ID: 955276996

View in Genome Browser
Species Human (GRCh38)
Location 3:57556296-57556318
Sequence AGCTGAGGAGCCGAGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 279}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955276996_955277003 9 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277003 3:57556328-57556350 AGTAGGCCGCTGATCGGCCGCGG 0: 1
1: 0
2: 0
3: 1
4: 13
955276996_955277007 27 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277007 3:57556346-57556368 CGCGGGTCTTGTCGACCGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 10
955276996_955277004 10 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277004 3:57556329-57556351 GTAGGCCGCTGATCGGCCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 20
955276996_955277002 3 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955277002 3:57556322-57556344 CCTGACAGTAGGCCGCTGATCGG 0: 1
1: 0
2: 0
3: 1
4: 46
955276996_955276999 -8 Left 955276996 3:57556296-57556318 CCGGCGGCCTCGGCTCCTCAGCT 0: 1
1: 0
2: 1
3: 37
4: 279
Right 955276999 3:57556311-57556333 CCTCAGCTCCACCTGACAGTAGG 0: 1
1: 0
2: 3
3: 22
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955276996 Original CRISPR AGCTGAGGAGCCGAGGCCGC CGG (reversed) Exonic
900526587 1:3132321-3132343 AGCAGAGGAGCGGAGCCTGCTGG + Intronic
901211448 1:7528506-7528528 AGCTGAGGAACCCAGGCTCCTGG - Intronic
901246553 1:7736408-7736430 AGATGATGAGCCGAGCCTGCTGG + Exonic
902207426 1:14879200-14879222 AGATGAGGAACCGAGGCTCCAGG - Intronic
902586220 1:17439881-17439903 AGCAGCGGAGCCGAGGCGGGCGG - Intergenic
902881045 1:19371956-19371978 TGCTGGGGAGCCCAGGCCGGGGG + Intronic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
903743149 1:25570014-25570036 AGCTGAGGGGCAGAGGCCTGGGG - Intergenic
904360440 1:29967772-29967794 CGCTCAGGAGCCCAGGCCCCTGG - Intergenic
904438746 1:30516186-30516208 AGCTGAGGGGCTGAGGCAGAGGG + Intergenic
904872969 1:33633443-33633465 AGCTGAGGAGCCGCGAGTGCTGG + Exonic
906126634 1:43431062-43431084 TGCTGAGGGTCCGAGGCCGTGGG - Exonic
906292984 1:44631998-44632020 AGCTGAAGTGCCGCCGCCGCCGG + Intronic
907278116 1:53328041-53328063 AGCCGAGGAGCCGGGGCGGGCGG - Intronic
913095892 1:115514924-115514946 GTCTGAGGAGCCGAGGTCGTAGG + Intergenic
913328598 1:117649315-117649337 TGATGAGGAGCTGAGGCCTCTGG - Intergenic
915515956 1:156412834-156412856 GGCTGGGGAGCCAAGGCCGGAGG + Intronic
915518380 1:156427085-156427107 AGCTGAGAGGCCCAGGCCGGAGG - Intronic
915960041 1:160258659-160258681 AGCTGAGTAGCTGGGACCGCAGG - Intronic
916106863 1:161439600-161439622 ACTTGAGGAGCCGAGACCACGGG - Intergenic
916108317 1:161446648-161446670 ACTTGAGGAGCCGAGACCACGGG - Intergenic
916109903 1:161454028-161454050 ACTTGAGGAGCCGAGACCACGGG - Intergenic
916111490 1:161461439-161461461 ACTTGAGGAGCCGAGACCACGGG - Intergenic
916113076 1:161468819-161468841 ACTTGAGGAGCCGAGACCACGGG - Intergenic
916166803 1:161972395-161972417 CGGTGAGGAGCGGAGGCCCCAGG - Intergenic
919513521 1:198494530-198494552 AGCTGAGGAAGCCAGGCAGCAGG + Intergenic
920766009 1:208834570-208834592 AGCTGAGCAGACGCGGCTGCCGG + Intergenic
922574161 1:226651255-226651277 AGGTGAGCAGGCGAGGCCTCGGG + Intronic
1063380593 10:5583100-5583122 CGCTTAGGTGCTGAGGCCGCAGG + Intergenic
1066370420 10:34814855-34814877 AGGTGAGGGGCCGGGGGCGCGGG - Exonic
1066746161 10:38605177-38605199 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1067474018 10:46554836-46554858 AGCAGAGGAGCCCAGGCCTTTGG + Intronic
1069887167 10:71631133-71631155 TGCTGGGGAGCTGAGGCAGCAGG + Intronic
1069959317 10:72070291-72070313 TGGTGAGGAGCCCAGGCCCCAGG - Exonic
1070718470 10:78739733-78739755 AGGTGAGGAGCAGAGGCAGATGG + Intergenic
1071600857 10:86958150-86958172 AGCTGCACAGCCCAGGCCGCGGG + Intronic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1073070527 10:100790634-100790656 AGCTGAGAAGCGCAGGCCACTGG + Intronic
1076669637 10:132112354-132112376 AGCTGACGAGCCGAGTGCCCAGG - Intronic
1076911854 10:133394364-133394386 AGCAGAGGCGCCGCGGCCGTAGG - Intronic
1077317963 11:1927669-1927691 AGCAGAGGAGGCAGGGCCGCAGG + Intronic
1077467570 11:2740813-2740835 AGAGGAGGAGACGTGGCCGCAGG - Intronic
1080388430 11:31823783-31823805 AGCTGAGGAGCGGAGGGAGACGG - Intronic
1080459075 11:32437978-32438000 AGCTGAGGAGCCGCAGTCGGAGG + Intergenic
1080781134 11:35431040-35431062 AGATGAGGGGCCGAGTCTGCAGG + Intergenic
1083855385 11:65390625-65390647 GGCCGAGGAGCCGGGGCAGCAGG - Intronic
1084891890 11:72240771-72240793 AGCTGAGGAGGAGAGGGGGCAGG - Intronic
1085471596 11:76761856-76761878 AGCTGAGGAAGCGAGGCCCAGGG + Intergenic
1087710216 11:101540214-101540236 AGCTGAAGAGCAGAGGCCTCAGG - Intronic
1088258789 11:107926010-107926032 GGCTGAGGAGCAGAAGCCACTGG + Intronic
1090976916 11:131686978-131687000 GGCAGCGGAGCCCAGGCCGCAGG + Intronic
1091454906 12:599762-599784 AGCTGAGGAGGAGAGGCAGTAGG - Intronic
1096792429 12:54053488-54053510 AGCTCAGGAGCCGAGGCCCACGG + Intronic
1101904282 12:108813587-108813609 CCCTGAGTAGCCGAGGCCACAGG - Intronic
1103516743 12:121513234-121513256 AGCTGTGCAGCCGAGGCCGTGGG + Intronic
1103559870 12:121788019-121788041 TCCTGAGGAGCTGGGGCCGCAGG + Intronic
1104653803 12:130557932-130557954 AGGTGAGGAACCGGGGTCGCAGG - Intronic
1104811315 12:131621944-131621966 AGCTCAGGAGCCTCGGCCTCTGG + Intergenic
1104895429 12:132161470-132161492 AGCTGAGGAGCTGAGGGAGGAGG - Intergenic
1104939109 12:132386582-132386604 CACTGAGGCGCCGAGGCCGGAGG - Intergenic
1105512443 13:21061641-21061663 CGCGGAGGAGCAGGGGCCGCAGG - Intergenic
1106173538 13:27309134-27309156 ACCGGAGGAACCGAGGCGGCTGG - Intergenic
1106908091 13:34430500-34430522 AGATGAGGAGCTGAGGCATCTGG + Intergenic
1110209484 13:72954629-72954651 AGCTGGGCAGCCCAGGCCACAGG - Intronic
1112299124 13:98214072-98214094 TGCTGAGGGGCCCAGGCTGCCGG - Intronic
1113031526 13:105998393-105998415 AGCAGAGGAGCGGAGCCTGCAGG - Intergenic
1113777637 13:112957461-112957483 AGATGAGAGGCCGAGGCCCCGGG + Intronic
1113931757 13:113972476-113972498 GGCGGAGCTGCCGAGGCCGCGGG + Intergenic
1115642221 14:35341992-35342014 AGCTGAAGGGCCGAGGACGAGGG - Intergenic
1121339017 14:93094028-93094050 AGCGGTGGAGCCGAGGCGGTGGG - Intronic
1122094837 14:99363193-99363215 ACCTGAGGTCCCGAGGCGGCAGG + Intergenic
1122113412 14:99516386-99516408 AGCTGAGGACCCTGAGCCGCTGG + Intronic
1122270959 14:100568285-100568307 AGCAGCGGGGCCGCGGCCGCCGG - Intronic
1122449844 14:101796840-101796862 ACTTGAGGAGCAGAGGCAGCAGG - Intronic
1122862465 14:104588702-104588724 GGCCGAGGAGCCGGGCCCGCAGG - Exonic
1122959233 14:105087065-105087087 AGCGCAGGAGCCGAGGTTGCGGG - Intergenic
1125830670 15:42715102-42715124 AGATGAGAAGCCGGGGCCTCTGG + Intronic
1130371105 15:83285477-83285499 CGCGGAGGGGCTGAGGCCGCAGG + Intergenic
1131855117 15:96585462-96585484 AGCTCAGCAGCAGAGGCCCCCGG - Intergenic
1132404662 15:101535167-101535189 AGCAGAGGAGCCGAAGGCGAGGG + Intergenic
1132639315 16:970552-970574 AGCCCAGGAGCCCAGGCCGGAGG + Intronic
1133004159 16:2868499-2868521 AGCTGGGGATCTGAGGCCCCCGG - Intergenic
1134143489 16:11742315-11742337 AGGTGGGAAGCCGTGGCCGCAGG + Intronic
1135314245 16:21430725-21430747 ACCTGAGTAGCCGAGACCACAGG - Intronic
1135367168 16:21863003-21863025 ACCTGAGTAGCCGAGACCACAGG - Intronic
1135444646 16:22508157-22508179 ACCTGAGTAGCCGAGACCACAGG + Intronic
1136193373 16:28632700-28632722 ACCTGAGTAGCCGAGACCACAGG + Intergenic
1136310913 16:29409433-29409455 ACCTGAGTAGCCGAGACCACAGG - Intergenic
1136324357 16:29511210-29511232 ACCTGAGTAGCCGAGACCACAGG - Intergenic
1136439042 16:30251192-30251214 ACCTGAGTAGCCGAGACCACAGG - Intronic
1136736899 16:32474464-32474486 AGGTGAGGGGCCGAGGGGGCGGG + Intergenic
1136927616 16:34389038-34389060 AGCTGGAGAGCCGGGGGCGCTGG + Intergenic
1136976958 16:35022768-35022790 AGCTGGAGAGCCGGGGGCGCTGG - Exonic
1137777565 16:51069232-51069254 AGCTGTGGAGCCAAGGACTCAGG - Intergenic
1139215467 16:65122005-65122027 GGCCGAGGAGCAGATGCCGCGGG - Exonic
1139459495 16:67110327-67110349 AGGTGAGGAGCTGCGGGCGCAGG - Intronic
1139858589 16:70001813-70001835 ACCTGAGTAGCCGAGACCACAGG - Intergenic
1141157994 16:81610311-81610333 TGCTGAGGAGCCGAGCGGGCGGG + Intronic
1141214592 16:82011462-82011484 AGCTGGGGCGCCGAAGCCGTCGG + Exonic
1141538398 16:84699713-84699735 AGGTGAGGAGCCGGGCCCGCCGG + Intergenic
1141695071 16:85615213-85615235 AGGTGAGGGGCCCAGGGCGCAGG + Intronic
1142131907 16:88434989-88435011 TGCTGAGCAGGCAAGGCCGCTGG - Exonic
1142206240 16:88784579-88784601 CGCTGCGGAGAGGAGGCCGCCGG - Intronic
1142373340 16:89694894-89694916 AGCTGAGGCGCAGAGGGCGTGGG - Intronic
1203016170 16_KI270728v1_random:355113-355135 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1203034505 16_KI270728v1_random:628271-628293 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1142996097 17:3761478-3761500 AGCTGAGGCTGTGAGGCCGCCGG + Exonic
1143125807 17:4640329-4640351 AGCAGAGGTGGCGAGGCCGCTGG + Intronic
1143402669 17:6656493-6656515 AGCAGAGGTGGCGAGGCCGCTGG - Intergenic
1143626078 17:8110759-8110781 AGGTGAGGAGGAGAGGACGCTGG - Intronic
1144021425 17:11242094-11242116 AGCTGAGAGGGTGAGGCCGCGGG - Intronic
1144685571 17:17223889-17223911 AGATGAGGTGCCGGGGCGGCAGG - Intronic
1146058931 17:29594377-29594399 AGCTGAGGGGCCCTGGCTGCTGG + Intronic
1146738226 17:35258110-35258132 AGTTGAGGAGCTGAGTCTGCTGG - Intronic
1147263365 17:39221656-39221678 GGCTCAGCAGCCGAAGCCGCTGG - Intronic
1147332114 17:39705358-39705380 AGCTGAAGGGCTGAGGCCGGGGG + Intronic
1147947543 17:44088503-44088525 GGCTCAGGGGCCGATGCCGCGGG + Exonic
1148054454 17:44785893-44785915 GCCTGAAGAGCCTAGGCCGCAGG - Intergenic
1148929977 17:51120341-51120363 CGCTGAGGAGGTGAGGCCGGCGG - Exonic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1151794125 17:76331623-76331645 TGCTGAGGAGCCGGGGAAGCGGG + Intronic
1152561090 17:81079143-81079165 GGCTGAGGAACCCAGGCCCCAGG - Intronic
1152763560 17:82122511-82122533 AGCTGAGGAACCCAGGCCTGGGG - Intronic
1153031093 18:713038-713060 AGCTCCCAAGCCGAGGCCGCTGG + Intergenic
1154098725 18:11447625-11447647 ATCTGAGCAGCCCAGGCCGAGGG + Intergenic
1156353746 18:36323172-36323194 AGAGGAGGAGCAGAGGCAGCCGG - Intronic
1156448668 18:37254253-37254275 GGCTGAGGTGCCGGGGCCGGCGG - Intronic
1158434949 18:57428799-57428821 GGCTGCGGCGTCGAGGCCGCGGG - Intergenic
1158436159 18:57436549-57436571 AGGTGGGGTGCCCAGGCCGCGGG - Exonic
1158539694 18:58341743-58341765 AGCTGAGGCTACGAGGCCGGCGG - Exonic
1159711740 18:71767948-71767970 AGCTGAGGAGACGAAGCTGTTGG + Intronic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1160732241 19:646572-646594 TCGTGAGGAGCCGAGTCCGCGGG + Intergenic
1160910782 19:1472852-1472874 AGCTGAGGGTCTGAGGACGCAGG + Exonic
1160981542 19:1818709-1818731 AGCTGAGGAGAAGAGGCCCAAGG - Exonic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162019612 19:7862670-7862692 AGGTCAGGAGGCGGGGCCGCGGG - Intronic
1163209371 19:15829282-15829304 GTCTGAGGACCCGAGGTCGCAGG - Intergenic
1163582951 19:18149227-18149249 AGCTGGGGAGGCGGGGCTGCTGG - Exonic
1163755398 19:19103691-19103713 AGCTGAGGGGCAGAGGGCCCGGG - Intronic
1165096172 19:33411064-33411086 ACCCGAGGGGCGGAGGCCGCAGG + Intronic
1166531625 19:43546514-43546536 GACTCAGGAGCCCAGGCCGCAGG + Intronic
1167429061 19:49443816-49443838 CGCTGAGGCTCAGAGGCCGCTGG - Intergenic
1167648918 19:50719351-50719373 AGCTGCGGGGCCGGGGCCGCGGG - Intronic
1167690008 19:50979657-50979679 AGCTGAGGAGGCCAGGCCTGGGG + Intronic
929414120 2:41730024-41730046 GGCTGTGTAGCCGAGGCTGCAGG - Intergenic
929667053 2:43841184-43841206 AGATGAGGAGCCTATGCCCCGGG - Intronic
930325062 2:49905782-49905804 ACCTGAGTAGCCGAGACTGCAGG - Intergenic
931614706 2:64144245-64144267 CGCTGAGGAGCCGCGGACGCAGG + Exonic
931680961 2:64750106-64750128 AGCTGAGGGGCGGAGGAAGCGGG + Intronic
932712860 2:74080682-74080704 AGCTGAGCAGGCGAGGGCGGGGG + Intronic
932779185 2:74549348-74549370 AGGTGAGGGGCCGCGGGCGCCGG - Exonic
933644521 2:84799501-84799523 GGCTGAGAAGCCTAGGCAGCAGG + Intronic
933692885 2:85193276-85193298 AGCTGAGGAGCCAAAGTCTCAGG + Intronic
933713773 2:85345540-85345562 ATCTGAGGAAGGGAGGCCGCTGG - Intronic
934188042 2:89763585-89763607 AGGTGAGGGGCCGAGGGGGCGGG + Intergenic
934308562 2:91844369-91844391 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
936594280 2:113832783-113832805 AGCTGGGAAGCCGAGGTTGCAGG - Intergenic
937917823 2:127107489-127107511 AACAGAGGAGCCGCGGCTGCTGG + Intergenic
939189251 2:138897136-138897158 AGCTGAGGAGCCCAGGCCACTGG + Intergenic
941676328 2:168346842-168346864 TGCTGAGGAGCCGTGGCTCCAGG + Intergenic
942278052 2:174336786-174336808 GGCGGAGGAGCCGAGGCCCGTGG - Exonic
944933408 2:204544008-204544030 AGATGAGGAGCTGAGGCCAAAGG - Intergenic
947138223 2:226996026-226996048 AGCTGAGGAGCTGAGGCGCCGGG - Exonic
947588208 2:231370081-231370103 CGCTGTGGAGCCGGGGCGGCTGG - Intronic
947598148 2:231426965-231426987 AGCTGGGGAGCAGAGCCCACAGG + Intergenic
948119161 2:235516038-235516060 AGCAGAGGAGCCCATGCGGCAGG - Intronic
948366215 2:237456457-237456479 ACCTGAGGAGCTGAGCCCGAAGG - Intergenic
948449512 2:238060649-238060671 ACCTGAGGAGCAGAGGCGGCTGG - Intronic
948914966 2:241029924-241029946 AGCTGAGGAGCAGTAGCTGCTGG + Intronic
1168814674 20:728417-728439 ATCTGAGGCGCGGAGGCGGCGGG + Intergenic
1169496735 20:6122896-6122918 AGCTGAGCAGCCGCCGCCACTGG - Exonic
1171457200 20:25278772-25278794 AGGGGAGGAGCCGTGGCCACCGG - Intronic
1173258622 20:41413433-41413455 GGCTCAGGAGCCGAGGTGGCAGG + Exonic
1173662623 20:44745084-44745106 AGCAGAGGAGCCGGTGTCGCTGG - Intergenic
1174017794 20:47502409-47502431 TGCTAAGGAGCCGGGGCAGCAGG - Intronic
1174804454 20:53593755-53593777 GGCCGAGGAGCCGGAGCCGCAGG - Exonic
1175812053 20:61863739-61863761 AGAGGAGGAGCCGAGGCTCCCGG + Intronic
1175856010 20:62121667-62121689 AGCGGAGGCTCCGAGGCCCCCGG + Intergenic
1175877794 20:62238644-62238666 AGCTGCGGGGCCTGGGCCGCGGG + Intronic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176120173 20:63450684-63450706 GTCTGTGGAGCCGAGGCTGCGGG + Intronic
1176144696 20:63560326-63560348 ACCTGAGGAGCCGAGGGGGCAGG + Exonic
1176177740 20:63736686-63736708 AGCTGAGGACCCCTGGCCGTGGG + Exonic
1176366788 21:6038037-6038059 AGCTGGGCAGCCGAGTCCGAAGG + Intergenic
1178156134 21:29856200-29856222 AGCAGAGGACCCCAGGCCCCTGG + Intronic
1178400175 21:32278771-32278793 GGCTGCGGAGGAGAGGCCGCTGG - Exonic
1179385349 21:40936798-40936820 AGGGGAGGAGCGGAGGCCACTGG - Intergenic
1179756730 21:43500507-43500529 AGCTGGGCAGCCGAGTCCGAAGG - Intergenic
1179833441 21:44012502-44012524 CTCTGAGGAGCCGCTGCCGCCGG + Exonic
1179992359 21:44954615-44954637 TGCTGAGGAGCCCAGGCTGCAGG - Intronic
1179996202 21:44975607-44975629 AACTGAGGAGCCGAGGCCAGGGG - Intronic
1180220711 21:46356223-46356245 GGGTGAGGGGCTGAGGCCGCGGG + Intronic
1180535648 22:16391448-16391470 AGGTGAGGGGCCGAGGGGGCGGG - Intergenic
1181235495 22:21445739-21445761 ACGGGAGGAGCAGAGGCCGCAGG - Exonic
1181630524 22:24148794-24148816 TGCTCAGGAGCCTAGGCTGCAGG - Intronic
1181639544 22:24189430-24189452 AGCCAAGGAGCCGAGGCTGCAGG - Intergenic
1181653068 22:24271419-24271441 AGCGGAGGAGCAGGGGCCACAGG + Intronic
1183096526 22:35555314-35555336 AGGTTAGGAGCCGAGCCCCCAGG - Intergenic
1183165062 22:36141274-36141296 TGCTGAGGAGCTGAGGCGGCAGG - Exonic
1183176374 22:36227478-36227500 AGCTGAGGAGCTGAAGAAGCGGG - Exonic
1183804213 22:40194368-40194390 AGCTCAGCAGCCGAGGCCATCGG - Intronic
1184035163 22:41914720-41914742 AGCGGAGGAGCCGAGCCGGAGGG - Intergenic
950785064 3:15427573-15427595 ATCTGAGGAGGCAAGGCCGTGGG - Exonic
950786712 3:15443070-15443092 AGCAGAGGAGCCAAGACCACAGG - Intronic
950963737 3:17131617-17131639 AGCTGAGGAGCAGAAGCCAGGGG + Intergenic
953005865 3:38978798-38978820 AGCGGAGGGGCCGAGGCTGGAGG - Intergenic
954323285 3:49846511-49846533 AGATGAGGAGACAAGACCGCAGG + Intronic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
956214629 3:66835764-66835786 AGCTGAGGAACTGAGGGCCCCGG + Intergenic
960973761 3:123156786-123156808 AGCTGAGGCACCGAGGGGGCTGG + Intronic
961332148 3:126148655-126148677 AGCTGTGGAGCCAAGGCCTGAGG - Intronic
961393872 3:126572477-126572499 AGCTGAGCAGCAGATGCCACTGG - Exonic
961522230 3:127473479-127473501 AGCACAGGAGCCCAGGCCCCTGG + Intergenic
961688222 3:128650341-128650363 AGCGGAGGCGCCGGGGCCCCTGG + Intronic
961987438 3:131152840-131152862 AGCTGAGAGGCCGAGGCGGATGG + Intronic
963906771 3:150779432-150779454 GGCTCAGGAGCAGAGGGCGCTGG + Intergenic
964790585 3:160450350-160450372 AGCTGAGCGGCGGAGGGCGCAGG - Intronic
968089706 3:195892528-195892550 AGCTCCGGAGCCGAGGCCACTGG - Intronic
969532639 4:7738332-7738354 AGCTCAGCAGCCGAGGAGGCAGG + Intronic
969544245 4:7813956-7813978 AGCTGAGCAGCCAAGGTCACAGG + Intronic
971985401 4:33815682-33815704 AGTTGAGAAGACGAGGCCACTGG - Intergenic
972386501 4:38571644-38571666 AGCAGAGGAGCCGAGAAAGCTGG + Intergenic
973870093 4:55157765-55157787 AGCGGAGGATCCCAGGCTGCAGG - Intergenic
975622209 4:76306747-76306769 GGCTGAGAGGCCGCGGCCGCAGG - Intronic
976324283 4:83752862-83752884 AGCTGAAGAGCCAAGGAAGCTGG - Intergenic
978390690 4:108222415-108222437 GGCTGAGGAGCGGAGGCGGGAGG - Intergenic
979448269 4:120839864-120839886 AGCGGGGGAGCTGAGGCAGCGGG + Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
986190790 5:5494714-5494736 AGCTGCGGGGGCGGGGCCGCTGG - Intergenic
988572410 5:32382177-32382199 AGCTGAGGAGCTGGGACCACAGG - Intronic
995086486 5:108116830-108116852 AGCTGAGGATACAAGGCTGCTGG - Intronic
997406529 5:133653305-133653327 TGCTGAGGAGATGAGGCCCCAGG - Intergenic
997971408 5:138405427-138405449 AGCTGAGAGGTTGAGGCCGCAGG + Intronic
1001334643 5:170787445-170787467 AGCTGAGGAGGCCGGGCCCCTGG + Intronic
1001682780 5:173570899-173570921 TGCAGGAGAGCCGAGGCCGCAGG - Intergenic
1004223777 6:13768814-13768836 AGCTGAGAGGCCGAGGCAGGAGG + Intergenic
1004525459 6:16403278-16403300 AGCTGAGAAGCCGAGGACCTGGG - Intronic
1005765860 6:29011628-29011650 AGCCGGGAAGCTGAGGCCGCGGG + Intergenic
1006515635 6:34544220-34544242 AGCTGGGCAGCCAAGGCCCCTGG - Exonic
1007168740 6:39847432-39847454 AGCAGAGGGGGCGAGGCCTCGGG + Intronic
1007725174 6:43911684-43911706 AGCTGAGGAGCCGGAGCTGGGGG - Intergenic
1011272412 6:85593347-85593369 AGCTCAGGAGACGAAGCCTCGGG + Intronic
1013355325 6:109341357-109341379 AAGTGAGGAGCCTGGGCCGCTGG + Intergenic
1018870778 6:167780541-167780563 AGCTGAGCAGCAGGGGCCGGCGG + Intergenic
1019476144 7:1245375-1245397 AGCTGGGGAGCCCAGGCCCGGGG - Intergenic
1019524849 7:1476305-1476327 AGCTGAGCAGCAGGGGCAGCCGG + Exonic
1019667157 7:2257621-2257643 AGCTGAGAAGCCAGGGCTGCAGG - Intronic
1020023592 7:4883496-4883518 ACCTGGGGCGCGGAGGCCGCGGG - Intronic
1021609747 7:22445538-22445560 AGCTGAGGGGCGGAGGCCAGCGG + Intronic
1022289346 7:28986171-28986193 AGCTGGGGAGCGGGGGCCACAGG - Intergenic
1023230729 7:38025325-38025347 AGCTGAGGAGCAGAAGCCAGAGG - Intronic
1024970693 7:55067041-55067063 AGGTGAGGAGCCGAGGATGCAGG - Intronic
1026858502 7:73770097-73770119 AGACGAGGGGCCGGGGCCGCTGG + Exonic
1028611622 7:92718289-92718311 CGCTGAGGTGCCGAGGCGACGGG + Intronic
1028985688 7:97006606-97006628 AGCTGAGGGTCCGCGGCGGCGGG - Intronic
1029168883 7:98617233-98617255 AGCTGAGGGGCGGAGGGGGCCGG - Intergenic
1029702307 7:102255109-102255131 TGGTGAGGAGCACAGGCCGCCGG - Exonic
1030593608 7:111510327-111510349 AGTTGAGGACACGATGCCGCAGG - Intronic
1032084658 7:128877575-128877597 AGCGGAGGAGCCAGGGCCACAGG + Exonic
1032145021 7:129371507-129371529 AGCTGAGGAGCAGAGGCTCCAGG - Intronic
1032239964 7:130153092-130153114 TGCGGAGGAGCAGAGGCCCCTGG + Intergenic
1034306672 7:150049162-150049184 AGCGGAGGAGCGGAGCCCGCTGG - Intergenic
1034490924 7:151392655-151392677 AGCTGAGGCTCCGGGGCCACCGG + Intronic
1034800173 7:154051481-154051503 AGCGGAGGAGCGGAGCCCGCTGG + Intronic
1035467403 7:159088807-159088829 AGATGAGGAACCGAGGCCTGAGG - Intronic
1035467412 7:159088845-159088867 AGATGAGGAGCTGAGGCCTGAGG - Intronic
1035467422 7:159088883-159088905 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467430 7:159088921-159088943 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467438 7:159088959-159088981 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467446 7:159088997-159089019 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467454 7:159089035-159089057 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467462 7:159089073-159089095 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467470 7:159089111-159089133 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467478 7:159089149-159089171 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467486 7:159089187-159089209 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467494 7:159089225-159089247 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467502 7:159089263-159089285 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467510 7:159089301-159089323 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467518 7:159089339-159089361 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467526 7:159089377-159089399 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467534 7:159089415-159089437 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467542 7:159089453-159089475 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1036786666 8:11692624-11692646 GGCTGAGGCGCAGAGGCCGCGGG - Intronic
1037589805 8:20303357-20303379 AGGTGGGGACGCGAGGCCGCAGG - Intronic
1037689214 8:21168706-21168728 AGGTGAGAAGCCAAGTCCGCCGG - Intergenic
1038568275 8:28637848-28637870 AGCTGGGGAGCCGAGGAGGAAGG - Intronic
1042533265 8:69835079-69835101 AGAGGAGCAGCCGAGGGCGCAGG + Intergenic
1042611857 8:70608476-70608498 ACCTGGGGACCGGAGGCCGCTGG + Intergenic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1048275535 8:133062992-133063014 GGCTGAGGAACCAAGGCAGCTGG - Intronic
1049190521 8:141284966-141284988 TGCTGGGGGGCCGAGGCCCCAGG - Intronic
1049326178 8:142022663-142022685 AGGTGCGGAGCTCAGGCCGCGGG + Intergenic
1049372621 8:142274967-142274989 TGCAGAGGAGCAGAGGCTGCAGG + Intronic
1049997558 9:1046638-1046660 GCCTGAGAAGTCGAGGCCGCAGG - Intergenic
1054835498 9:69672009-69672031 TGCGGAGGAGCGGAGGCAGCAGG - Intronic
1056503438 9:87233309-87233331 AGCTGAAGAACCAAGGACGCGGG - Intergenic
1056687920 9:88782067-88782089 AGCTGAGGGGCAAAGGCGGCAGG + Intergenic
1057145406 9:92755794-92755816 AGATGGGGAGCCCAGGCAGCAGG + Intronic
1059119762 9:111631432-111631454 GGCTGGGGAGCCGGGGCTGCCGG + Exonic
1060347290 9:122828235-122828257 AGCAGAGGAGGCGGGGCCCCCGG + Intronic
1060918600 9:127405361-127405383 AGCTGAGGAGCCCAGCCCTGCGG + Intronic
1061080173 9:128365190-128365212 GGCTGGGGAGGCGAGGGCGCGGG - Intergenic
1061384742 9:130282589-130282611 AGCAGAGGGGCCGGGGCCACGGG + Intergenic
1061452415 9:130675482-130675504 AGCAGAGCTGCAGAGGCCGCTGG - Intronic
1061841422 9:133360558-133360580 ACCATAGAAGCCGAGGCCGCTGG + Intronic
1061958852 9:133977872-133977894 AGCTGAGGGGCAGAGGCCTGAGG - Intronic
1187974012 X:24687204-24687226 ATTTGAGAAGCCGAGGCCGGTGG - Intergenic
1189323228 X:40098335-40098357 AGCTGGGGAGGGGAGGCCGGGGG - Intronic
1189325684 X:40109491-40109513 GGCCGAGGAGCGGAGGTCGCCGG - Intronic
1189856151 X:45227287-45227309 AGCAGAGGAGCCAAGGGCTCAGG + Intergenic
1191902348 X:66053915-66053937 AACAGAGGAGCCCAGGCCCCAGG + Intergenic
1192319669 X:70079481-70079503 AGCTGAGGAGCTGAGGTGGGAGG + Intergenic
1197692861 X:129522501-129522523 AACTGAGGAACCGTGGACGCTGG - Intronic
1198370676 X:135985880-135985902 AGCAGAGGAGGCGAAGCAGCCGG - Intronic
1199976868 X:152899327-152899349 AGATGAGGAGCGGAGGCCCTGGG - Intergenic
1200164467 X:154026653-154026675 AGCTGAGAAGCTGGGGCCGTTGG + Intronic