ID: 955287036

View in Genome Browser
Species Human (GRCh38)
Location 3:57651956-57651978
Sequence GATCCTCCCACCTAGGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955287036_955287041 7 Left 955287036 3:57651956-57651978 CCCAACACCTAGGTGGGAGGATC 0: 1
1: 1
2: 2
3: 29
4: 243
Right 955287041 3:57651986-57652008 GCAAGAGTTTAAGACTGGCCTGG 0: 1
1: 4
2: 121
3: 2048
4: 23515
955287036_955287040 2 Left 955287036 3:57651956-57651978 CCCAACACCTAGGTGGGAGGATC 0: 1
1: 1
2: 2
3: 29
4: 243
Right 955287040 3:57651981-57652003 TTGAGGCAAGAGTTTAAGACTGG 0: 1
1: 0
2: 7
3: 33
4: 229
955287036_955287042 8 Left 955287036 3:57651956-57651978 CCCAACACCTAGGTGGGAGGATC 0: 1
1: 1
2: 2
3: 29
4: 243
Right 955287042 3:57651987-57652009 CAAGAGTTTAAGACTGGCCTGGG 0: 2
1: 71
2: 917
3: 9089
4: 53715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955287036 Original CRISPR GATCCTCCCACCTAGGTGTT GGG (reversed) Intronic
901248833 1:7756740-7756762 GATCCTCCCACCTCAGTCTCCGG - Intronic
901503529 1:9669272-9669294 GATCCGCCCACCTAGTAGTTGGG + Intronic
901574050 1:10185630-10185652 GATCCTCCCACCTCGATCTCTGG - Intergenic
902711702 1:18244365-18244387 CTTGATCCCACCTAGGTGTTGGG + Intronic
903205793 1:21781626-21781648 GATCCTCCCACCTCGGCCTCCGG - Intronic
904894305 1:33802593-33802615 GATCCTCCTGCGTAGGTGTCAGG + Intronic
905991759 1:42343407-42343429 GATCCTCCCACCTTGTAGCTGGG - Intergenic
906048720 1:42853124-42853146 AATCCTCCCACCTCAGTGTATGG + Intergenic
906112112 1:43331055-43331077 GATCCTGCCACCTAGCAGTGAGG - Intergenic
906555100 1:46704367-46704389 GATCCTCCCACCTCAGTCTCTGG - Intronic
906719388 1:47994536-47994558 GATCCTCCGGCCTACCTGTTTGG - Exonic
908192974 1:61722178-61722200 GATCCTCCCACCTCGGCCTCTGG - Intronic
911192276 1:94960063-94960085 AATCCTCCCACCTCAGTGCTGGG + Intergenic
911625094 1:100114610-100114632 GACCCTCCCACCTCAGTCTTTGG - Intronic
913195617 1:116454056-116454078 TTTCCTCCCACCTAGGAGTGGGG + Intergenic
917960437 1:180139970-180139992 GATCCTCCCGCCTTGGTCTCCGG - Intergenic
918344461 1:183594163-183594185 GATCTTCCCACCTAAGTGTTGGG - Intronic
924210802 1:241765079-241765101 GATCCTCCCACCTTGGGCTCTGG - Intronic
1063612348 10:7573424-7573446 GATCCTCCCACCTTGGCCTCCGG - Intronic
1065738767 10:28777626-28777648 GATCCTCCCACCTCAGTCTCTGG - Intergenic
1066284456 10:33950991-33951013 GATCCTCCCACCTCAGTCTCTGG - Intergenic
1069008800 10:63348098-63348120 GATCCTCCCACCAAGTAGCTGGG - Intronic
1069381235 10:67844767-67844789 GATCCTCCCACCTCGGCCTCTGG - Intergenic
1069411947 10:68163052-68163074 AATCCTCCCACCAAAGTGTTGGG - Intronic
1073295144 10:102434267-102434289 GATCCTCCCACCTCAGTCTCTGG - Intergenic
1074321256 10:112404994-112405016 GGCACTCTCACCTAGGTGTTTGG + Intronic
1074993117 10:118729548-118729570 TATCCTCCCCCATCGGTGTTCGG + Intronic
1075322766 10:121505525-121505547 GATCCTCACACCCAAGTGTCTGG + Intronic
1075694018 10:124420013-124420035 GATCCTCCCACCTCAGCCTTTGG - Intergenic
1076020271 10:127066618-127066640 GCTCCTCACACCCAGATGTTTGG - Intronic
1076236875 10:128870434-128870456 GATCCTCCCACCTCAGTATCTGG + Intergenic
1077264903 11:1643604-1643626 GAACCTCCCACCTGGGTATCAGG - Intergenic
1078208258 11:9248985-9249007 GATCCGCCCACCTAAGTGCTGGG - Intronic
1078783271 11:14460620-14460642 GATCCTCCCACCTCAGTCTCCGG + Intronic
1081646756 11:44795561-44795583 GATCCTCACACCTGTGTGTCAGG - Intronic
1083426886 11:62592756-62592778 GATCCCCTCACCTAGCTGTGTGG - Intergenic
1084450297 11:69232867-69232889 CATCCTCCCACCTGGGTCTGGGG - Intergenic
1085164811 11:74389157-74389179 GATCCTCCCACCTCAGTTTCCGG - Intronic
1085540151 11:77260068-77260090 GATCCGCCCACCAAAGTGTTGGG - Intronic
1086885763 11:92203540-92203562 GATCCTCCCACCTCAGTCTCTGG - Intergenic
1087033789 11:93735002-93735024 AATACTCCCACCTTGGTGTGGGG + Intronic
1088631289 11:111776113-111776135 GATCCTCCCACCTAGGCTCCTGG - Intergenic
1089428464 11:118400869-118400891 GATCCACCCGCCTTGGTGCTGGG - Intronic
1091705462 12:2690433-2690455 GATCCTCCCACCTCAGTCTCTGG + Intronic
1092480250 12:8853098-8853120 GATCCTCTCACCTAGGCCTCCGG + Intronic
1093169209 12:15840663-15840685 GATCCTCCCACCTCAGTAGTTGG + Intronic
1093446507 12:19266231-19266253 GATCCTCCCACCTTGGTCTCCGG - Intronic
1096384688 12:51187454-51187476 GAACCTCTCACCTAGGAGGTAGG - Exonic
1096396043 12:51267597-51267619 GATCCTCCCACCTAAGCCTTTGG + Intronic
1098880649 12:75913849-75913871 CATCCTCCCACTTCTGTGTTAGG - Intergenic
1100496309 12:95128479-95128501 GATCCTCCCAACTCAGTGCTGGG + Intronic
1101364683 12:104060815-104060837 GATCCTCCCACCTCAGCTTTTGG - Intronic
1101832025 12:108265564-108265586 GATTCTCCCACCTAGTAGCTAGG + Intergenic
1103482910 12:121262662-121262684 GATTCTCCCACCTCGGCCTTCGG + Intronic
1103707755 12:122887942-122887964 GATCCTCCCACCTCAGCCTTCGG + Intronic
1105728878 13:23191933-23191955 GATCCGCCCACCTAAGTGCTGGG - Intronic
1106151875 13:27112387-27112409 GATCCTCCCACCTCAGTCTGTGG + Intronic
1106386964 13:29296317-29296339 GATCCTCCCACCTGAGTGGTTGG + Intronic
1106562948 13:30862565-30862587 GGTCCCCCCACCCAGGTGCTGGG + Intergenic
1106633962 13:31507529-31507551 GATCCTCCCACCTTGGCCTTAGG + Intergenic
1106833245 13:33608013-33608035 GATCCTCCCACCTCAGGCTTTGG + Intergenic
1108507387 13:51124764-51124786 GAACCACCCACTTAGGTATTCGG + Intergenic
1109784356 13:67154951-67154973 GATCCACCCACCTGAGTGGTGGG + Intronic
1111658559 13:91181007-91181029 GATACTACCACCTATGGGTTTGG + Intergenic
1112013606 13:95312829-95312851 GATCCTCCCACCTCAGTCTCTGG + Intergenic
1112775284 13:102837035-102837057 GATCCTCCCACCTAAGCGCTGGG - Intronic
1114522500 14:23348045-23348067 GATCCTCCCACATGGGTGGTGGG + Intronic
1115585376 14:34806483-34806505 GATCCTCCCACCTCAGCCTTCGG + Intronic
1118219656 14:63843140-63843162 GATCCTCCCACCTTAGCCTTTGG + Intergenic
1118804542 14:69224138-69224160 GATCCTCCCACCTCGGCCTCTGG + Intronic
1119158641 14:72434229-72434251 GATCCTCCTGCCTCAGTGTTTGG - Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119396050 14:74327056-74327078 GATCCTCTTTCCTAGGTGGTTGG + Intronic
1123052365 14:105551114-105551136 TATCCTCCCACCTCAGTCTTCGG - Intergenic
1124117497 15:26859733-26859755 GATCCTCCCACCTCAGTCTCTGG - Intronic
1125434315 15:39628859-39628881 ATTCCTCCCAACTAGTTGTTTGG - Intronic
1128283996 15:66420445-66420467 GATCCTCCCACCTCAGCGTTTGG - Intronic
1128544905 15:68560398-68560420 GATCCTCCCACCCCAGTGTCTGG + Intergenic
1129899824 15:79138043-79138065 GAACATCCCACCTGGGTATTTGG + Intergenic
1131526966 15:93160194-93160216 GCTGGTCCCACCTAGGGGTTGGG - Intergenic
1133072417 16:3255074-3255096 GATCCTCCCACCTTGGCCTCTGG - Intronic
1133260232 16:4544499-4544521 GATCCTCCCACCTCAGTCTCTGG - Intergenic
1133581357 16:7147407-7147429 GATCCTGTCACCCAGGTGGTGGG + Intronic
1134204750 16:12228033-12228055 GATCCTCCTACCTAAGTCTCTGG - Intronic
1135111652 16:19695038-19695060 GATCCGCCCACCTTGGCCTTGGG + Intronic
1135412224 16:22243815-22243837 GATCCTCCCACCTCAGCCTTGGG - Intronic
1135679913 16:24447541-24447563 GATCCTCCCACCTCAGTGCTGGG + Intergenic
1136463694 16:30427893-30427915 GATCCTCCCACCTCAGCCTTCGG - Intronic
1137491523 16:48937111-48937133 GATCCTCCCACCTTGGCCTCTGG + Intergenic
1138405713 16:56792072-56792094 GATCCTCCCACCTAAGTCTCCGG - Intronic
1139418827 16:66835670-66835692 GATCCTCCCACCAAGTAGCTGGG - Intronic
1139604912 16:68011277-68011299 GATCCACCCACCAAAGTGCTGGG - Intronic
1139844808 16:69912839-69912861 GATCCTCCCACCTTGGCCTCTGG - Intronic
1141406108 16:83794445-83794467 GATCCTCCCACCTTAGTCTCCGG - Intronic
1143613031 17:8031087-8031109 GATCCTCCCACCTCAGCCTTTGG - Intergenic
1144387108 17:14758956-14758978 GATCCGCCCACCAAAGTGCTGGG - Intergenic
1146768411 17:35545598-35545620 GATCCTCCCACCTTGGCCTCTGG + Intergenic
1147275293 17:39311059-39311081 GATCCTCCCACCTTGGCCTCTGG - Intronic
1147434156 17:40396986-40397008 GATCCTCCCACCTTGGCCTCCGG + Intronic
1147739795 17:42664963-42664985 GGTCCTCCCACCTTGGCCTTGGG + Intronic
1148583537 17:48760463-48760485 GGTCCTCCCAGCTAGGTGTGAGG + Intergenic
1151080198 17:71321050-71321072 GATCCTTGCAGCAAGGTGTTCGG - Intergenic
1151702192 17:75749420-75749442 GATCCTCCCACCTCAGTCTCCGG - Intronic
1152542892 17:80985559-80985581 GATCCACCCACCTTGGTCTCCGG - Intergenic
1153295919 18:3546306-3546328 GATCCTCCCACCTCAGTCTCCGG - Intronic
1154962471 18:21323624-21323646 GATCCTCCCACCTCAACGTTTGG - Intronic
1155857791 18:30855311-30855333 GATCCTCCCGCCTAGGCATCTGG - Intergenic
1157324719 18:46660424-46660446 GATCCTCACACCAAGGAGCTGGG - Intergenic
1158623259 18:59050314-59050336 CACCCTCTCACCTAGGTGTCTGG + Intergenic
1159123594 18:64197707-64197729 GATCCTCCCACTTTGGCCTTGGG - Intergenic
1159897157 18:74008265-74008287 GAGCCTCCTACCTCTGTGTTAGG - Intergenic
1161047200 19:2141843-2141865 GATTCTCCCACCTCAGTATTTGG + Intronic
1161090878 19:2359646-2359668 GATCCTCCCACCTCAGAGTCTGG - Intergenic
1161514729 19:4690101-4690123 GTTCCTCCGACCCAGGTGCTTGG + Intronic
1161540696 19:4849544-4849566 AATCCTCCCACCAAAGTGCTGGG + Intronic
1162406599 19:10478565-10478587 GATCCTCCTGCCTCAGTGTTGGG + Intergenic
1163457045 19:17413244-17413266 GATCCTCCTGCCTAAGTGTTGGG - Intronic
1164255155 19:23521629-23521651 AGTCATACCACCTAGGTGTTGGG + Intergenic
1165202796 19:34158968-34158990 GATCCACCCACCAAAGTGCTGGG - Intergenic
1165675713 19:37720634-37720656 GATCCTCCTACCTTTGTCTTTGG - Intergenic
1165946267 19:39444656-39444678 GATCCTCCCACCTTAGCCTTTGG + Intronic
1166181451 19:41112072-41112094 GATCCTCCCACCTGGGCCTCTGG - Intergenic
1166541086 19:43606397-43606419 GATCCACCCACCTCAGTGCTGGG + Intronic
1167226667 19:48248272-48248294 GATCCTCCCACCTCGGCCTCCGG - Intronic
1167230956 19:48282954-48282976 GATCCTCCCACCTCGGCCTCCGG + Intronic
1167268342 19:48494159-48494181 GGCCCTCCCACCTAGCTGTGTGG + Intronic
1167640290 19:50678080-50678102 GATCCTCACACCTGTGAGTTAGG + Intronic
1167862446 19:52296805-52296827 GATCCTCCCGCCTCAGTCTTCGG + Intergenic
925849786 2:8069040-8069062 GATCCTCCCGCCTAAATGCTGGG - Intergenic
928165847 2:28971315-28971337 GATCCTCCCACCTCAGCTTTCGG + Intronic
929015338 2:37487931-37487953 GATCCGCCCACCTAAGTGCTGGG - Intergenic
931740366 2:65237337-65237359 GATCCTCCCACCTCAGTCTCTGG + Intronic
931847016 2:66214458-66214480 GATCCTCCCTCCTTGGTCTCCGG + Intergenic
932175577 2:69597764-69597786 GATCCTCCCAGCTAGTAGCTGGG - Intronic
933312468 2:80677704-80677726 GAGCCTCCTACATAGGTCTTTGG - Intergenic
933589412 2:84215317-84215339 GATCCTCTCACCTTGGTTCTGGG - Intergenic
935930297 2:108116940-108116962 GATACTACAACCTAGGTCTTAGG - Intergenic
936762666 2:115805218-115805240 GACCCTCCCAGCCAGGTGTGGGG + Intronic
937183419 2:120015825-120015847 GATTCTCCCACCTAGGGCTACGG - Intronic
937634046 2:124135727-124135749 GATCTTCACACCTAGATTTTTGG - Intronic
937999502 2:127720668-127720690 GATCCTCCCACCTCGGCCTCCGG + Intronic
938503253 2:131847583-131847605 GATCCACCCACCTCGGCCTTTGG - Intergenic
938838715 2:135136842-135136864 AATACTCCCACCTTGGTGTGGGG - Intronic
940961174 2:159787862-159787884 GATCCACCCACCTCGGTGCTGGG - Intronic
941260165 2:163287723-163287745 GATCCTCACACCTAAGTGTGTGG + Intergenic
942110744 2:172680455-172680477 GATCCTCCCACCTCAGCCTTTGG + Intergenic
942386812 2:175451483-175451505 AATCCTCCCACCTAGGCCTCTGG - Intergenic
943774545 2:191750628-191750650 GTTCCTCTCACCTAGGTCTAGGG + Intergenic
944126604 2:196300965-196300987 CATCCTATCACCTAGGTATTAGG + Intronic
945159042 2:206870251-206870273 GACTCTGCCACCTAGGAGTTTGG - Intergenic
946091585 2:217229684-217229706 GATCCACCCACCAAAGTGCTGGG + Intergenic
946170481 2:217892508-217892530 CCTCTTCCTACCTAGGTGTTTGG - Intronic
946352956 2:219167634-219167656 GATCCTCCCACCTAAGCCTCCGG - Intronic
946625024 2:221602183-221602205 GACCCTCCCACAGAGGTCTTGGG + Intergenic
947541456 2:230982636-230982658 GATCCTCCCACCACAGTGCTGGG - Intergenic
947753805 2:232546585-232546607 GATCCTCCCACTTGAGTCTTGGG + Intergenic
948829804 2:240593109-240593131 GAGCCTCCCACCTGGGAGTGAGG + Intronic
1169265505 20:4164981-4165003 GATCCTCCCACCTTAGCCTTTGG + Intronic
1169897319 20:10518064-10518086 GGGCCTAACACCTAGGTGTTGGG + Intronic
1172143246 20:32738834-32738856 GATCCTCCCACCTAAGCCTCTGG + Intronic
1174465207 20:50712022-50712044 GATCCTCCTTCCAAAGTGTTGGG + Intergenic
1174909732 20:54594284-54594306 GATCCTCCCACCTCAGTCTCTGG - Intronic
1177186515 21:17803403-17803425 GATCCTCCCACCTAAGTAGCTGG - Intronic
1178018634 21:28382274-28382296 AATCCTACCACCTGTGTGTTTGG + Intergenic
1180740733 22:18051529-18051551 GATCCTCCCACCTCAGGTTTTGG - Intergenic
1183957012 22:41386801-41386823 GATCCACCCACCAAAGTGCTGGG - Intronic
1184003812 22:41694435-41694457 GGTTCTCCCACTCAGGTGTTTGG - Exonic
1184003880 22:41694834-41694856 GCTTCTCCCACCTTGGTGTCTGG - Exonic
1184359438 22:44006046-44006068 GATCCTCCCACCTCAGTCTCTGG + Intronic
949872380 3:8599786-8599808 GATCCTCCCACCTCAGTCTCCGG - Intergenic
950051094 3:9990438-9990460 GATCCCCCCACCTCAGTCTTTGG + Intronic
950083782 3:10241865-10241887 GATCCTCCCACCTCAGTCTCCGG - Intronic
950984576 3:17347756-17347778 GATTCTCCCACCTAAGTGTTAGG - Intronic
953911484 3:46895418-46895440 TATCCTCCCACCCAGGAGTCAGG - Intronic
954642213 3:52107465-52107487 AATGCTCCCACACAGGTGTTGGG - Intronic
954709130 3:52496298-52496320 GAGCCTCCCACCCTGGTGATGGG + Intronic
955287036 3:57651956-57651978 GATCCTCCCACCTAGGTGTTGGG - Intronic
960103015 3:113764864-113764886 GATCCCCCCACCTCAGTGCTGGG - Intronic
962762493 3:138528148-138528170 GATCCTTCCACCTCAGTCTTCGG + Intronic
964272365 3:154971179-154971201 GAACCTCACACCTAGGTTTCAGG - Intergenic
964551529 3:157890200-157890222 GATCCACCCACCAAAGTGCTGGG + Intergenic
964794524 3:160482666-160482688 AATCCTCCCACCAAAGTGCTGGG + Intronic
966903448 3:184504514-184504536 GATCCTCCCACCTCAGCGTCTGG + Intronic
967004350 3:185369524-185369546 GATCCTCCTACATAAGTGTGTGG + Intronic
968196369 3:196710734-196710756 GATTCTCCCACCTTGGCCTTTGG - Intronic
969543637 4:7809962-7809984 GATCCTCCCACCTTGGCCTCCGG + Intronic
970782836 4:19759444-19759466 GATCCTCCCACCTAAGTGTTGGG - Intergenic
970868523 4:20785813-20785835 GATCCTTCCACCAAGGTCTTAGG - Intronic
972628659 4:40824591-40824613 GATCCTCCCACCTCGGCCTCTGG + Intronic
976505602 4:85842857-85842879 GATCCTCCCACTTTGATGGTGGG + Intronic
977356624 4:95954300-95954322 CCTCCTCCAACCTAGGTATTGGG + Intergenic
978184939 4:105846243-105846265 GATCCTCCCACCTCATTTTTTGG - Exonic
980123166 4:128748684-128748706 GATCCTCCCACCTTGGCCTCTGG + Intergenic
980938154 4:139246016-139246038 GATCCTCCCACCTCAGACTTTGG - Intergenic
987222449 5:15804361-15804383 GATCCTCCCACCTCGGCCTCTGG - Intronic
987457827 5:18169195-18169217 GATCCTCTCACCCAGGTTGTGGG - Intergenic
989094707 5:37771226-37771248 TATGCTGCCACCTAGGTGTTGGG - Intergenic
989376498 5:40768086-40768108 GATCCTTTCACCTTGGTGTAAGG - Intronic
989380804 5:40807874-40807896 GATCCTCCCGCCTCGGTGGACGG - Intergenic
990196664 5:53324482-53324504 GATCCTTCCACCTGGCTGCTTGG - Intergenic
991332251 5:65504348-65504370 GATTCTCCCACCTAGGCCTCCGG - Intergenic
992043700 5:72863364-72863386 AATCCACCCACCTAGGCCTTGGG - Intronic
998429929 5:142062017-142062039 GATCCTCCCACCTCAGTCTCCGG - Intergenic
999199468 5:149805683-149805705 GACCCACCCACCTTGGTGCTGGG + Intronic
999375988 5:151086909-151086931 GCTCTTCCCACCCAGGTCTTGGG - Intronic
1003297024 6:4838923-4838945 GATCCTCCCGCCTCGGCCTTGGG + Intronic
1004209046 6:13618783-13618805 GATCCTCCCACCTTGGCCTCTGG - Intronic
1004500182 6:16202190-16202212 GATCCATCCACCTTGGTGCTGGG - Intergenic
1004904555 6:20224631-20224653 AATCCTCTTACCTCGGTGTTGGG + Intergenic
1005380204 6:25225863-25225885 GATCCTCCCACCTCAGCCTTTGG - Intergenic
1010160304 6:72846431-72846453 AATCCTCCCACCTCAATGTTGGG - Intronic
1014819552 6:125972095-125972117 GATCCTCCTCCCAAAGTGTTGGG + Intronic
1016924206 6:149325990-149326012 TGGCCTCCCACCTAAGTGTTGGG + Intronic
1017524862 6:155233716-155233738 GATCCTCCCACCAAACTGCTGGG - Intronic
1023788647 7:43734502-43734524 AATCCTCCCACCTCAGTCTTTGG + Intergenic
1026301700 7:69103461-69103483 GATCCTCCCACCTAGACCTCTGG - Intergenic
1026465097 7:70646979-70647001 GATCCTGCCACCTCTGTGTCTGG + Intronic
1026827045 7:73590886-73590908 GATCCTCCCACCTTGGCCTTAGG - Intergenic
1027146387 7:75698067-75698089 GATCCTCCCAGCTAGGTGCCGGG + Intronic
1028425007 7:90676636-90676658 GATCCTCCCACCTCAGCCTTGGG + Intronic
1029497774 7:100906528-100906550 GATCCTCCCACCTCGGTAGCTGG + Intergenic
1030681698 7:112441019-112441041 CAGCCTCCCACCAAAGTGTTGGG - Intronic
1030784595 7:113644532-113644554 GATCCTCCCACCTCAGCCTTTGG - Intergenic
1031596282 7:123653344-123653366 GATCCTCCCACCTCGGCCTTCGG - Intergenic
1031861915 7:126989854-126989876 GATCCTCCCACCTCAGTCTCTGG - Intronic
1034960394 7:155361040-155361062 GACCCTCCCACCGAGGAGCTGGG + Exonic
1035188465 7:157144188-157144210 GATCCTCCCGCCTCAGTCTTCGG - Intronic
1035534458 8:380395-380417 GATCCCCCCACCTGGGTCCTGGG + Intergenic
1035731328 8:1855485-1855507 GATCCTCCCACCTCAGCCTTCGG + Intronic
1036786406 8:11690763-11690785 GATCCTCCCACCTCGGCCTCCGG - Intronic
1037300036 8:17442009-17442031 GATCCTCCCACCTCAGTCTCTGG - Intergenic
1038235595 8:25750439-25750461 GATCCTCTCACCTCAGTCTTTGG - Intergenic
1039062776 8:33584962-33584984 GATCCTCCCACCTCTGCCTTGGG + Intergenic
1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG + Intronic
1039646261 8:39287095-39287117 AATCCTCTCATCTAGCTGTTTGG + Intergenic
1039975873 8:42364342-42364364 AATCCTCCCACCTAGTAGCTGGG + Intronic
1040845856 8:51838381-51838403 GATCTTCCCACCTTGGCCTTTGG - Intronic
1041909169 8:63069627-63069649 GATCCTCCCACTTCGGCTTTTGG - Intronic
1042075131 8:64985578-64985600 CACCCAGCCACCTAGGTGTTGGG - Intergenic
1042525183 8:69757436-69757458 GATCCACCCATCTCGGTGCTGGG - Intronic
1045215717 8:100146354-100146376 GATCCTCCCACCTCTGTGCTGGG - Intergenic
1049959367 9:723517-723539 AATCCTCCCACCTTGGCCTTTGG - Intronic
1050323446 9:4477518-4477540 GATCCTCCCCCCTCGGTCTCTGG + Intergenic
1053146281 9:35714359-35714381 CATCTTCCCACCTGGCTGTTGGG + Exonic
1054690558 9:68318865-68318887 CATCTTCCCACCTAGATATTAGG + Intergenic
1056631013 9:88293071-88293093 GATCCTCCCACCTTGGCCTCCGG + Intergenic
1058598157 9:106638376-106638398 GATCCTACCATCTAGGGGTTAGG + Intergenic
1058654579 9:107208135-107208157 TAGCCTCCCACCCTGGTGTTTGG - Intergenic
1059301059 9:113313917-113313939 GATCCGCCCGCCTAAGTGCTGGG - Exonic
1060095525 9:120785777-120785799 GATCCACCCTCCAAAGTGTTGGG - Intronic
1060177438 9:121507471-121507493 GATCCTCCCGCCTAAGTGCTGGG + Intergenic
1061203773 9:129151604-129151626 CATCCTCTCACCTGGGTGATGGG + Intergenic
1061565248 9:131434472-131434494 CATCCTCCCACCAAGGTATCAGG + Intronic
1062688331 9:137827842-137827864 GAACCTTCCACCTAGGTTTCGGG - Intronic
1187095557 X:16143959-16143981 GATTCTCCCAACTAGTTGTATGG - Intronic
1190170459 X:48108182-48108204 GATCCTCCCACCTCGGCCTCGGG + Intergenic
1190170549 X:48108687-48108709 GATCCTCCCACCTTGGCCTCAGG + Intergenic
1190176566 X:48155541-48155563 GATCCTCCCACCTCGGCCTTGGG - Intergenic
1190181688 X:48197742-48197764 GATCCTCCCACCTCGGCCTCGGG + Intronic
1190188363 X:48255581-48255603 GATCCTCCCGCCTCGGCCTTGGG + Intronic
1190194521 X:48305698-48305720 GATCCTCTCACGTAGGCCTTGGG - Intergenic
1190200432 X:48356204-48356226 GATCTTCTCACCTAGGCCTTGGG - Intronic
1190200603 X:48357505-48357527 GATCCTCCCACCTCGGCCTCGGG + Intergenic
1190667416 X:52707983-52708005 GATCCTCCCACCTCGGCCTCGGG + Intergenic
1190672002 X:52750425-52750447 GATCCTCCCACCTCGGCCTCGGG - Intergenic
1191867690 X:65718575-65718597 AATCCTCCCATCTCAGTGTTAGG - Intronic
1191987769 X:67000927-67000949 GATGCTACCATCTTGGTGTTGGG - Intergenic
1192617157 X:72638297-72638319 GATCCTCCCACCTTAGTCTCTGG - Intronic
1194062980 X:89227552-89227574 GATCCAACCACTTAGGTGTCTGG - Intergenic
1196659888 X:118258750-118258772 GATCCTCTCACCTCTGTGTTGGG + Intergenic
1197277222 X:124494016-124494038 GATTTCCCCAGCTAGGTGTTAGG + Intronic
1200716791 Y:6556220-6556242 GATCCAACCACTTAGGTGTCTGG - Intergenic
1202080449 Y:21078733-21078755 GATCTTGTCACCTAGGTGCTGGG - Intergenic
1202252771 Y:22890189-22890211 GATCATTTCACCTAGGTGATAGG + Intergenic
1202405760 Y:24523938-24523960 GATCATTTCACCTAGGTGATAGG + Intergenic
1202465020 Y:25146144-25146166 GATCATTTCACCTAGGTGATAGG - Intergenic