ID: 955276075

View in Genome Browser
Species Human (GRCh38)
Location 3:57548498-57548520
Sequence CTGGAGTTTGAGATCAGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76801
Summary {0: 2, 1: 68, 2: 2625, 3: 27108, 4: 46998}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955276067_955276075 19 Left 955276067 3:57548456-57548478 CCCAGCACTTTGGAAGGCTGAGG 0: 3195
1: 98846
2: 220041
3: 240219
4: 264270
Right 955276075 3:57548498-57548520 CTGGAGTTTGAGATCAGACTGGG 0: 2
1: 68
2: 2625
3: 27108
4: 46998
955276069_955276075 18 Left 955276069 3:57548457-57548479 CCAGCACTTTGGAAGGCTGAGGT 0: 1053
1: 34384
2: 134265
3: 227911
4: 224834
Right 955276075 3:57548498-57548520 CTGGAGTTTGAGATCAGACTGGG 0: 2
1: 68
2: 2625
3: 27108
4: 46998

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955276075 Original CRISPR CTGGAGTTTGAGATCAGACT GGG Intergenic
Too many off-targets to display for this crispr