ID: 955276075 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:57548498-57548520 |
Sequence | CTGGAGTTTGAGATCAGACT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 76801 | |||
Summary | {0: 2, 1: 68, 2: 2625, 3: 27108, 4: 46998} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
955276067_955276075 | 19 | Left | 955276067 | 3:57548456-57548478 | CCCAGCACTTTGGAAGGCTGAGG | 0: 3195 1: 98846 2: 220041 3: 240219 4: 264270 |
||
Right | 955276075 | 3:57548498-57548520 | CTGGAGTTTGAGATCAGACTGGG | 0: 2 1: 68 2: 2625 3: 27108 4: 46998 |
||||
955276069_955276075 | 18 | Left | 955276069 | 3:57548457-57548479 | CCAGCACTTTGGAAGGCTGAGGT | 0: 1053 1: 34384 2: 134265 3: 227911 4: 224834 |
||
Right | 955276075 | 3:57548498-57548520 | CTGGAGTTTGAGATCAGACTGGG | 0: 2 1: 68 2: 2625 3: 27108 4: 46998 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
955276075 | Original CRISPR | CTGGAGTTTGAGATCAGACT GGG | Intergenic | ||
Too many off-targets to display for this crispr |