ID: 955276996

View in Genome Browser
Species Human (GRCh38)
Location 3:57556296-57556318
Sequence AGCTGAGGAGCCGAGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955276996_955277002 3 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277002 3:57556322-57556344 CCTGACAGTAGGCCGCTGATCGG 0: 1
1: 0
2: 0
3: 1
4: 46
955276996_955277004 10 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277004 3:57556329-57556351 GTAGGCCGCTGATCGGCCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 20
955276996_955277003 9 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277003 3:57556328-57556350 AGTAGGCCGCTGATCGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 13
955276996_955276999 -8 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955276999 3:57556311-57556333 CCTCAGCTCCACCTGACAGTAGG 0: 1
1: 0
2: 3
3: 22
4: 236
955276996_955277007 27 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277007 3:57556346-57556368 CGCGGGTCTTGTCGACCGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955276996 Original CRISPR AGCTGAGGAGCCGAGGCCGC CGG (reversed) Exonic