACAGGATGGAAAAGGCTGATGG - Intronic
904547111 1:31283830-31283852 AACCACATGCCAAAGAATGAAGG + Intronic
906683294 1:47745655-47745677 AAGTACATGGTAAAGAGTGTGGG - Intergenic
910170703 1:84373890-84373912 AGGGAAATGGTAAAGACTGATGG - Intronic
910631584 1:89361017-89361039 AACAACATGGATAAACCTGAAGG - Intergenic
911174032 1:94801502-94801524 AACTACATGTTATAGACAGAAGG - Intergenic
912041013 1:105390654-105390676 AATAACATGGAAAAAACTGGAGG - Intergenic
912154396 1:106899609-106899631 AAAAACAAAGTAAAGACTGGGGG - Intergenic
912207550 1:107525044-107525066 AACTACATGGAAATGACTGTGGG - Intergenic
912903251 1:113675439-113675461 AAGGATATGGCAAAGACTGATGG + Intronic
912910577 1:113755743-113755765 AATGACATGGAAAAGAGTGAAGG + Intronic
913417219 1:118622073-118622095 AACAACATGGAAATAACTGGAGG - Intergenic
915413996 1:155725951-155725973 AATAACATGGCAAAGACTTAGGG - Exonic
915660632 1:157402470-157402492 TACCACAAGGTAAGGACTGATGG - Intergenic
915703259 1:157818351-157818373 AACAACATGGGTGAGCCTGAAGG + Intronic
916569196 1:166009983-166010005 AACAACTTGGAAAGGTCTGAGGG - Intergenic
917449902 1:175138931-175138953 AACACCATGGTAAGTACTTATGG + Intronic
918841475 1:189545712-189545734 AACAACATTTTAAAACCTGATGG + Intergenic
920619389 1:207529186-207529208 AACAAAATGGAAAAGAAAGAAGG - Intronic
920621171 1:207547741-207547763 AACAAAATGGAAAAGAAAGAAGG - Intronic
921176388 1:212598754-212598776 AACAACATGGATGAAACTGAAGG - Intronic
921794689 1:219328386-219328408 AACAACCAGGTCTAGACTGAAGG - Intergenic
923428892 1:233901070-233901092 AATAACATGGATAAGCCTGAAGG + Intergenic
924029176 1:239869228-239869250 AACCATATGGTACAAACTGAAGG + Intronic
924365246 1:243285886-243285908 ATCAACTTGTTAAAAACTGATGG - Intronic
924594057 1:245429952-245429974 AACAATAAGGAAGAGACTGAAGG + Intronic
1062884460 10:1005534-1005556 AACTACATGTTAATAACTGAGGG - Intronic
1066139843 10:32493298-32493320 AACAACATGGATGAAACTGAAGG - Intronic
1069395623 10:67984343-67984365 AACAACATGGACAAAACTGGAGG + Intronic
1071122221 10:82292029-82292051 AAAAACAAAGTAAAGACTGGGGG + Intronic
1071197003 10:83173349-83173371 AACAAAATGTTAAAAACAGAGGG - Intergenic
1071506645 10:86236372-86236394 TACAACATGGTAAAGTGTTATGG - Intronic
1075759563 10:124845786-124845808 AACTGCATGGTATTGACTGAGGG + Intergenic
1076052841 10:127349106-127349128 AACTTCATGGGAAAGACTGGTGG - Intronic
1076182772 10:128423331-128423353 AACAACATGGTAAACAGCCAAGG - Intergenic
1077528127 11:3080950-3080972 AACAACATGGATAAGCCTGGAGG + Intergenic
1079025985 11:16948025-16948047 AACAACATGGTTAAACCTGGAGG + Intronic
1079776268 11:24533200-24533222 AACAACCTGGCAAAGCCAGAGGG - Intronic
1079929839 11:26544177-26544199 AACAACATGGATAAGACTGGAGG - Intronic
1080519826 11:33058764-33058786 GACAACATGATAAAAACTGATGG - Intronic
1080734918 11:35004270-35004292 AACAACATGGAAAATACTCATGG + Intronic
1080767056 11:35306828-35306850 AGCAACATGGATAAGACTGGCGG - Intronic
1081123825 11:39298732-39298754 AACAACATGGATAAAACTGAAGG + Intergenic
1081253575 11:40865125-40865147 AACAACATGGTTAACTCTGGAGG + Intronic
1081350712 11:42048771-42048793 AACAACATGCTAGGCACTGAAGG + Intergenic
1082916509 11:58443998-58444020 AACCACATAGAAAAGACTGTTGG + Intergenic
1084018766 11:66404360-66404382 ATCAGCATGGTACAGGCTGAAGG + Intergenic
1084345411 11:68544011-68544033 GACAGCATGGTGAAGACTCATGG + Intronic
1087303476 11:96461881-96461903 ATCAACATTGTAAAGAGTAAAGG - Intronic
1089799965 11:121019389-121019411 AAGATCATTGTGAAGACTGAGGG + Intergenic
1091541677 12:1468192-1468214 AGCAAGAAGGTAAAGACTCATGG + Intronic
1092018785 12:5182727-5182749 TAGACCATGGTAGAGACTGAGGG + Intergenic
1092632717 12:10400439-10400461 AACAACATGGATAAACCTGAAGG + Intronic
1092754885 12:11753832-11753854 AGCAACTTCGTAAATACTGATGG - Intronic
1093299478 12:17437377-17437399 AACAACATGGATAAAACTTAAGG + Intergenic
1094420626 12:30267192-30267214 AACAACATGGTTGGAACTGAAGG + Intergenic
1095893490 12:47257280-47257302 AACAACATCCAAATGACTGATGG - Intergenic
1096277520 12:50222899-50222921 AATAACATGGTAAATTCTGCTGG + Intronic
1097108261 12:56638130-56638152 GACAACATAGTCAACACTGAAGG - Intergenic
1097424886 12:59431658-59431680 TACAACATGGGAGAGAATGAAGG - Intergenic
1098378423 12:69842607-69842629 AAGAACATGGTAGAGACTGAGGG - Intronic
1100224846 12:92545732-92545754 AACAACATGGATGAGCCTGAAGG + Intergenic
1100665936 12:96753198-96753220 AAAAACATGTTAAATAATGATGG + Intronic
1101526699 12:105537726-105537748 AACCACAAGATAAAGACTGGTGG + Intergenic
1102087170 12:110151948-110151970 AACAACATGGATGAGCCTGAAGG - Intronic
1103115342 12:118324691-118324713 AACAACATGGATGAGACTGGAGG - Intronic
1103330161 12:120148700-120148722 AACTACAGGGTGAAGCCTGAAGG + Intronic
1103804068 12:123558796-123558818 AACAACTATGTAAAGACTGTGGG + Intergenic
1106031385 13:26008429-26008451 AAAAACATGGGAGAGATTGAGGG + Intronic
1107206384 13:37794828-37794850 AACCTCATGGTATATACTGATGG - Intronic
1107774114 13:43820119-43820141 AAAAACATAGTATAAACTGATGG + Intergenic
1108991628 13:56665771-56665793 AAAAACATGTTAAAGACTAATGG - Intergenic
1109106286 13:58254879-58254901 CACAACATGAAAAAAACTGAAGG + Intergenic
1109291914 13:60486896-60486918 AGCAACATGGATAAGCCTGAAGG - Intronic
1109319078 13:60787370-60787392 CAAGACATGGTAAAGACAGAGGG + Intergenic
1109362333 13:61311294-61311316 AACAACATGGAAAAAACTGGAGG - Intergenic
1110663766 13:78091246-78091268 AACAACATGGATGAAACTGAAGG + Intergenic
1111033072 13:82632813-82632835 GAAAACATGGTAAAAAGTGAAGG - Intergenic
1111484923 13:88884526-88884548 AACAACTTAGTAAATACTCAAGG - Intergenic
1111761295 13:92468865-92468887 AACAGCAAGGCAAAGACTGAAGG - Intronic
1112455835 13:99562412-99562434 TACTACATAGAAAAGACTGAAGG - Intronic
1112727807 13:102325369-102325391 AGCAATATTGTAAAGACTGTTGG - Intronic
1113171132 13:107504569-107504591 AACAACATGGAAACGAATAAAGG - Intronic
1113282315 13:108802383-108802405 AACAACATGGATGAAACTGAAGG - Intronic
1113975952 13:114227386-114227408 AAAAACATGAGAAAGAGTGATGG - Intergenic
1114251064 14:20961219-20961241 AACAAAATGGTAAAAAGTGAGGG + Intergenic
1114761175 14:25316197-25316219 AACAACATGGATAAAACTGGAGG - Intergenic
1115209398 14:30950167-30950189 AAAATCATGGTAAAGTCAGAGGG + Intronic
1115900180 14:38137851-38137873 AAATACTTGGTAAAGAGTGAAGG + Intergenic
1116490783 14:45500552-45500574 AACAACCTGGTGAAGACAGGTGG - Intergenic
1116602108 14:46938960-46938982 AACAACATGGATAAGCCTGGAGG + Intronic
1116674946 14:47894057-47894079 AACAACATGGATGAAACTGAAGG + Intergenic
1118056240 14:62082365-62082387 AGCAACATGGAGAAGACTGCAGG - Intronic
1118688163 14:68312466-68312488 AACAACAGGGTCAATACTGGAGG - Intronic
1120445913 14:84595679-84595701 AACAACATGGATAAACCTGAAGG - Intergenic
1120533123 14:85657855-85657877 AACATCATGGTAAAAAATGAAGG - Intergenic
1120698552 14:87672146-87672168 AACAACATGGATGAAACTGAAGG + Intergenic
1122035592 14:98946955-98946977 ATCAAAATGCTATAGACTGATGG + Intergenic
1122050039 14:99051352-99051374 AACAACATGGATAAAACTGAAGG + Intergenic
1124046947 15:26159443-26159465 AGCCACTTAGTAAAGACTGAAGG - Intergenic
1124091352 15:26605620-26605642 AACAACATGGATAAAACTGGAGG + Intronic
1124418538 15:29494798-29494820 AACAACATGGATAAGCCTGGAGG - Intronic
1125209466 15:37196583-37196605 AACAATATGCTAAAGAGTGGGGG - Intergenic
1126047917 15:44661282-44661304 AACAACACTGGCAAGACTGATGG + Intronic
1126219898 15:46200654-46200676 CACAACATGGGTAAAACTGATGG - Intergenic
1126388207 15:48116333-48116355 AACAACAGCCTAAGGACTGATGG + Intergenic
1126528942 15:49690202-49690224 TTCAACATGGCAAAGACTGGAGG + Intergenic
1126829163 15:52582156-52582178 AACATCTTGGTGAAAACTGAGGG + Exonic
1126950933 15:53880286-53880308 AACTACATTATAAAGATTGAAGG + Intergenic
1127245033 15:57163838-57163860 AAGAAGATGGCAGAGACTGAAGG + Intronic
1128272010 15:66318662-66318684 AAAAAGCTGGTAAAGACAGAAGG - Intronic
1128360835 15:66960627-66960649 TTCATCATGGTAAAGATTGAGGG - Intergenic
1128963838 15:72037539-72037561 AACCTCATAGTAAAGACTGGAGG + Intronic
1130036834 15:80368634-80368656 AACACCATGGAAAAGTCTGGGGG - Intronic
1131877022 15:96818960-96818982 AGCAACATGGTGAAGAATGACGG - Intergenic
1131930147 15:97432536-97432558 AACACCAGGGTAAAGACAAAGGG + Intergenic
1133904256 16:10006926-10006948 AACAACATGGATGAAACTGAAGG - Intronic
1134683450 16:16142454-16142476 AAAAACAAGGAAAAGACTCAAGG - Exonic
1140109266 16:71989127-71989149 AACAGCGTGGGAAATACTGAGGG + Intronic
1141935981 16:87238003-87238025 AAAAACATGCCAGAGACTGATGG - Intronic
1144544884 17:16184909-16184931 CACAACATGGATAAGCCTGAAGG + Intronic
1144748947 17:17634909-17634931 AACAGCATGGCAAAGACAGTGGG - Intergenic
1145082289 17:19904041-19904063 AACAACATGATAAAGATGAAGGG + Intergenic
1148591403 17:48818899-48818921 ATCCACAAGGTAAACACTGAGGG + Intergenic
1149084879 17:52703975-52703997 AACAACATGGCTAGAACTGAAGG - Intergenic
1149149855 17:53548578-53548600 GACAACATGGATAAAACTGAAGG - Intergenic
1149453114 17:56765740-56765762 AACCACATTGTCTAGACTGAAGG - Intergenic
1150029422 17:61716719-61716741 AACAAAATGGTACAGATTGGGGG - Intronic
1150176200 17:63059186-63059208 AACAACATAATTCAGACTGAAGG - Intronic
1150420415 17:65029046-65029068 AAAAACTTGGTGAACACTGAAGG + Intronic
1150953935 17:69834398-69834420 GAAAACTTGGAAAAGACTGAAGG + Intergenic
1153211939 18:2776846-2776868 AACAGCATGGGAAATCCTGACGG + Intronic
1153668741 18:7390628-7390650 AGCGACATGGGAAAGACTGCAGG + Intergenic
1156914638 18:42451357-42451379 AAGAACAAGATAAAGGCTGAGGG + Intergenic
1157049375 18:44143506-44143528 AGCATCATGGTAAAGAATGTGGG - Intergenic
1157505602 18:48224023-48224045 AAGATGATGGAAAAGACTGACGG + Intronic
1158369744 18:56786812-56786834 ACAAACATGCTAAAGACTGAGGG - Intronic
1159174522 18:64815583-64815605 AACACCATAGAAAAGTCTGAGGG - Intergenic
1161430230 19:4227462-4227484 AACAACAACAAAAAGACTGATGG - Intergenic
1162173495 19:8810911-8810933 GCCTACATGGTAATGACTGAAGG + Exonic
1165777968 19:38416063-38416085 AACAACAATGAAAAGGCTGAGGG + Intronic
1165822103 19:38683258-38683280 AACAAAATGGTTAGGTCTGAGGG - Intronic
1166129857 19:40739699-40739721 ACCAACGTGGAAAAGTCTGAAGG + Exonic
1168001034 19:53446143-53446165 AGTAACATGATAGAGACTGATGG - Intronic
1168465858 19:56600687-56600709 AACAACATGGATAAAACTGGAGG - Intronic
926300029 2:11595864-11595886 AACAACATGGTAAAGGATGAAGG - Intronic
930554188 2:52874565-52874587 AACAATATGTTAGTGACTGAGGG + Intergenic
932769427 2:74492287-74492309 AATAACCTGATAAAGACAGAAGG - Exonic
935144283 2:100384235-100384257 AACATCTTGGTGAAAACTGAGGG + Intergenic
935154577 2:100471796-100471818 AATAACAGAATAAAGACTGACGG - Intronic
935693700 2:105752547-105752569 AACAACATTGTATACAGTGATGG + Intronic
937197304 2:120170515-120170537 GCCCACATGGTAAGGACTGAGGG - Intronic
938811567 2:134858228-134858250 AACAACATGAATAACACTGAAGG + Intronic
939347428 2:140984367-140984389 AAGAATATAGAAAAGACTGAAGG - Intronic
939670217 2:145001872-145001894 AACAAAAAGATAAAGAGTGAGGG + Intergenic
940990927 2:160095635-160095657 AACAACATGGATGAAACTGAAGG + Intergenic
942601037 2:177641289-177641311 AACAAAACCATAAAGACTGATGG + Intronic
942777403 2:179599779-179599801 AATAACATTCTGAAGACTGATGG + Intronic
943510555 2:188820987-188821009 AATAACTTGGTAAATACTTAGGG + Intergenic
945830622 2:214780259-214780281 AACAAAATGATAAAAACTGAAGG + Intronic
946127423 2:217575648-217575670 AACAACATGGATAAAACTGGAGG + Intronic
946130217 2:217600930-217600952 CAAAACATGATAGAGACTGAAGG - Intronic
948472137 2:238189930-238189952 TCCCAGATGGTAAAGACTGAAGG - Exonic
948912894 2:241013711-241013733 AACAACATGGATGAAACTGAAGG - Intronic
1168750231 20:276928-276950 CAGAACATGGTAGAGACCGATGG + Intronic
1168899340 20:1348271-1348293 AACAACATGGATGAAACTGAAGG - Intronic
1170061378 20:12263117-12263139 AAACAAATGGTAAACACTGAAGG - Intergenic
1170454002 20:16515722-16515744 AAGAACATTGTCAACACTGAAGG - Intronic
1171263795 20:23754068-23754090 ATCAACATGGTTAAAAATGATGG + Intergenic
1172735124 20:37120956-37120978 AACATCATGGAAAAGAATAAAGG - Exonic
1173597223 20:44266531-44266553 AACAAAATACTACAGACTGAGGG + Intronic
1175103767 20:56599224-56599246 TACAACATGTGAAAGAGTGATGG - Intergenic
1176937100 21:14880175-14880197 AAGAACATGGCAAAGACTCAGGG - Intergenic
1178028443 21:28495598-28495620 AAGAACAAGGAAAAGACTGGGGG - Intergenic
1179331469 21:40406492-40406514 AACAACATGGATAAACCTGAAGG + Intronic
1179809191 21:43859400-43859422 GACCACATGGTAAAGACCGCAGG - Intergenic
1183435765 22:37793931-37793953 AGCACCATGGCACAGACTGAGGG - Intergenic
1184183184 22:42845117-42845139 AAGAACACAGTAAAGACAGAAGG + Intronic
1184725084 22:46339800-46339822 AACAACATGGACAAAACTGATGG + Intronic
1203244743 22_KI270733v1_random:55459-55481 AACAACATGGGTTAAACTGAAGG - Intergenic
949144353 3:678885-678907 AACAACATGGATAGAACTGAAGG - Intergenic
951255855 3:20448369-20448391 AACAAGAGGGTAAGGACTTAAGG + Intergenic
952393213 3:32898623-32898645 ACCAACATGGGAAGGAGTGAAGG - Intergenic
952825085 3:37517984-37518006 ATCAACATGGTAGAGCATGATGG - Intronic
953119812 3:40028669-40028691 AGCTACATGGGAAAGAGTGATGG - Intronic
955103774 3:55876682-55876704 AACCACAGGTTAAAGAATGATGG + Intronic
955271715 3:57506154-57506176 AACAACATGGTAAAGACTGAAGG + Intronic
956246874 3:67193239-67193261 CACAAGATGTTAAAGACTAATGG + Intergenic
958474306 3:94561350-94561372 TACATCCTAGTAAAGACTGATGG - Intergenic
958710604 3:97712400-97712422 TACTGCATGGTAAAGACTCAGGG - Intronic
958971158 3:100611456-100611478 AACAACATGAGAAAGAGTGCAGG + Intronic
958991400 3:100849907-100849929 AATTTCATGGTAGAGACTGAAGG + Intronic
959487889 3:106949360-106949382 AACAAAACGGCAAAGACTGTAGG - Intergenic
961546760 3:127639624-127639646 AGCAGCATGGTAAAAACTGTAGG - Intronic
963251158 3:143104666-143104688 AATAACATAGAAAAGACTGCTGG - Intergenic
963386699 3:144605015-144605037 AACAACATTGTAAAGATGGCTGG + Intergenic
966153152 3:176887880-176887902 AACAACATGGATAAAACTGGAGG + Intergenic
967549122 3:190768699-190768721 AACAACATGGATGAAACTGAAGG - Intergenic
970199911 4:13593707-13593729 ATCAACATGGAAATGACTGATGG - Intronic
971657391 4:29366996-29367018 ATCAACATGGTAAAGATTTGAGG + Intergenic
972054923 4:34789462-34789484 AACAAAATACCAAAGACTGAAGG - Intergenic
974136997 4:57831310-57831332 AACAACAAGGTAATGACTAATGG - Intergenic
974661934 4:64901153-64901175 AACAACATGGTTAGAACTGGAGG + Intergenic
974871297 4:67646970-67646992 AAAATAATGGTAAAGCCTGAAGG + Intronic
974927128 4:68313322-68313344 AATAAATTGGTAAAGATTGACGG - Exonic
975169267 4:71214425-71214447 ATCATCATGGCAAAGGCTGATGG + Intronic
975612480 4:76215735-76215757 GAGAACATGGGAAAGACTGTGGG + Intronic
975939630 4:79627130-79627152 AAAAAAATGGTAAAGAATGTTGG - Intergenic
976932414 4:90584330-90584352 AACCACACGGCAAAGAATGAAGG + Intronic
977258819 4:94772270-94772292 AACAACATGCTGAAGACAAAGGG - Intronic
977493478 4:97742618-97742640 AACAACATGGATGAAACTGAAGG + Intronic
977873111 4:102117137-102117159 AACAACATGGATAGGACTGGAGG - Intergenic
977966788 4:103160306-103160328 AAAAAAATGGTAAAGACTAAGGG + Intronic
980562514 4:134496250-134496272 AACAACATGGATTATACTGAAGG + Intergenic
980792758 4:137640529-137640551 AACAACATCGTAAATAATAATGG + Intergenic
981664532 4:147208100-147208122 GACAAATTGGTAAAGAATGAAGG - Intergenic
983002550 4:162435463-162435485 AACAGCATGGTACAGACACATGG - Intergenic
983426605 4:167592000-167592022 AACAACATGGCTGAAACTGAAGG + Intergenic
983442699 4:167807663-167807685 AACAAAGTGTTAAAGAGTGAAGG - Intergenic
983463988 4:168063576-168063598 AACAACATGGATAAAACTGGAGG + Intergenic
983477949 4:168238680-168238702 AACAGCATAGTAAAGGGTGAGGG + Intronic
983942988 4:173555748-173555770 AACAACATGGATAAAACTGGAGG + Intergenic
984082443 4:175264621-175264643 AACAACATGGAAAATACCTAGGG + Intergenic
984518521 4:180772226-180772248 GACAACATGGTAATGACTATTGG - Intergenic
984560294 4:181260333-181260355 AAGAACATGGAATAGCCTGAAGG + Intergenic
984846892 4:184115784-184115806 AACAAGAGGGTAAAGAATGAAGG - Intronic
985327511 4:188788385-188788407 ATCAACATGCTAAAGGTTGAGGG - Intergenic
987208688 5:15655959-15655981 CACAAAATGATAAAGACTAAAGG - Intronic
987240052 5:15987214-15987236 AACAACATGGATAAACCTGAAGG - Intergenic
987264637 5:16240210-16240232 AACAACATGGATAAAACTGGAGG + Intergenic
987688355 5:21234017-21234039 AAACATATGTTAAAGACTGAAGG + Intergenic
987868162 5:23573591-23573613 AACAACATGGATAATACTGGAGG - Intergenic
988265002 5:28937595-28937617 AACAACATGGATTAAACTGAAGG - Intergenic
989807389 5:45626038-45626060 AGGAACGTTGTAAAGACTGAAGG - Intronic
990304575 5:54481829-54481851 CACAACATGGCAATGACTGCTGG - Intergenic
990682548 5:58261577-58261599 TTCAACATGGTATATACTGATGG - Intergenic
991098454 5:62764772-62764794 AACTATATGGTCAAGAATGATGG - Intergenic
991654335 5:68888349-68888371 AACAACATGGATAAACCTGAAGG + Intergenic
992451394 5:76879448-76879470 TACTAAATGGGAAAGACTGAGGG + Intronic
992750723 5:79858037-79858059 AACATCAAGGGAAATACTGAAGG - Intergenic
993564879 5:89461502-89461524 AACAACATGATTGAAACTGAAGG + Intergenic
994228362 5:97281925-97281947 AGCAACATGGATAAAACTGAAGG - Intergenic
994322503 5:98409458-98409480 ACCAAGATGGGAAAGACTGAGGG - Intergenic
994372345 5:98981425-98981447 AACAACATGGGTAAATCTGAAGG + Intergenic
994703246 5:103164630-103164652 AACAAGGTGGTAAAGAATTATGG - Intronic
997096383 5:130918079-130918101 AACAACATGGATAGAACTGAAGG + Intergenic
998680474 5:144461236-144461258 AAAAGCATGGAAAAGACTGATGG + Intronic
999723112 5:154413192-154413214 ACCAAAATGGTCCAGACTGATGG - Intronic
1003357667 6:5389571-5389593 ACCAAAAAGGTAAAGTCTGATGG - Intronic
1003437602 6:6106661-6106683 AACAACATGGAAGAAACTGGAGG - Intergenic
1005155683 6:22803544-22803566 AACAGCATGAGCAAGACTGAAGG + Intergenic
1005907079 6:30271950-30271972 AACAACATGGATAAATCTGAAGG + Intergenic
1008757293 6:54811361-54811383 AAAAAAATGGTAATGACTGTTGG - Intergenic
1009551378 6:65097698-65097720 AACAACATGGATAAACCTGAAGG + Intronic
1009551719 6:65104300-65104322 AACAACATTCTAAACATTGAAGG - Intronic
1009657599 6:66567105-66567127 AACAACATAGAAAAGTCTGTGGG + Intergenic
1010354442 6:74915045-74915067 CACAACATGGGAAAGAGAGAGGG - Intergenic
1012229259 6:96741224-96741246 AAAGACATTGTAAAGACAGAAGG + Intergenic
1012325890 6:97917135-97917157 AATAAAATTGTAAAGACTGAAGG + Intergenic
1012726419 6:102816901-102816923 AACAAGATGGAAGAGATTGATGG - Intergenic
1012976016 6:105781639-105781661 AACAACATGCTAGACACCGAGGG + Intergenic
1013263646 6:108472037-108472059 AACAACATGGATAAAACTGGAGG + Intronic
1013292243 6:108729480-108729502 AACAGCATGGTAAAGCCTCTGGG - Intergenic
1014328541 6:120030047-120030069 AACAACATGGATAGAACTGAAGG + Intergenic
1014331366 6:120069328-120069350 AACAACATGGATGAAACTGAAGG - Intergenic
1014375237 6:120664178-120664200 AACAACATGGATAAAAGTGAAGG - Intergenic
1014483124 6:121963298-121963320 AACAATATGGACAAGAGTGAGGG - Intergenic
1014976931 6:127898816-127898838 AACAACATGGATAGAACTGAAGG + Intronic
1014986119 6:128012501-128012523 AAAAAAATGGTAAAGATTTATGG - Intronic
1015735476 6:136394861-136394883 AACAACATGGATAAAACTGCAGG - Intronic
1016267630 6:142250905-142250927 AATAAAATAGTAAAGACCGAGGG + Intergenic
1016751929 6:147640025-147640047 AGCTTCATGGTAAAGAATGACGG + Intronic
1018975838 6:168564930-168564952 AAAAACATGTTCAAGACTGAAGG - Intronic
1020607216 7:10354577-10354599 AACAACATGGATAAAACTGGAGG - Intergenic
1020762075 7:12280274-12280296 AGCAACATTTTAAAGTCTGATGG - Intergenic
1021159491 7:17254438-17254460 AACAACATGGTTAACTCTCAAGG + Intergenic
1022276658 7:28861968-28861990 AACAAGGTGGTACAGAGTGAGGG + Intergenic
1022279034 7:28887218-28887240 AACAACATGGCAAAGGCACATGG + Intergenic
1023097077 7:36672237-36672259 TACAACATTTTAAAGACAGAAGG - Intronic
1023679044 7:42664800-42664822 AATAACCTTGTAAAAACTGATGG + Intergenic
1023884489 7:44343099-44343121 AACAAAATGCCAGAGACTGAGGG - Intergenic
1025172059 7:56768005-56768027 AACAACATGGATAAAACTGGAGG + Intergenic
1025699808 7:63807550-63807572 AACAACATGGATAAAACTGGAGG - Intergenic
1026447644 7:70499442-70499464 AACAACATGGAAGAGGCTGGCGG + Intronic
1026531068 7:71197740-71197762 AACAACATGGATAAAACTGGAGG - Intronic
1026786652 7:73305861-73305883 AGCAACATGGTAGAGGCAGAAGG + Intronic
1027858437 7:83543303-83543325 AACAACATGTTAAACATTTAAGG - Intronic
1028085616 7:86633530-86633552 AACCAAATGATGAAGACTGAAGG + Intergenic
1028399902 7:90413702-90413724 AGCAACATGTTAAAGAATGATGG + Exonic
1028719589 7:94013340-94013362 GATTACATGGTAAAGACTTAGGG - Intergenic
1029021417 7:97368705-97368727 AACAACATGGATAGGACTGGAGG + Intergenic
1030461557 7:109843004-109843026 AATAATATGGAAAAGCCTGAAGG - Intergenic
1031217497 7:118914492-118914514 AGCAACATGGATAAAACTGAAGG + Intergenic
1031305850 7:120125999-120126021 AACAAAATGCTTAAGACTGCTGG - Intergenic
1031586751 7:123539644-123539666 AGCAACTGGGAAAAGACTGAAGG + Exonic
1033429188 7:141273445-141273467 AACAAAATGTTAAACCCTGAGGG + Intronic
1035096840 7:156362634-156362656 AACAACAGTGTGAAGATTGAGGG - Intergenic
1037687328 8:21153398-21153420 AACAACATGGATGAAACTGAAGG + Intergenic
1038738226 8:30192087-30192109 AACAAAATGCCATAGACTGAGGG + Intergenic
1038800401 8:30744063-30744085 AATAACGTGGTAAATACTGACGG - Intronic
1039100174 8:33932824-33932846 AACAACATGGATGAAACTGAAGG - Intergenic
1039167096 8:34694778-34694800 AACAACATGAAAAAGACAAAGGG - Intergenic
1040996054 8:53403708-53403730 AATGATATGGTAAAGACTGCAGG + Intergenic
1041051434 8:53938816-53938838 AACAACAGGGCAGAGGCTGAAGG + Intronic
1041595319 8:59643739-59643761 AACCACATTTTAAAAACTGAAGG - Intergenic
1042009108 8:64219728-64219750 AACAACATGGATAAACCTGAAGG + Intergenic
1043374071 8:79627898-79627920 GACAACATGGATAAGCCTGAAGG - Intronic
1045831782 8:106470466-106470488 ACCAAGATGGGAAAGACTGGGGG + Intronic
1045958337 8:107936239-107936261 AATAACATGGTTAAAACTGGAGG - Intronic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1046664161 8:116980697-116980719 CAGAACAAGGTAAAGAATGAAGG + Intronic
1049910199 9:258555-258577 AACAACATGGTAATGATGAAAGG + Intronic
1050438445 9:5634021-5634043 AACAACATGGACAAAACTTAAGG - Intronic
1051375516 9:16398542-16398564 AGCAACGTGGTCAAGCCTGATGG + Intergenic
1053208497 9:36208020-36208042 AACAAAATGGGAAAGAAGGAAGG + Intronic
1055727743 9:79249767-79249789 AACAACATGGTTGAAGCTGAAGG + Intergenic
1057954678 9:99398125-99398147 AACAACTTGCAACAGACTGAAGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1059107344 9:111523162-111523184 ACCATCATGGTAAGGAGTGATGG - Intergenic
1059625771 9:116064015-116064037 AACACCATTTTAAAGAATGAGGG - Intergenic
1059719981 9:116950551-116950573 AAGAACATAGCAAATACTGAAGG + Intronic
1061687984 9:132299222-132299244 AACAAGATGGGAAAGAATGAAGG + Intronic
1186084985 X:5977814-5977836 AATGTCATGGAAAAGACTGAGGG - Intronic
1186404794 X:9292528-9292550 AACAACATTCTAAAGACTCGAGG + Intergenic
1188294195 X:28426444-28426466 CACAATATGGTAAATATTGATGG + Intergenic
1188416546 X:29942251-29942273 AACAAGATTGAAAAGACTGCTGG - Intronic
1188507667 X:30900091-30900113 AACAACATCCTATAGAGTGATGG - Intronic
1188698398 X:33226900-33226922 AACTACATTGTGAAGCCTGATGG + Intronic
1188706775 X:33343386-33343408 AACAACATGGATAGAACTGAAGG + Intergenic
1188831956 X:34909342-34909364 AACAACATGGTTAGAACTGAAGG - Intergenic
1189084063 X:38001593-38001615 AACAACATGGAAGAAACTGGAGG - Intronic
1189186002 X:39055726-39055748 CACAACATCGAAAAGAGTGATGG - Intergenic
1189527957 X:41846271-41846293 AACAACATGGATAGGACTGGAGG + Intronic
1190135765 X:47796180-47796202 AACAAAATGCCATAGACTGATGG - Intergenic
1190602509 X:52107332-52107354 AACAACATGGATGAAACTGAAGG - Intergenic
1191069769 X:56388326-56388348 AACAATTTGGTAAGGACTGGGGG - Intergenic
1191767790 X:64719017-64719039 AGCAACATGGATAAGACTGGAGG + Intergenic
1191963075 X:66725202-66725224 AACAACATGGATGAGACTGGAGG + Intergenic
1192495044 X:71610711-71610733 AACAAGATGGTGAAAACTGCTGG + Exonic
1192893277 X:75412771-75412793 AACAACATGGATGAGACTGGAGG + Intronic
1193055127 X:77141958-77141980 AACAACGTGGGTAAGACTGGAGG - Intergenic
1193278182 X:79615872-79615894 AAAATCATCGTAAATACTGAAGG + Intergenic
1193459252 X:81771046-81771068 AACAACATGGACAGAACTGAAGG + Intergenic
1193498758 X:82245484-82245506 AACAACATGGATGAAACTGAAGG + Intergenic
1193681581 X:84525854-84525876 AACAACATGGATAAACCTGAAGG + Intergenic
1193765300 X:85521486-85521508 AACAACATGGATAAAACTGGAGG - Intergenic
1194068552 X:89291905-89291927 AACAACATGGATAGAACTGAAGG - Intergenic
1194072348 X:89341406-89341428 AAAAAAATTGTAAAAACTGATGG + Intergenic
1194268433 X:91781539-91781561 CGCAACTTGGTAAAGACTGACGG + Intronic
1194385639 X:93250814-93250836 TACAACTTGGAAATGACTGATGG + Intergenic
1194678027 X:96816921-96816943 AACAACATGGCAAGAACTGGAGG + Intronic
1195196900 X:102506815-102506837 AAGAATTTGGTAAAGACTGATGG - Intergenic
1195434866 X:104830585-104830607 AACAACATGGACAAAACTGATGG - Intronic
1196136715 X:112217803-112217825 GACACCATGATAAAGAATGAGGG - Intergenic
1196144241 X:112299099-112299121 AGCATCATTGAAAAGACTGAGGG - Intergenic
1196433264 X:115650903-115650925 TAGAACATTGAAAAGACTGAGGG - Intergenic
1197161720 X:123331045-123331067 AGAAACATGGTTAAGACTGAAGG - Intronic
1198011153 X:132555755-132555777 AACAACATGGATCAGCCTGAAGG - Intergenic
1198965026 X:142218357-142218379 AGCAACATGGTTGAAACTGAAGG + Intergenic
1199948903 X:152689797-152689819 AACAAAATGCTATAGACTGGGGG - Intergenic
1199960773 X:152778652-152778674 AACAAAATGCTATAGACTGGGGG + Intergenic
1200168405 X:154053181-154053203 AACAAAATAGTACAGACTGGGGG + Intronic
1200426134 Y:3022352-3022374 AACAGCATGGTAAGGCCTCATGG - Intergenic
1200585632 Y:5002452-5002474 CGCAACTTGGTAAAGACTGACGG + Intronic
1200726590 Y:6677152-6677174 AAAAAAATTGTAAAAACTGATGG + Intergenic
1200727742 Y:6692928-6692950 AAAAAAATTGTAAAAACTGATGG + Intergenic
1201260385 Y:12153391-12153413 AACACCAAGTTAAAGAATGAAGG + Intergenic
1201502759 Y:14663167-14663189 AACAACATGGATAAAACTGGTGG - Intronic
1201965025 Y:19723257-19723279 ACCGACATGCTGAAGACTGAGGG + Intronic