ID: 955278994

View in Genome Browser
Species Human (GRCh38)
Location 3:57575736-57575758
Sequence ATGCTGAGTAAAGTATATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955278994 Original CRISPR ATGCTGAGTAAAGTATATAT AGG (reversed) Intronic
900867525 1:5278905-5278927 AAGCTGATTAAAATATAAATTGG - Intergenic
901330790 1:8406555-8406577 AATCTGGGTAAAGAATATATGGG + Intronic
901564821 1:10105263-10105285 AAACTGGGTAAAGTATATATAGG - Intronic
902681497 1:18047070-18047092 ACGGTGAGTTAAGTGTATATTGG + Intergenic
903700501 1:25244537-25244559 ATGCTGAGTACAGAATTTGTGGG + Intronic
903844410 1:26269343-26269365 TTGCTGAGGAAATTAAATATAGG + Intronic
904069929 1:27787185-27787207 TTCCCGAGTCAAGTATATATAGG - Intronic
907130194 1:52090637-52090659 ATGTTGAGTAAACTACACATTGG - Exonic
907219357 1:52894364-52894386 ATGCTGACTAAAGAAAACATGGG + Exonic
908685659 1:66716423-66716445 ATGATGAGAAAAGCAGATATTGG - Intronic
909117553 1:71557645-71557667 AAACTGAGTAGAGTGTATATAGG - Intronic
909879308 1:80853046-80853068 TTGCTGAGTACAGCATAGATTGG - Intergenic
910338433 1:86158190-86158212 AAGCTGAGGGAAGTATATATAGG - Intergenic
911682778 1:100736971-100736993 ATGCTGTGCAAAGTATAAACAGG + Intronic
915035963 1:152925219-152925241 ATGCTAAAGAAAGTATATGTAGG - Intergenic
915795269 1:158724867-158724889 ATGCTGATAAAATTATACATGGG + Intergenic
916968949 1:169987808-169987830 ATGCTTATAAAAGTATTTATTGG - Intronic
918537779 1:185593344-185593366 ATGCTGATTAAGGTCTACATGGG + Intergenic
918741338 1:188134584-188134606 ATGCTAACTAAAATATAGATAGG + Intergenic
919351927 1:196468452-196468474 GTGCTGAGTAACATATTTATGGG + Intronic
920772025 1:208896556-208896578 AAGCTGAGTAAAGGATACATAGG - Intergenic
921031155 1:211336255-211336277 ATGCTGAGAAAAATGTATATAGG - Intronic
923116343 1:230942179-230942201 ATCATGAGTTAAGTATATTTAGG - Intronic
923858995 1:237874055-237874077 GGGCCTAGTAAAGTATATATGGG - Intergenic
924148244 1:241099963-241099985 AAGCTGAGTAAAGAGTGTATGGG + Intronic
924154240 1:241159733-241159755 ATACTGAGTTAAGTATACACAGG + Intronic
1063421961 10:5919881-5919903 AAACTGAGTACAGGATATATGGG - Intronic
1064235987 10:13575974-13575996 ACTCTGAGTAAAATAAATATAGG - Intergenic
1065052771 10:21812801-21812823 TTGCTGAATAAAGAGTATATGGG - Intronic
1065409137 10:25402674-25402696 AATCTGGGTAAAGAATATATTGG + Intronic
1066432549 10:35365776-35365798 AAGCTGGGTAAAGGGTATATGGG + Intronic
1066489507 10:35881226-35881248 ATGCTGACAATAATATATATCGG + Intergenic
1068733797 10:60389308-60389330 ATGCTGGGTAGAGTGTAAATTGG - Intronic
1068742615 10:60491482-60491504 ATGATTGGTAAAGTATTTATGGG - Intronic
1071051559 10:81456580-81456602 ATGGTGAGTATAGTAAATAATGG - Intergenic
1071126427 10:82340717-82340739 ATACTGTGCAAAGTAGATATTGG - Intronic
1071133734 10:82428324-82428346 GTGCTTAGTAAAGTATTAATAGG - Intronic
1071828151 10:89346230-89346252 AAGCTGCGTAAAGGGTATATGGG - Intronic
1073793483 10:106962991-106963013 ATCCTGAGGAAAGCAAATATGGG + Intronic
1074170538 10:110930635-110930657 ATGAAAAGTAAAGTATATCTTGG + Intronic
1074369011 10:112883865-112883887 GGGCTGGGTAAAGGATATATGGG - Intergenic
1074824876 10:117207482-117207504 GTGCTGAGCAAAGTAGATATGGG - Intronic
1078268370 11:9772122-9772144 ATCCTGAATAAAGTTGATATAGG + Intergenic
1079415143 11:20227482-20227504 ATTCTGCGAAAAGTATTTATGGG + Intergenic
1079638191 11:22771915-22771937 ATGCTTAATAATGTAAATATTGG + Intronic
1080393583 11:31870523-31870545 AAGCTGAGTAAAAGTTATATAGG - Intronic
1080831954 11:35903068-35903090 AAGCTGGGTAAAGAATATATAGG - Intergenic
1080877205 11:36287520-36287542 AAACTGAGTAAAGGATAAATGGG + Intronic
1080982054 11:37419789-37419811 AAGCTGAGTAAAGTAAGTAAAGG - Intergenic
1081290423 11:41318552-41318574 ATGGTGAGAAAAGTAGATAGTGG - Intronic
1081930345 11:46866196-46866218 ATTAAGAGTAAATTATATATAGG + Intronic
1083057488 11:59836963-59836985 ATGCTGAATGAAGTAGATATGGG + Intronic
1083211814 11:61192964-61192986 AATCTGAGTGAAATATATATGGG + Intergenic
1087505539 11:99016177-99016199 TGGCTGAGTAGCGTATATATAGG - Intergenic
1087864971 11:103214096-103214118 ATTTTCAGCAAAGTATATATTGG - Intronic
1088201270 11:107337909-107337931 AAACTGAGTAAAGCATACATGGG - Intronic
1088549643 11:110999458-110999480 AAGCTGAGTGAAAGATATATTGG - Intergenic
1094595220 12:31859369-31859391 ATGCTGCGTAAAAGATATACAGG + Intergenic
1095262985 12:40119383-40119405 TTACTGGGTAAAGGATATATGGG - Intergenic
1095479057 12:42614773-42614795 AGGCTGATTAAAGAAGATATGGG - Intergenic
1096664301 12:53152616-53152638 AATCTGGGTAAAGAATATATAGG + Intergenic
1097722984 12:63043938-63043960 ATGGGGAGTAAAGTAGATAAAGG - Intergenic
1098092351 12:66917196-66917218 ATGCTGATAAAAGTATAGAAAGG - Intergenic
1100253413 12:92856609-92856631 ATAATGACTAAAGTGTATATTGG - Intronic
1101960244 12:109243644-109243666 CTGATGATTAAAGTATACATAGG + Intronic
1104471042 12:129029808-129029830 ATGCTCAACAAAGTATATTTGGG + Intergenic
1106924383 13:34598943-34598965 GTGCTGAGTAAAGGAAAAATGGG - Intergenic
1108193371 13:47966218-47966240 ATGTTGACTAAAGTGTATTTAGG + Intronic
1108918489 13:55646636-55646658 ATGAAGAGTAAAGTAAATTTTGG + Intergenic
1109097603 13:58138197-58138219 CTTCTGAGTAAAATTTATATGGG - Intergenic
1109992718 13:70080508-70080530 ATGCTGACAAAATAATATATTGG + Intronic
1110159275 13:72356258-72356280 ATGTTGAATAAAATATATGTGGG - Intergenic
1110249236 13:73363284-73363306 AAGCTGAGTGAAGGATATAAGGG + Intergenic
1110410450 13:75198997-75199019 ATGCTGAGGAAAGAATTAATAGG + Intergenic
1110478350 13:75944416-75944438 CTTCTGAGTAAAATGTATATTGG + Intergenic
1111112897 13:83737714-83737736 ATGGCAAATAAAGTATATATGGG + Intergenic
1111354676 13:87082770-87082792 ATGATGAGTAATCTATAAATAGG + Intergenic
1111358529 13:87143256-87143278 ATACTGAGTTAATTATATATGGG + Intergenic
1111422926 13:88040690-88040712 ATGTTGAGGAAAGATTATATTGG - Intergenic
1111975161 13:94958978-94959000 ATGGTGCATAAAGCATATATAGG + Intergenic
1113047292 13:106169743-106169765 GTGCTGAGTAAAGAGTAAATGGG - Intergenic
1115038605 14:28891956-28891978 ATGCTAGGTAAAGTTTATTTTGG - Intergenic
1115825433 14:37267016-37267038 ATTCTGAGAAAAGTATGCATCGG + Exonic
1116948985 14:50861518-50861540 AGTCTCACTAAAGTATATATAGG - Intronic
1117063819 14:51989301-51989323 ATGCAGAGAATAGTATATGTAGG - Intergenic
1118032899 14:61835765-61835787 CTGCTGATCAAAGTATAAATTGG - Intergenic
1118140923 14:63081496-63081518 AATCTGAATAAAGTATATATGGG + Intronic
1118774281 14:68963849-68963871 AAGCTGAGTAATGGGTATATGGG + Intronic
1126399395 15:48254239-48254261 ATGCTTTGGAAAGTATATTTAGG + Intronic
1130346953 15:83056326-83056348 AAATTGAGTAAACTATATATGGG - Intronic
1130864533 15:87921044-87921066 AAACTGAGTGAAGGATATATGGG + Intronic
1131474515 15:92726234-92726256 ATTCTGGGTAAAGGATATATGGG + Intronic
1135561786 16:23482390-23482412 AAGATGAGTGAAGAATATATAGG + Intronic
1137226326 16:46514414-46514436 ATGCTGAGTAAAATATATAAAGG - Intergenic
1139710912 16:68775270-68775292 ATGCAGACTAAAGTATTTAGGGG - Intronic
1140577770 16:76192485-76192507 AAACTGAGTAAAGTATACATGGG - Intergenic
1140785860 16:78341612-78341634 ATGCTGAGATAAGTCTAGATGGG + Intronic
1143470549 17:7172499-7172521 ATGGTGAGAAAATTATATGTTGG + Intergenic
1148527847 17:48359189-48359211 AAGCTGAATGATGTATATATGGG - Intronic
1150169303 17:62975667-62975689 ATGATGAGACCAGTATATATTGG + Intergenic
1150306742 17:64091916-64091938 ATGATGAGGAAAGGATAAATAGG - Intronic
1153274889 18:3358754-3358776 TTGCAGTGTAAAGTATATATGGG - Intergenic
1156023651 18:32627649-32627671 ATGCTGAGTGAAGCATATATTGG + Intergenic
1156814837 18:41297198-41297220 GTGCTAAGTAAAGTATATGATGG - Intergenic
1159368745 18:67504748-67504770 ATGGTGAACAAAGTATACATGGG - Intergenic
1159523133 18:69552027-69552049 TTGCTGAGCAAATTATATTTTGG + Intronic
1160304088 18:77715822-77715844 ATGCTGTGTAAAGAGTATATAGG - Intergenic
925682379 2:6436108-6436130 ATGCTGAGTAGATTTCATATCGG + Intergenic
925957556 2:8982443-8982465 ACTCTGACCAAAGTATATATTGG - Intronic
927738476 2:25545022-25545044 AAGGTGAGTAAAGGATATAAAGG - Intronic
929021294 2:37555945-37555967 ATGCTGTTTAAAGTAGAAATTGG + Intergenic
929304256 2:40342258-40342280 TTGCAGAGCTAAGTATATATAGG - Intronic
929974400 2:46617471-46617493 ATTCTGAGTACAAAATATATAGG - Intronic
931964674 2:67520076-67520098 AAGGTGAGGAAAGGATATATGGG - Intergenic
932601339 2:73128500-73128522 AAGCTGAGTGAAGGGTATATGGG - Intronic
933584475 2:84165738-84165760 ATGCTGAAGAAAATATAAATTGG - Intergenic
934534780 2:95123944-95123966 AAACTGAGTAAAGGATACATGGG - Intronic
935170275 2:100605932-100605954 ATGCTGACAAAAGTATTTGTGGG - Intergenic
940236431 2:151515741-151515763 AATCTGAGTAAAGGATCTATAGG - Intronic
941130882 2:161649930-161649952 AAATTGAGTAAAGAATATATGGG - Intronic
941333746 2:164213248-164213270 AAGCAGAGTAAAGGATGTATAGG + Intergenic
942430202 2:175902719-175902741 ATGCTGCCTAAAGCATATAATGG + Intergenic
942472597 2:176276920-176276942 AAGCTCAGTAAACTATATAAAGG + Intronic
943990317 2:194681494-194681516 ATGCTGAGTAATGCATAGAGAGG + Intergenic
945284248 2:208066180-208066202 AGACTGAGCAAAGTATTTATAGG + Intergenic
946474745 2:219996369-219996391 CTGCTGAGCAAAGAATAAATTGG - Intergenic
1170386296 20:15820913-15820935 ATGCTGAGTACAACATATTTAGG - Intronic
1170647304 20:18208975-18208997 AATCTGAGTAAAGGGTATATAGG + Intergenic
1172315142 20:33948066-33948088 GTGCTGAATAAAGCACATATAGG - Intergenic
1173312439 20:41910011-41910033 ATCCTCAGTAAAGTAAATTTGGG - Intergenic
1176700251 21:10039185-10039207 AAGCTGGGTGAAGAATATATAGG - Intergenic
1177112663 21:17047671-17047693 AAGAAGAGGAAAGTATATATTGG + Intergenic
1178795872 21:35743787-35743809 ATGCCAAGTACAGTATATAGTGG + Intronic
1183105728 22:35613797-35613819 CTGCTGTTTAAAGTAAATATGGG - Intronic
1183471799 22:38012450-38012472 AAGCTGGGTAAAGGATATACGGG - Intronic
949272062 3:2229304-2229326 AGGCTAAGTATATTATATATTGG - Intronic
949740146 3:7223087-7223109 ATGTTGACTAACTTATATATAGG + Intronic
950761498 3:15233354-15233376 ATGCTAGGCAAAGAATATATAGG + Intronic
951472229 3:23069028-23069050 AATCTGTGTAAAGGATATATGGG - Intergenic
951870799 3:27359725-27359747 AAGCTGAGTGAAGGGTATATGGG + Intronic
955278994 3:57575736-57575758 ATGCTGAGTAAAGTATATATAGG - Intronic
956819709 3:72942980-72943002 AAGCTGAGTGAAGAATATATGGG + Intronic
957813200 3:85255205-85255227 ATGCTAAATACACTATATATGGG - Intronic
958596584 3:96233089-96233111 TTGCTGACTAAAGTCTATAGAGG - Intergenic
959472549 3:106770251-106770273 AAGCTGAGTAAAAAACATATGGG + Intergenic
960725502 3:120665907-120665929 AGGCTGAGAAAATTATATTTAGG - Intronic
961073327 3:123958507-123958529 AATCTGAGTGAAGCATATATAGG - Intronic
961148465 3:124615576-124615598 AATCTGAGTAAAGAGTATATAGG + Intronic
961310319 3:125994243-125994265 AATCTGAGTGAAGCATATATAGG + Intergenic
961365642 3:126397843-126397865 ATGCTGAGCCAAGTACAGATAGG + Intronic
961950134 3:130740898-130740920 AATCTGGGTAAAGTGTATATGGG + Intronic
962883968 3:139606054-139606076 AAGCTGAATAAAGGATATATGGG - Intronic
964326199 3:155548593-155548615 CTGCTGACTAAAGAATATTTAGG + Intronic
965568956 3:170151906-170151928 AAGCTGAGTGAAGTTTATATAGG + Intronic
965977780 3:174645724-174645746 ATGCTTAGTCAAGTGGATATTGG - Intronic
966141928 3:176766916-176766938 CTGCTGAGTAAAGACTATTTGGG + Intergenic
967767932 3:193302511-193302533 ATTCTAAGTAAAGGATAAATGGG + Intronic
970446562 4:16127751-16127773 AAACAGGGTAAAGTATATATCGG - Intergenic
971086681 4:23285529-23285551 AGGCTGAGTACAGAATAAATTGG + Intergenic
971952179 4:33366401-33366423 ATGCTCACTAAAGTAAATATGGG - Intergenic
974475352 4:62372136-62372158 ATGGGGATTAAAGTATAAATGGG + Intergenic
976049092 4:80989866-80989888 ATTCTACGTAAAGCATATATAGG + Intergenic
976270611 4:83227007-83227029 AACCTGAGCAAAGGATATATGGG + Intergenic
976526213 4:86092258-86092280 ATGGTGAGTAAAGTTAAAATGGG - Intronic
977620924 4:99136227-99136249 ATGCTGGGTCAATTATATGTAGG + Intronic
980082569 4:128359818-128359840 AAGCTGGGTGAAGGATATATGGG - Intergenic
980372657 4:131897947-131897969 AAGCTGGGTGAAGAATATATAGG - Intergenic
981543530 4:145871185-145871207 ATTCTGGGTGAAGGATATATGGG - Intronic
982429671 4:155308480-155308502 ATACTCAGTAAAATATTTATTGG - Intergenic
983085240 4:163435152-163435174 ATTCTGAGTTAATTATATATTGG + Intergenic
983424867 4:167570606-167570628 AAGCTGAGTTAAATCTATATTGG + Intergenic
984132468 4:175895317-175895339 ATTCTGAGAAAAATATAAATAGG - Intronic
986527052 5:8690343-8690365 AGGAAGAGTAATGTATATATGGG - Intergenic
986930411 5:12812326-12812348 TTACTGAGTGTAGTATATATGGG + Intergenic
987328133 5:16831054-16831076 AAGCTGAGTAAAGGAGACATGGG + Intronic
987647698 5:20696680-20696702 ATACATAGTACAGTATATATGGG + Intergenic
988783106 5:34541486-34541508 ATGATGCGTAAACTATAGATTGG + Intergenic
989116627 5:37960447-37960469 AATCTGAGTAAAGGATATATGGG + Intergenic
989655238 5:43740427-43740449 AAACTGAGTAATGGATATATTGG - Intergenic
990273634 5:54172724-54172746 ATGCTGAGTAAAGAGAATAGAGG + Intronic
990376448 5:55175579-55175601 ACGCTGAGTGAAGGATATAATGG + Intergenic
992177219 5:74161867-74161889 GAGCTGAGTAAAGAGTATATGGG - Intergenic
992464936 5:76994492-76994514 ATGTTGAGTACATTATATACAGG - Intergenic
994177097 5:96722869-96722891 ATGATGTGTAAGGTAAATATTGG - Intronic
994562369 5:101392120-101392142 AAGCTGAATGAAATATATATAGG + Intergenic
995028615 5:107453439-107453461 ATGCTGAGCCTATTATATATGGG + Intronic
995768269 5:115642361-115642383 ATGTTGAGAAATTTATATATTGG - Intergenic
998802742 5:145886896-145886918 ATGCTAAGTAAAATACACATAGG - Intergenic
998908139 5:146928699-146928721 ATGCTGAGTATAGTATACCAGGG - Intronic
1005392466 6:25347665-25347687 AAGCTGAGTAAAGGGTATATGGG - Intronic
1005546210 6:26875278-26875300 ATACATAGTACAGTATATATAGG - Intergenic
1005729070 6:28678148-28678170 AAGCTGAGTAATGAATAGATGGG - Intergenic
1005821053 6:29599508-29599530 ATGCTGAGTGAAGGATCTTTTGG + Intronic
1006658335 6:35616511-35616533 AAGCTGTGTAAAGCATATAAGGG + Intronic
1008923937 6:56871953-56871975 TGGCTGAGGAAAGTATAAATGGG + Intronic
1009016925 6:57916068-57916090 ATACATAGTACAGTATATATAGG - Intergenic
1011323837 6:86127203-86127225 ATACTGATTAAGGCATATATAGG + Intergenic
1011441039 6:87387730-87387752 ATGCTGAATAAACTATGTAGTGG + Intronic
1011854655 6:91674421-91674443 ATGATTAGTAAATTATTTATAGG + Intergenic
1012452341 6:99365839-99365861 AAGCTGAATAAAGGATATATGGG + Intergenic
1012954461 6:105553811-105553833 ATGATGTTTAAAGTATAAATGGG + Intergenic
1013320682 6:108984941-108984963 ACGCTGAGTTAACAATATATGGG - Intergenic
1014000052 6:116355263-116355285 ATGCTGGGGGAAGTATAAATTGG - Intronic
1014315846 6:119863771-119863793 ATTCTGAGTGAAGTATAAATTGG - Intergenic
1014354497 6:120388557-120388579 ATGCTGGATAAAGTATTTATTGG + Intergenic
1014618351 6:123633164-123633186 ATACTAAGTTAATTATATATGGG + Intronic
1018739870 6:166719829-166719851 ATGCTGATTAGAGTATATCTGGG + Intronic
1020831268 7:13098601-13098623 ATACTGAGAAAAGGACATATTGG + Intergenic
1024402212 7:48938121-48938143 AAAATGAATAAAGTATATATGGG + Intergenic
1024412094 7:49055423-49055445 AAACTGAGTATATTATATATTGG - Intergenic
1025624637 7:63209487-63209509 AAGCTGAGTAAAATACATTTTGG + Intergenic
1026376324 7:69754548-69754570 ATGGTGAGTAGAGTAGAAATAGG + Intronic
1027834412 7:83221950-83221972 ATGCTGATTGAAGTACAAATTGG + Intergenic
1031136422 7:117889160-117889182 ATCCTGAGTGAAGTATAGCTAGG - Intergenic
1031426110 7:121607676-121607698 ATGCTGAGTAAATTTTAAATGGG + Intergenic
1031981166 7:128126351-128126373 ATGCTGTGCCCAGTATATATTGG - Intergenic
1032168626 7:129565729-129565751 GAGCTGGGTAAAGTATATATGGG - Intergenic
1032232083 7:130083581-130083603 ATGTAGATTAAAGTATACATGGG - Intronic
1032690440 7:134281266-134281288 ATCATTAGTCAAGTATATATTGG - Intergenic
1032788917 7:135227586-135227608 AAGCTGGGTAAAGGGTATATAGG + Intergenic
1032805016 7:135344951-135344973 AAGTTGAGTGAAGGATATATGGG + Intergenic
1034584936 7:152081843-152081865 AAGATGAGAAAAGTATATATAGG - Intronic
1035134072 7:156683685-156683707 ATTCTGAATAAAGTACATAATGG + Exonic
1035843900 8:2842525-2842547 ATGCTTAGTGAAGTATTTTTGGG - Intergenic
1036913921 8:12786047-12786069 ATGCTGAATAGAGTATGTAAGGG - Intergenic
1037694643 8:21212989-21213011 ATGCTAAGTAAAGTAAATAGTGG + Intergenic
1038905139 8:31893020-31893042 ATGCTGAGTAAAGAATATGGGGG + Intronic
1039169777 8:34730352-34730374 TTTCTGAGTAAAGTATTTCTGGG - Intergenic
1041370414 8:57153823-57153845 ACTCTGACTAAAGTATGTATTGG + Intergenic
1042731558 8:71940660-71940682 AAGCTGGGTTAAGTACATATAGG - Intronic
1043207631 8:77466916-77466938 ATGCTGAGTAAAGAAGCTAAGGG - Intergenic
1043263995 8:78239095-78239117 ATGCTGAGTAAAGTGTATAAAGG - Intergenic
1043283929 8:78505257-78505279 AAGCTGAGTAAAGGCTATATGGG + Intergenic
1044611976 8:94100387-94100409 ATGCTGCGTAAAGCAGTTATAGG - Intergenic
1045392284 8:101727415-101727437 AGGCTGAGTAGAGAATAGATTGG - Intronic
1045796078 8:106046031-106046053 ATGATGAGTAAAATGTAGATAGG - Intergenic
1046418744 8:113950276-113950298 AAGCTGAGTAAAATATACACAGG - Intergenic
1050172298 9:2834303-2834325 AAGCAAAGTGAAGTATATATGGG - Intronic
1050657573 9:7845940-7845962 ATGCAGAGTAGAGTAAATCTGGG + Intronic
1050875689 9:10632742-10632764 ATGCTGGATAAATTATATCTGGG + Intergenic
1051034777 9:12731067-12731089 CTGCTGAAAAAAGTATAAATTGG - Intergenic
1051059560 9:13030398-13030420 ATGCTGAGTAAAGTTAATGAAGG + Intergenic
1051913706 9:22183804-22183826 ATGCACAGTGAAGTATTTATGGG - Intergenic
1053637447 9:40025993-40026015 AAGCTGGGTGAAGAATATATAGG - Intergenic
1053768632 9:41439248-41439270 AAGCTGGGTGAAGAATATATAGG + Intergenic
1054547302 9:66350728-66350750 AAGCTGGGTGAAGAATATATAGG + Intergenic
1054922601 9:70557068-70557090 ATGCTGAATACAGGGTATATTGG + Intronic
1055071104 9:72166785-72166807 ATGATGAGTATGGTAAATATAGG - Intronic
1056373008 9:85977547-85977569 ATGCTGAGTTCTGTATATCTGGG - Intronic
1057381901 9:94576202-94576224 GTGCTGAGTACAGTATCTCTGGG - Intronic
1057641948 9:96832815-96832837 AAGCTGAGTAAATTCTATACAGG - Intronic
1057919689 9:99086950-99086972 ATGCTTAATAAAGTAAATAACGG + Intergenic
1058179700 9:101781682-101781704 ATGGAGAGTAAGGTATAGATTGG - Intergenic
1058438817 9:104988917-104988939 ATCCAGAGTAAAGAATATAGTGG - Intergenic
1058683278 9:107458484-107458506 AATCTGGGTAAAGGATATATGGG - Intergenic
1202785261 9_KI270719v1_random:9248-9270 AAGCTGGGTGAAGAATATATAGG - Intergenic
1186830061 X:13381147-13381169 ATGCTGGGTAAAAGGTATATGGG + Intergenic
1187187324 X:16999523-16999545 ATGCTAAATACAGTCTATATTGG - Intronic
1187599440 X:20811548-20811570 AAGCTGGGTAAAGAGTATATGGG - Intergenic
1187813054 X:23201402-23201424 AAGCTGAGTGAATGATATATGGG + Intergenic
1187828093 X:23353219-23353241 AAGCTGAGTAAGGGATACATGGG + Intronic
1187841800 X:23496232-23496254 AAGCTGAGTGAAGGATATAATGG + Intergenic
1188802538 X:34549715-34549737 ATCCTGAGTAAAGAAAAGATAGG - Intergenic
1188837804 X:34979517-34979539 ATGCTGAGGAAAGAATATCAGGG + Intergenic
1190051394 X:47152373-47152395 ATTCTGAGTAGAGGATATATGGG - Intronic
1190849961 X:54230227-54230249 AAACTGAGTAAAGGATACATAGG + Intronic
1191652375 X:63553717-63553739 AAGCTCAGTAATGGATATATGGG - Intergenic
1191895837 X:65992360-65992382 CTGCTGATGAAAGTATAAATTGG - Intergenic
1192880526 X:75278529-75278551 TTGCTGAGTTTAGTATATAAAGG - Intronic
1194792136 X:98163537-98163559 TTGATCAATAAAGTATATATAGG + Intergenic
1196070726 X:111518538-111518560 ATACTGATTAAAATAAATATGGG - Intergenic
1196867072 X:120079799-120079821 TTACTGAGTGAAGTACATATAGG - Intergenic
1196876027 X:120156483-120156505 TTACTGAGTGAAGTACATATAGG + Intergenic
1197237148 X:124079910-124079932 ATGCTGAGGAAATTATTTAATGG - Intronic
1197324056 X:125069869-125069891 ATGCAGAGAAAAGGGTATATTGG - Intergenic
1197330106 X:125143262-125143284 AGGCTGAATAAAAAATATATTGG - Intergenic
1197805733 X:130396833-130396855 ATGCTGATTCAAGTAGATGTGGG - Intergenic
1197839788 X:130733884-130733906 TTACTGGGTAAAGGATATATGGG + Intronic
1198603958 X:138315880-138315902 ATGCTGGGTGAAGGATTTATAGG - Intergenic
1199030748 X:142996295-142996317 ATGGTGAGGAAAGTAAAAATTGG - Intergenic
1199040337 X:143107699-143107721 ATGCTTAGTGAAGTAATTATTGG - Intergenic
1199279588 X:145985010-145985032 ATCCAGAATAAACTATATATTGG - Intergenic