ID: 955275190

View in Genome Browser
Species Human (GRCh38)
Location 3:57540495-57540517
Sequence AAGAACAAGGATAAGTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 347}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955275187_955275190 -6 Left 955275187 3:57540478-57540500 CCATAAACTAAACCTGGAAGAAC 0: 1
1: 0
2: 7
3: 297
4: 9253
Right 955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG 0: 1
1: 0
2: 2
3: 26
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955275190 Original CRISPR AAGAACAAGGATAAGTATTC AGG Intronic
901295523 1:8158232-8158254 AAGAACACAGATAAGCAATCAGG - Intergenic
907080764 1:51619466-51619488 AAAAAGAAGGATAAGCATTGAGG - Intronic
907779851 1:57556791-57556813 AAAAACAAGGATAAATATATGGG - Intronic
908667144 1:66506025-66506047 AAGAACAATGATTAGAATTACGG + Intergenic
908994221 1:70132422-70132444 AAGAAAAAAGAAAAGTACTCTGG - Intronic
909043686 1:70685104-70685126 AAGAACCAGTGTAAGAATTCTGG - Intergenic
909250896 1:73354794-73354816 AAGAATAAGGAAAAATATTTGGG + Intergenic
909264313 1:73537215-73537237 AAGAACAAGCACAAGAATTTTGG - Intergenic
909715326 1:78701172-78701194 AAGAACAAGCACAAGAATTCTGG - Intergenic
910129279 1:83884295-83884317 AAGCACAGGAAAAAGTATTCAGG + Intronic
910391116 1:86745652-86745674 AAGAACAAGCATATATATTGTGG - Intronic
910653221 1:89592186-89592208 AGGAACAAGAGTAAATATTCAGG + Intronic
910655810 1:89616769-89616791 AAGAACAAGCATTAGCATTCAGG - Intergenic
910830397 1:91455336-91455358 AAGAATAAGGATAACTAACCAGG + Intergenic
911450169 1:98052403-98052425 TAAAACAGAGATAAGTATTCAGG - Intergenic
912339879 1:108902838-108902860 AATCTCAAGGATAGGTATTCTGG - Intronic
912567967 1:110602179-110602201 AAGAACAGGGATAGGTAGGCTGG + Exonic
912652891 1:111455906-111455928 AAGAACAAAGATATGGACTCAGG - Intronic
913374970 1:118140981-118141003 AAGAGCAAGGGAAAATATTCAGG - Intronic
914760536 1:150594958-150594980 AAGAGAAAGGATAAGTGTTAGGG + Intergenic
915583248 1:156828901-156828923 TAGAACAATGATAATAATTCCGG - Intronic
916253948 1:162767084-162767106 AAGAATAAGCAGAAGTATTAAGG + Intronic
916277764 1:163013699-163013721 AGGAACCAGAATAAGAATTCTGG - Intergenic
916327030 1:163573938-163573960 TAGAGCCAGGATAAGAATTCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
920088550 1:203435698-203435720 AAGAACAACGAGATATATTCGGG - Intergenic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921440536 1:215181441-215181463 AAGAACCAGGGCAAGAATTCTGG - Intronic
922952054 1:229567160-229567182 AAGAAAAAGGATAAAAATACAGG + Intergenic
924222407 1:241891581-241891603 AAGAGCAAAGATAAGATTTCTGG + Intronic
1066458470 10:35592927-35592949 AAGGAAAAGGATTAGTGTTCAGG + Intergenic
1067894640 10:50165773-50165795 CAGAACAAGGACAAGAATTCAGG + Intergenic
1067954204 10:50774488-50774510 CAGAACCAGGACAAGAATTCAGG - Intronic
1068254950 10:54497351-54497373 AAGAACCAGCACAAGAATTCTGG + Intronic
1069009191 10:63352327-63352349 AATAAAAAGGATAAGTAAACTGG + Intronic
1071230297 10:83578855-83578877 AAGAACCAGCATAAGAACTCTGG - Intergenic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072205626 10:93202774-93202796 AAAAACAGGGATAAGTATAAAGG - Intergenic
1072393299 10:95012110-95012132 ATTAAGAAGGATAAGTTTTCTGG + Intergenic
1072435479 10:95410940-95410962 AACAAAGAGGATAAGCATTCCGG - Intronic
1072896998 10:99376016-99376038 AAGAACCTGGCTAAGCATTCAGG + Intronic
1076362396 10:129898474-129898496 CAGAACAAGGAGAGGAATTCAGG - Intronic
1077302488 11:1853738-1853760 AAGGACAAGGCCAAGGATTCTGG + Intronic
1077792841 11:5460669-5460691 AAGAACCAGGGAAAGAATTCTGG - Intronic
1078361363 11:10670601-10670623 AAGAACTAGGAGGAGTATTGGGG - Intronic
1078464551 11:11540583-11540605 AAGATCAGGGATCAGTTTTCAGG - Intronic
1079256222 11:18833769-18833791 AAGAACCAGTACAAGAATTCTGG - Intergenic
1079993885 11:27274897-27274919 AAGAAAAAGGATAAATATACTGG + Intergenic
1080740481 11:35059379-35059401 CAGAAAAAGGATTAGAATTCAGG - Intergenic
1082128144 11:48456142-48456164 AGGAACCAGCATAAGAATTCTGG - Intergenic
1082129258 11:48468436-48468458 AAAAACATGGATAAGTCTGCAGG - Intergenic
1082247821 11:49945250-49945272 AAGAACATGGATAAATCTGCAGG + Intergenic
1083062050 11:59883999-59884021 AAAACCAAGGTTAAGGATTCTGG + Intergenic
1083918648 11:65767520-65767542 AGGATCAAGGATAATTATTACGG + Intergenic
1084911560 11:72393814-72393836 ACTAACAAGGATAAGTATATGGG - Intronic
1086589571 11:88496100-88496122 AAGAGCAGGCATAAGTGTTCTGG - Intergenic
1087559373 11:99765843-99765865 AAGAACATGGATCTGTATTCTGG + Intronic
1087584207 11:100097423-100097445 TAGAAAAAGAATAAGTTTTCTGG + Intronic
1088064618 11:105701020-105701042 AAGAACAAGCATAAGTTACCAGG - Intronic
1089078312 11:115756633-115756655 CAGAGAAAGGATAAGCATTCGGG - Intergenic
1089701675 11:120248341-120248363 AGGGACAAGGATAAATTTTCAGG - Intronic
1090586462 11:128218548-128218570 AAGAAAAAGGAAAATCATTCTGG - Intergenic
1091877955 12:3952221-3952243 AAGAAGAATGATAACTATGCCGG - Intergenic
1092020766 12:5200627-5200649 AAGAACAAGGTAAATTGTTCTGG - Intergenic
1093395964 12:18682748-18682770 AAGAACTAGCATAAGAATGCAGG + Intergenic
1094365001 12:29670945-29670967 AAAAAAAAGGATAGGAATTCAGG + Intronic
1095819297 12:46459988-46460010 AAGACCAAGGATTTGTATCCAGG - Intergenic
1096101580 12:48973242-48973264 AAGAAAAAGGATAAGGACACTGG - Intergenic
1096976983 12:55705081-55705103 TAGAACAAGGATAACTTATCTGG - Intronic
1097512718 12:60564405-60564427 AAGAACCAGCAAAAGAATTCTGG - Intergenic
1098458406 12:70703089-70703111 AATAACAAGCATAATTATTGTGG - Intronic
1104169864 12:126269634-126269656 AAGAACAAGTAGAAGTTTACTGG + Intergenic
1104227910 12:126854464-126854486 AACAACAAGCTTAAGTGTTCAGG - Intergenic
1105784649 13:23736519-23736541 AAGTACTAGGGTAATTATTCTGG + Intronic
1105786561 13:23756034-23756056 AAGTACCAGGATAAAGATTCAGG - Intronic
1105813193 13:24011885-24011907 AAGAAGAAGGCTGAGCATTCTGG - Intronic
1106157690 13:27172517-27172539 AAGAAGAAAGATAAGTAATGGGG + Intergenic
1106338631 13:28807452-28807474 AAGATCAAGCATAAGTCATCTGG + Intergenic
1107583593 13:41819276-41819298 AAGAACATGGTTAAGAATTCTGG + Exonic
1108626778 13:52236646-52236668 AAGAACCAGTACAAGAATTCTGG + Intergenic
1108659291 13:52569812-52569834 AAGAACCAGTACAAGAATTCTGG - Intergenic
1109441117 13:62376177-62376199 AAGAACAACGACAGGCATTCAGG + Intergenic
1110573307 13:77028654-77028676 AAGGACAATGATAATTATTAAGG + Intergenic
1111143569 13:84153970-84153992 AAGAACCAGTAAAAGCATTCTGG - Intergenic
1111338172 13:86848457-86848479 AAGAACCAGCATAAGAACTCTGG + Intergenic
1111438912 13:88251930-88251952 AGGAAAAAGGCTAAGTGTTCAGG - Intergenic
1111682844 13:91465342-91465364 AAGATCTAGGGTAACTATTCGGG - Intronic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1112993102 13:105538010-105538032 ATGAACTAGGATAGCTATTCAGG - Intergenic
1113084491 13:106554327-106554349 AAGAAGAATGAGAAGCATTCTGG - Intronic
1113290294 13:108898308-108898330 TAGAACAAGGATCAATACTCAGG + Intronic
1114852228 14:26395003-26395025 AAGAACAAGGATCATCAATCAGG - Intergenic
1114938427 14:27574008-27574030 AAGAACCAGATTAAGAATTCTGG + Intergenic
1115002182 14:28436222-28436244 TAGAATAAGGACAAGAATTCAGG + Intergenic
1115211953 14:30976292-30976314 CAGAACCAGGATAATTATCCAGG + Intronic
1115453906 14:33579458-33579480 TAAAACAAGAATAATTATTCAGG + Intronic
1116089417 14:40285872-40285894 CAGATCAAGGATACATATTCAGG - Intergenic
1117767079 14:59094507-59094529 AAGAGCACAGATAAGTAATCTGG + Intergenic
1118924716 14:70181607-70181629 AAGAACAAGGACAAGTCTTAGGG + Intronic
1119858569 14:77920112-77920134 AAAAACAAAGATAAGTAGACAGG - Intronic
1121620428 14:95344033-95344055 AAGAATAAGAATAAGGATCCAGG + Intergenic
1121869916 14:97397629-97397651 ATGAACAAGGATGAAAATTCAGG - Intergenic
1122332280 14:100929919-100929941 TAGACCAATGATGAGTATTCTGG + Intergenic
1122948325 14:105024839-105024861 AAGAAAAAAGAAAAGTATTAAGG + Intergenic
1202894209 14_KI270722v1_random:188690-188712 AAGAAGAAGTAGAAGAATTCAGG - Intergenic
1123451177 15:20360366-20360388 AACAACAAGGATATCTCTTCTGG - Intergenic
1123897853 15:24846639-24846661 CAAAAGAAGGATTAGTATTCAGG + Intronic
1124115382 15:26838059-26838081 AGGAACAAAGATAAGCATTACGG - Intronic
1124806664 15:32890750-32890772 AAAAACAAAGATAAGTAGTTGGG - Intronic
1125316680 15:38440218-38440240 AAAAACAAGCATAAAAATTCTGG - Intergenic
1125692545 15:41608100-41608122 AAGATGAAGGATGAGTGTTCAGG - Intergenic
1125914797 15:43476295-43476317 AAGCAGAAGTATAAGGATTCTGG - Intronic
1126841540 15:52722042-52722064 AAGCCCAAAGATAAGAATTCTGG - Intergenic
1126866931 15:52947030-52947052 AAGAACAAAGACAAGTTCTCTGG - Intergenic
1127915949 15:63455298-63455320 AAAAACAAGGATAAATTTTATGG - Intergenic
1131919445 15:97307978-97308000 AAGAGCAAGGAAATTTATTCGGG - Intergenic
1133312724 16:4860692-4860714 AAGAAGAAGAAGAAATATTCTGG + Exonic
1133732065 16:8586492-8586514 AAAAAGAATGATAAGAATTCCGG - Intronic
1134369784 16:13612326-13612348 AAGAAAAAGTATAAGTATCCAGG - Intergenic
1134873021 16:17668724-17668746 ATAAACAAGGATCAGTACTCAGG + Intergenic
1135051201 16:19194422-19194444 AAGACCAAGGAGAAGTACCCAGG - Intronic
1135805740 16:25540859-25540881 AAAAAGAAGGAAAAGGATTCTGG + Intergenic
1138744672 16:59349169-59349191 AAGAGCAAGGATAGCAATTCTGG + Intergenic
1138970761 16:62140453-62140475 AAGAGCAAGGGAAAGTTTTCTGG + Intergenic
1139024706 16:62801043-62801065 AAGAAAAAAGATGAATATTCGGG + Intergenic
1139715798 16:68812034-68812056 AAGCACATGGTTAAATATTCTGG + Intronic
1139730963 16:68944863-68944885 AAGAACAAAGATAAGTTTAGAGG + Intronic
1140621623 16:76740933-76740955 AAGAACAAGTGTAAGAATTCTGG + Intergenic
1145913048 17:28553578-28553600 AAAAACAAGGATTTGAATTCAGG + Exonic
1146623467 17:34418517-34418539 AAGTACAAGGCTGAGTATGCGGG - Intergenic
1148909887 17:50935745-50935767 AATAACAAGGAAAAATAATCAGG + Intergenic
1148956440 17:51357657-51357679 AAAAAAAAAGATAAGTATTGAGG - Intergenic
1149015190 17:51901101-51901123 AAGAACCAGGATAAGAACTCTGG - Intronic
1149395696 17:56240209-56240231 AAAAACAAGGATAAGCATACAGG - Intronic
1150940456 17:69687740-69687762 AAGAACCAGGGTAAGAACTCTGG - Intergenic
1153000081 18:446965-446987 ATGATCAAGGATAACTGTTCAGG - Intronic
1153513625 18:5882907-5882929 AAGCAGAAGGATTAGTATTTAGG + Exonic
1154371478 18:13766498-13766520 AAGAACCAGCACAAGAATTCTGG + Intergenic
1156576741 18:38325874-38325896 AATATGAAGGAAAAGTATTCTGG - Intergenic
1157770661 18:50343005-50343027 AAGAGCAAGGAAAATTATTAGGG - Intergenic
1161128088 19:2571386-2571408 CAGAACAAGGATAAGGATATAGG - Intronic
1162318610 19:9957217-9957239 ATGAATGAGGACAAGTATTCAGG + Intergenic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163689233 19:18729845-18729867 AAGAACGAGGATAAGGAGTGTGG - Intronic
1164483518 19:28634148-28634170 AAGAATCAGCATAAGAATTCTGG + Intergenic
1166182553 19:41119140-41119162 AAGAATGAAGATGAGTATTCAGG + Intronic
925079109 2:1047440-1047462 AAGAACCAGCACAAGAATTCTGG - Intronic
926485796 2:13455955-13455977 AACAACAAGGATATCTCTTCTGG + Intergenic
927165789 2:20319914-20319936 AAGAACAAGGAGATGAATTTTGG + Intronic
927240596 2:20916862-20916884 AAGAACAAAGAAGTGTATTCTGG + Intergenic
928799428 2:35068575-35068597 AGGAACAAGCACAAGAATTCTGG + Intergenic
930268281 2:49225588-49225610 AAGAAAATGGATAAGTTTTATGG + Intergenic
930598986 2:53422856-53422878 AAGAACCAGCACAAGAATTCTGG - Intergenic
932534543 2:72579185-72579207 AAGAATAACTACAAGTATTCTGG + Intronic
932792795 2:74670574-74670596 AAAAACAATCATAAATATTCTGG - Intronic
932883240 2:75523735-75523757 GAGAACAAAGATAAGAATTAAGG - Intronic
933362846 2:81309730-81309752 AAGAACCAGGCTAAGAACTCTGG + Intergenic
933463283 2:82616629-82616651 AAGAAAAAGCATAAATATTAGGG + Intergenic
933629687 2:84641609-84641631 AAGAACAAGGCAAGATATTCTGG + Intronic
935442431 2:103117079-103117101 AAGAAGGAGTTTAAGTATTCAGG - Intergenic
936407703 2:112221953-112221975 AAGAACCAGCATAAGAACTCTGG - Intronic
936650764 2:114423454-114423476 AAGAACTAGGTCATGTATTCTGG + Intergenic
936692921 2:114913627-114913649 AAGAACCAACATAAGAATTCTGG + Intronic
937537581 2:122909854-122909876 AAGAATAAGGATAAAAATTAAGG - Intergenic
937572563 2:123381571-123381593 AAGAACCAGAATAACAATTCTGG + Intergenic
937861912 2:126718089-126718111 AAGATCAGGGAGAAGTGTTCTGG - Intergenic
938710099 2:133968759-133968781 AAGAAGAAGGAGAAGTTTTGAGG - Intergenic
939373404 2:141331863-141331885 TAGAACAAGGGTAATTAGTCTGG - Intronic
940614070 2:156028775-156028797 AAGAATAAAAATAATTATTCTGG - Intergenic
941884829 2:170517127-170517149 AAGAACAGGGAGAAGGATTTGGG - Intronic
943088919 2:183351118-183351140 AAGAACACAGATATGGATTCAGG - Intergenic
944975488 2:205045221-205045243 AATAATAATGATAAGTATTCAGG - Intronic
945449381 2:209976257-209976279 AAGCACAAAGATGGGTATTCGGG - Exonic
945519647 2:210809201-210809223 CAGAACAATAAAAAGTATTCAGG - Intergenic
947452857 2:230224399-230224421 AACAAGAAGGAAAAGTATGCTGG - Intronic
947674566 2:231966151-231966173 AAGAAGAAGAAGAAGAATTCTGG - Intronic
947985392 2:234443470-234443492 AACAACAAGAATAAGTTTGCAGG - Intergenic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1169128667 20:3150505-3150527 AAGAAAAAGAATAAGCATTAAGG - Intronic
1169665532 20:8031333-8031355 AAGCACAAGGACAAATATTTTGG + Intergenic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1170045531 20:12081239-12081261 AAGATTAAGGAGAAGTATTCTGG - Intergenic
1170916826 20:20634675-20634697 AAGAACAGGGATAGGAAGTCTGG - Intronic
1171169730 20:23005094-23005116 AAGAACAATGAGAAGGATTAGGG + Intergenic
1173294663 20:41746550-41746572 AGGAACCAGCATAAGAATTCTGG - Intergenic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1175304248 20:57965140-57965162 GAGAACAAGGATGATTCTTCTGG - Intergenic
1177039697 21:16093299-16093321 AGGAACAAAGATAAGAATTACGG - Intergenic
1177153115 21:17474340-17474362 ATGAACAAAGATAAGTGTTGTGG + Intergenic
1177279144 21:18956548-18956570 AAGAACAAGTGGAAGTATTTTGG - Intergenic
1177296886 21:19187353-19187375 AAGAAAAAGACTAAATATTCTGG - Intergenic
1177333025 21:19685211-19685233 AAGAACAAGGATAATATTACAGG - Intergenic
1177663553 21:24121318-24121340 AAGAAAATGTATAAATATTCAGG + Intergenic
1177674489 21:24278929-24278951 GAGCAAAAGGAGAAGTATTCTGG + Intergenic
1181429371 22:22868849-22868871 AAGAATAAGGATAATGATTAGGG + Intronic
1181911590 22:26242601-26242623 AAGAACAATTATTATTATTCTGG + Intronic
1183920943 22:41167745-41167767 AAGTACAAGGATTAGGATTATGG + Intronic
949971438 3:9409247-9409269 AAAAATAAGGGTGAGTATTCCGG - Intronic
950324047 3:12088397-12088419 AAGACAAAAGATAAGTATTGGGG + Intronic
951823461 3:26840571-26840593 AAGAATAAGGTAATGTATTCAGG - Intergenic
952075460 3:29691335-29691357 CAGGTCAAGGGTAAGTATTCTGG - Intronic
952172551 3:30824438-30824460 AAGAGGAAGGAAAATTATTCCGG + Intronic
952734791 3:36678145-36678167 AAGAAAAAAGATAAATTTTCAGG + Intergenic
954485828 3:50850571-50850593 AAGAACCAGGGCAAGAATTCTGG - Intronic
954763006 3:52890687-52890709 AAGGAAAAGGATAATTCTTCTGG + Intronic
955275190 3:57540495-57540517 AAGAACAAGGATAAGTATTCAGG + Intronic
955477126 3:59348823-59348845 AAAAACAAAGATAAATATTTCGG - Intergenic
956525382 3:70153886-70153908 AAAAAGTAGAATAAGTATTCTGG - Intergenic
957347827 3:78984644-78984666 AAGAACAAGGAAAACCTTTCTGG - Intronic
957356479 3:79094587-79094609 ATGCTCAAGGATAAGTAGTCAGG + Intronic
957538528 3:81537797-81537819 AAGAATAAGCATAAGCATGCAGG - Intronic
957813541 3:85260244-85260266 AAGCAAAAGCCTAAGTATTCAGG + Intronic
958568077 3:95840894-95840916 AAAAAAAAGGATAAATTTTCTGG - Intergenic
958942023 3:100327363-100327385 AAAAACAAAGATAAATATTTGGG + Intergenic
958985169 3:100772034-100772056 AACAACAAAGATAAGGATTGTGG + Intronic
959191340 3:103115180-103115202 AAAAACAAGGAGAAGAATTCAGG + Intergenic
959324793 3:104922983-104923005 AAAAACCAGGAAATGTATTCAGG - Intergenic
959362847 3:105416148-105416170 AAGGATAAGGATAAGTCTTAAGG + Intronic
959738418 3:109687657-109687679 AAGAGCATGGAGAAATATTCTGG + Intergenic
960316537 3:116185344-116185366 AAGAGCAAGTATCAATATTCAGG - Intronic
960583418 3:119299536-119299558 AAGAACAAGGATAAGGCAACGGG + Intronic
960860166 3:122143713-122143735 AAGAACAACGATAAGTGTAGTGG - Intergenic
961264231 3:125627983-125628005 AAAAACAAAGATAAATATTTGGG - Intergenic
962617734 3:137144340-137144362 AAGAACAAGGATAGCAATTCTGG - Intergenic
963390115 3:144650938-144650960 AAGAACTATGCTAAGTATTAGGG - Intergenic
963685546 3:148429295-148429317 AAGAAAATAGACAAGTATTCAGG - Intergenic
964057883 3:152484068-152484090 AAGAAAGAGCATAAGAATTCTGG - Intergenic
964190047 3:153991171-153991193 AAAAACAAAGATAAGTAGTCGGG + Intergenic
964206758 3:154183486-154183508 AAGCAAAAGTAAAAGTATTCTGG - Intronic
964299456 3:155271657-155271679 AGGAACAAGGAAAACAATTCTGG + Intergenic
965715627 3:171599479-171599501 AAAGACAAGAAAAAGTATTCTGG - Intergenic
965879736 3:173374131-173374153 ATGAATATGGATAAGTATGCAGG + Intergenic
966519412 3:180856354-180856376 AGGAACCAGCATAAGTATTCTGG + Intronic
966539025 3:181068453-181068475 AAGAACAAGGTTTATTATTGTGG + Intergenic
966614167 3:181896462-181896484 AAGAACAAGGCGAAATATTAAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966859340 3:184220793-184220815 AAGATGAAGGATAAGTTTTCAGG - Intronic
967140817 3:186557898-186557920 AAGAACAAGTAAAAATATTTTGG + Intronic
967741160 3:193003744-193003766 AAAAACAAAGATAAGTAGTTGGG - Intergenic
968807363 4:2784067-2784089 AAGAACCAGGAAAACAATTCTGG - Intergenic
970682941 4:18532461-18532483 CAGAACTAGGATGAGAATTCTGG + Intergenic
970746578 4:19305292-19305314 ATGAACAAGGATGAGAATTAGGG - Intergenic
970826182 4:20278880-20278902 CAGAAGAAGAATAAGTATTTAGG + Intronic
970915647 4:21331045-21331067 ATGAACAAGGACAACTATTAGGG - Intronic
971632343 4:29009715-29009737 AAGAAGAAAGATATTTATTCAGG - Intergenic
972186751 4:36537841-36537863 AAGAACAAGGAAGATTATTAAGG - Intergenic
973099548 4:46247996-46248018 AATAACAGTGATAAGTTTTCTGG + Intergenic
974313457 4:60244525-60244547 AAAAAAGAGGATAAATATTCAGG - Intergenic
975955089 4:79827336-79827358 AAGAACAGTGTTAAGTATCCTGG + Intergenic
975967161 4:79987050-79987072 AAGAACCAGCACAAGAATTCTGG + Intronic
976961970 4:90988371-90988393 AAGAACAAGCTTAAATATCCTGG + Intronic
977182465 4:93893822-93893844 GAGGCCATGGATAAGTATTCTGG - Intergenic
977276451 4:94983024-94983046 AAGAACAATCTTTAGTATTCAGG - Intronic
977318240 4:95478308-95478330 AAGAATAAGGACAAGGATTGGGG + Intronic
977989452 4:103423177-103423199 CATAACAAGGATATGGATTCTGG - Intergenic
979291864 4:118987050-118987072 AAGAACAATGATAAGGATAATGG - Intronic
979527669 4:121734566-121734588 AAGAAAACTGAAAAGTATTCAGG + Intergenic
979596487 4:122540659-122540681 AAGAAAAAGAATAAGTCCTCAGG + Intergenic
979906716 4:126302351-126302373 AAGATATAGGAAAAGTATTCAGG - Intergenic
979960259 4:127011013-127011035 AATAACAAGGATTAGCATTTAGG + Intergenic
980576283 4:134687247-134687269 AAGAACAAGCACAAGAACTCTGG - Intergenic
980694605 4:136338315-136338337 AAGAACCAGTATAAGAACTCTGG + Intergenic
981082573 4:140649767-140649789 AGAAACAAGGATATGAATTCAGG + Intronic
981584015 4:146280917-146280939 AAGAGCCAGGATGAGTATTTAGG + Intronic
981653387 4:147084464-147084486 AGGAACTATGATAAGTATTAGGG - Intergenic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983400305 4:167255414-167255436 AAGAACAAAGATAAGTTTGCAGG + Intergenic
984086594 4:175320605-175320627 CAGAACAAAAATAAGTATTTTGG - Intergenic
984174647 4:176401485-176401507 AGGAACAAAGATAAATATTTTGG + Intergenic
986985193 5:13493355-13493377 AAGAACCAGTATAAGAACTCCGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
989214876 5:38893256-38893278 AGGAAAAAGCATAAGAATTCTGG + Intronic
989232948 5:39107095-39107117 AAGAAAAAGGAAAATCATTCAGG - Intronic
989245684 5:39251625-39251647 AAAAAAAAGGATTAGTATACAGG - Intronic
989510038 5:42275753-42275775 AAGAACTGGGAAAAATATTCTGG - Intergenic
991375956 5:65967107-65967129 AAGAAAAAGAAAAAATATTCTGG + Intronic
991924299 5:71689044-71689066 AAAAACAAGGATAAATAGTTGGG + Intergenic
993191051 5:84681944-84681966 GAGAACAAGGATCAGTAATGTGG - Intergenic
993720559 5:91317674-91317696 AATAACAATGGTAGGTATTCTGG + Intergenic
994413845 5:99443091-99443113 CAGAACAAGAATAATCATTCGGG + Intergenic
995068002 5:107883907-107883929 AGGAGCAAGGATAGGTATGCTGG + Intronic
995783074 5:115798315-115798337 AAGTCCAAGGGTAAGTAATCAGG - Intergenic
996249901 5:121316981-121317003 AAGAACAAGTACAAGAACTCTGG - Intergenic
996979072 5:129468107-129468129 AAGAACAAGGCTAAATATATAGG + Intronic
998051808 5:139042183-139042205 AAGGACAAGGACAAGGATTCCGG + Intronic
998902061 5:146866738-146866760 AGGAATCAGGTTAAGTATTCTGG - Intronic
999426712 5:151493926-151493948 AACAACAAGCAGAAGTATTTTGG - Intergenic
999654483 5:153798833-153798855 AAGAACAAGGAGAAATATAGGGG + Intronic
1000078037 5:157813098-157813120 AAGAACAAAGACAAGTATGTTGG - Exonic
1000281516 5:159786483-159786505 AAGAACAAGGATTTGAATTGGGG - Intergenic
1000393487 5:160749072-160749094 AAGAACATGGATTTGGATTCAGG - Intronic
1001162624 5:169334683-169334705 AAGAGAAGGTATAAGTATTCTGG - Intergenic
1001733736 5:173981452-173981474 AAACACCTGGATAAGTATTCGGG + Intronic
1001869909 5:175143502-175143524 CAGAACAAGGAAAACTATTAGGG + Intergenic
1002646100 5:180656279-180656301 AAAAAAAAGAATATGTATTCTGG + Intergenic
1003441220 6:6144364-6144386 ATGAACAGTGATAAGTATACTGG - Exonic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1005189718 6:23206868-23206890 GAGAATAAGAATGAGTATTCAGG + Intergenic
1005880979 6:30060846-30060868 AAAAACAAAGCTAAGTGTTCTGG - Intronic
1008040446 6:46792258-46792280 TTGAATAAGAATAAGTATTCAGG - Intergenic
1008059334 6:46980493-46980515 AAGAAAAATGATCAGAATTCTGG - Intergenic
1008120812 6:47615093-47615115 AAGAAATAGGGTAAGTAATCAGG - Intronic
1009787410 6:68357840-68357862 AGGAACCAACATAAGTATTCAGG - Intergenic
1010568700 6:77451423-77451445 AAGAACAATAATAAGTATACTGG - Intergenic
1010654991 6:78502212-78502234 AAGAACCAGCACAAGAATTCTGG - Intergenic
1012333916 6:98030049-98030071 AAGAACAAGGATAAATAATTTGG - Intergenic
1012874534 6:104710989-104711011 AAGAACAATGAAAGGTATTTTGG - Intergenic
1014525487 6:122496295-122496317 AAGAACTAGTATAAGAATTCTGG + Intronic
1015509303 6:134022166-134022188 AAGAACATGGATTAGCTTTCAGG + Intronic
1016401296 6:143683662-143683684 AAGGAAATGGATAAATATTCTGG - Intronic
1019649654 7:2149998-2150020 AAGAACAAGGATGGGTCCTCGGG - Intronic
1020125028 7:5528802-5528824 AAGAACACGGCTAAGTGTGCTGG + Intronic
1020541568 7:9465306-9465328 AAGAACAAGTGCAAGGATTCTGG - Intergenic
1021473679 7:21035710-21035732 AAAAACAAGGATAAGTAGCTGGG - Intergenic
1022048878 7:26645699-26645721 CAGCACAAGGATGAGAATTCAGG - Intronic
1022392078 7:29951893-29951915 AAGTACCAGGATAAGTATAGGGG + Intronic
1023238395 7:38115333-38115355 AAGAACATGAAGAAGTATTTAGG - Intergenic
1024098814 7:46008015-46008037 AATAACAAGAATAAGTAGGCTGG - Intergenic
1024172724 7:46807072-46807094 GAGAACAAGAATAAATGTTCTGG - Intergenic
1025638398 7:63345268-63345290 AAGAATAAAAATAAGTTTTCAGG - Intergenic
1025644298 7:63402821-63402843 AAGAATAAAAATAAGTTTTCAGG + Intergenic
1025713888 7:63935885-63935907 AAGAATAAAAATAAGTTTTCAGG + Intergenic
1027943294 7:84712494-84712516 AAGAGCAAGAATTAGTATTCTGG + Intergenic
1030082504 7:105789748-105789770 AAGAACAATGAGAAGTACTGGGG + Intronic
1030949000 7:115765837-115765859 AATAACAAGAATAAGTTTCCTGG + Intergenic
1031302807 7:120084711-120084733 AATAAGAAGGATAGGTACTCAGG + Intergenic
1031453636 7:121952926-121952948 AAGGAAAAGGGTCAGTATTCAGG + Intronic
1032612582 7:133431106-133431128 TAGAACAAGGACTAGAATTCTGG + Intronic
1033516000 7:142106889-142106911 AAGAAAAAGGATAATTATAAAGG - Intergenic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1033965141 7:146966216-146966238 ATGAACAGGAAGAAGTATTCTGG + Intronic
1035076015 7:156178064-156178086 AAGAAAAGAGAAAAGTATTCGGG + Intergenic
1035086276 7:156261254-156261276 AAGAGAAATGATAAGTATGCGGG + Intergenic
1041445509 8:57947786-57947808 AAGAACCAGCACAAGAATTCTGG - Intergenic
1042417310 8:68536894-68536916 AAGAACAAGTGTAATTATACTGG + Intronic
1042575078 8:70209005-70209027 AAGTACAAAGAAAAATATTCTGG + Intronic
1042869721 8:73387242-73387264 AAGAAAAAGGATAGTTATTTGGG + Intergenic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044026828 8:87183621-87183643 AAGAACTAGTACAAGAATTCTGG - Intronic
1044643580 8:94413813-94413835 AAAAAAAAGAATAATTATTCTGG - Intronic
1046491176 8:114954081-114954103 AATAACAAGCATAAGAACTCTGG + Intergenic
1046631182 8:116624490-116624512 AAGAGCAAGTACAAATATTCTGG - Intergenic
1047875365 8:129130827-129130849 AAAAACAAGGATAAGAATTCTGG + Intergenic
1048120572 8:131576489-131576511 AAGAAAAAGTATATGTATTCAGG + Intergenic
1048681480 8:136846358-136846380 AAGAACTAGCATAAGAATTCTGG + Intergenic
1049118399 8:140710694-140710716 AACAACAAAAATAAGTATACTGG + Intronic
1051565881 9:18497713-18497735 ATGAACAAAGGTTAGTATTCAGG - Intronic
1057528839 9:95826410-95826432 TAGAACAAGAAGAAATATTCTGG - Intergenic
1058383137 9:104401318-104401340 AAGAATAAGAATAAGTGATCTGG - Intergenic
1060015475 9:120082960-120082982 AAGAACAAGTTTAGGGATTCAGG - Intergenic
1060082377 9:120661858-120661880 AAGAAAAATGTTAAGTGTTCTGG - Intronic
1186177372 X:6938940-6938962 CAGATAATGGATAAGTATTCTGG + Intergenic
1186584593 X:10859250-10859272 GAGAACACGGATAAGTAAACTGG - Intergenic
1187339604 X:18409375-18409397 AAGAAAAAAAAAAAGTATTCAGG - Intergenic
1188095512 X:26016617-26016639 AAGAAAAATAATAAGTATTTTGG + Intergenic
1188149743 X:26657150-26657172 AAGAACAAGCTCAAGAATTCTGG - Intergenic
1188172356 X:26943262-26943284 AAGAATAAGGATGACTATTTTGG + Intergenic
1188376296 X:29432774-29432796 AAGTAGAAGGAGAAGTATTATGG - Intronic
1189260534 X:39675489-39675511 AAGAAAAAGGAAAGGAATTCTGG + Intergenic
1189791702 X:44611211-44611233 AAAGACAAGGATGAGTAGTCAGG + Intergenic
1189860057 X:45262817-45262839 AAGACCATGGAGAGGTATTCTGG + Intergenic
1193067747 X:77277022-77277044 GAAACCAAGGACAAGTATTCAGG + Intergenic
1193551631 X:82900088-82900110 AAGAACAAGCACAAGAACTCTGG + Intergenic
1193557504 X:82974218-82974240 AAGAACCAGCATAAGAACTCTGG + Intergenic
1193945574 X:87728914-87728936 AAAAATAAGGATAATTTTTCTGG + Intergenic
1194060025 X:89184739-89184761 AAGAAGAAGGACAAGTACACTGG + Intergenic
1194637010 X:96358378-96358400 AAGTACAAGCACGAGTATTCAGG - Intergenic
1194923402 X:99795443-99795465 AAGAACTAGCACAAGAATTCTGG - Intergenic
1195273774 X:103258383-103258405 AACAATAAGGATATGAATTCTGG + Intergenic
1196495344 X:116318022-116318044 AAGAACAAGGAGCAGTAGCCAGG + Intergenic
1197867858 X:131037572-131037594 AACAACAATGATAAGTATAAAGG + Intergenic
1197963279 X:132028939-132028961 AATAACAAGGACAATAATTCGGG - Intergenic
1200893561 Y:8349720-8349742 AAAAACAAAAATAAATATTCAGG - Intergenic
1202578440 Y:26352672-26352694 ATGAACAAATATAATTATTCTGG - Intergenic