ID: 955288286

View in Genome Browser
Species Human (GRCh38)
Location 3:57666337-57666359
Sequence CCCATTCTGTCATGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955288282_955288286 26 Left 955288282 3:57666288-57666310 CCAGTTTCATCAATTTTAGAGCT 0: 1
1: 0
2: 0
3: 17
4: 214
Right 955288286 3:57666337-57666359 CCCATTCTGTCATGTTTTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 162
955288283_955288286 -6 Left 955288283 3:57666320-57666342 CCTATCAATCATTTTAACCCATT 0: 1
1: 0
2: 0
3: 23
4: 215
Right 955288286 3:57666337-57666359 CCCATTCTGTCATGTTTTGGAGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955288286 Original CRISPR CCCATTCTGTCATGTTTTGG AGG Intronic
900274104 1:1812186-1812208 CCCACTCTGTCATGTGGTGGGGG + Intronic
901608737 1:10479734-10479756 CGCATCCTGGCAGGTTTTGGTGG + Intronic
904994939 1:34624252-34624274 CTCATTCTGCCATGGGTTGGAGG + Intergenic
905079839 1:35308453-35308475 CCCAATCTCTCATAATTTGGTGG + Intronic
910090469 1:83456950-83456972 TACATTCTGCAATGTTTTGGGGG + Intergenic
912963154 1:114213825-114213847 CCCATTCTGTGCAGTCTTGGGGG + Intergenic
916072165 1:161176783-161176805 CCCAATCTGTCCTGTTGGGGTGG - Intronic
916238805 1:162617927-162617949 CCCAAGCTATCATGTTTTTGAGG + Intergenic
916836951 1:168555481-168555503 CCTTTTCTGTAATGTTTTGAAGG - Intergenic
919004862 1:191884407-191884429 CTGGTTCTTTCATGTTTTGGGGG - Intergenic
920983479 1:210861570-210861592 CCCATTCTGTCAGGTTCTGTTGG + Intronic
922311633 1:224398132-224398154 ACAATTCATTCATGTTTTGGAGG - Exonic
922821924 1:228490501-228490523 TTCAATCTGTCCTGTTTTGGGGG + Intronic
924254470 1:242169117-242169139 ACCCTTTTTTCATGTTTTGGGGG - Intronic
1064477958 10:15711769-15711791 CCCTTTCTTTCTTTTTTTGGGGG - Intronic
1064596577 10:16951579-16951601 GCCATTCTGTCATGTCCTTGAGG + Intronic
1064946566 10:20796924-20796946 TTCTTTCTGTCTTGTTTTGGGGG - Intronic
1065013255 10:21438590-21438612 CCCGCTTTGTCATGTTTTCGAGG + Intergenic
1066556800 10:36623255-36623277 GGCATTCTGTCATGCTTTGAGGG - Intergenic
1068349173 10:55821185-55821207 CCTATTATGTGATATTTTGGGGG - Intergenic
1069261865 10:66408417-66408439 CCCCTTCTGTCATGTGGTCGAGG - Intronic
1072479667 10:95798488-95798510 CCCATTCTCTCAGGATTGGGTGG - Intronic
1072505910 10:96066881-96066903 GCCATTTTGTCTTATTTTGGTGG - Intergenic
1074061287 10:109968135-109968157 CCCATTTTGACATGTCTTGGTGG - Intergenic
1074469921 10:113717601-113717623 CCCATTCTGGCATTTTCTGAAGG + Intronic
1077666863 11:4119192-4119214 TCCATTATGTTGTGTTTTGGAGG + Intronic
1078228584 11:9417085-9417107 TCCATTCTGTCAGGTTCTGTTGG - Exonic
1078657833 11:13258942-13258964 CCCATTCTGACACTTTTTGTAGG - Intergenic
1080428863 11:32180161-32180183 CCTATCCTGTCATGCCTTGGGGG + Intergenic
1081710888 11:45214561-45214583 CCCATTCTGTGGTTCTTTGGGGG + Intronic
1083574061 11:63776556-63776578 CCCCTTCTGCCATGATTTTGAGG + Intergenic
1085762485 11:79254199-79254221 CCTATCTTGGCATGTTTTGGGGG - Intronic
1087961650 11:104358077-104358099 CAAATTCTCCCATGTTTTGGAGG + Intergenic
1088294014 11:108272291-108272313 ACCATTATGTCCTTTTTTGGGGG - Intronic
1092769477 12:11883798-11883820 CTCATTCTATCACATTTTGGAGG - Intronic
1094383009 12:29864074-29864096 CTCATTCTGTCATTTGTAGGTGG + Intergenic
1097351012 12:58549215-58549237 AATATTCTGTTATGTTTTGGAGG - Intronic
1097667788 12:62500611-62500633 CCCATTTTTTTTTGTTTTGGAGG + Intronic
1098049557 12:66439081-66439103 TGCTTTCTGTCATGTTTGGGTGG - Intronic
1098255666 12:68612459-68612481 CCCACCCTGTCATTTTATGGAGG + Intronic
1101171371 12:102099191-102099213 CTCTTTCTGTCAGGTTTTAGAGG - Exonic
1101566028 12:105906322-105906344 CCCATTCTTGCATGGTTTAGTGG - Intergenic
1103418193 12:120758781-120758803 CCCATTCTGTCAGTCTTTTGTGG - Intergenic
1107412579 13:40171911-40171933 CCCATTTTGTTTTGTTGTGGTGG + Intergenic
1108504782 13:51102942-51102964 CCCATGCTGTCATGATAGGGAGG - Intergenic
1110028410 13:70571773-70571795 CGCATTCTGTCATGATTGTGAGG + Intergenic
1112761917 13:102701160-102701182 GCCATGCTGTCAAGGTTTGGGGG + Intergenic
1114921803 14:27342014-27342036 CGCATTCTGCCATGATTTTGAGG + Intergenic
1118194403 14:63611389-63611411 CCCAATCTGTGATGATTTGTTGG - Intronic
1118806966 14:69246270-69246292 CTAGTTCTGTCATGTATTGGAGG + Intergenic
1120863430 14:89275346-89275368 TCCATTCTGACCTATTTTGGGGG + Intronic
1121945903 14:98121660-98121682 CCCATTTTTTCATGTTTTTCTGG + Intergenic
1123179466 14:106455122-106455144 CCCATTCTGTCATGATTGTCAGG - Intergenic
1127398241 15:58560599-58560621 CCTATTCTGCCATCTTTTGTTGG + Intronic
1127945881 15:63752281-63752303 CTTATTCTGTCATGTATAGGAGG - Intronic
1128729301 15:70009844-70009866 CACATTCTCTCATGTGATGGGGG + Intergenic
1130242663 15:82210910-82210932 GCCATTCTTGCATGGTTTGGTGG - Intronic
1131620219 15:94060384-94060406 CACATTGTGTCATGTTTTTATGG - Intergenic
1132112141 15:99109441-99109463 TTCATTCAATCATGTTTTGGGGG - Intronic
1132558352 16:582519-582541 CCCATTCTGCCCTGTGTCGGAGG + Intronic
1136691062 16:32029670-32029692 CACATTCTGCCATGATTTCGAGG - Intergenic
1136791651 16:32973230-32973252 CACATTCTGCCATGATTTCGAGG - Intergenic
1136878165 16:33880700-33880722 CACATTCTGCCATGATTTCGAGG + Intergenic
1140554606 16:75907506-75907528 CCCTTTCTGTCTTGTTTTGTTGG - Intergenic
1140770917 16:78203254-78203276 CCCATCCTGCAATGGTTTGGGGG + Intronic
1203093860 16_KI270728v1_random:1234691-1234713 CACATTCTGCCATGATTTCGAGG - Intergenic
1144583135 17:16471322-16471344 CATATTCTCTCATGGTTTGGAGG - Intronic
1146825503 17:36019092-36019114 CCCATTCTGTTAGGTTTTTATGG + Intergenic
1155632307 18:27907428-27907450 CACATAGTGTCATGTTTTTGAGG + Intergenic
1157206102 18:45701147-45701169 TCCATTGTTTCATGTTTTGTAGG - Intergenic
1157636626 18:49162963-49162985 GCCATTGGGTCCTGTTTTGGGGG - Intronic
1161463666 19:4414900-4414922 CCCCTGCTGTCAGGTTTTAGCGG + Intronic
1162274796 19:9644565-9644587 CACCTTCTGTCATGATTTTGAGG - Intronic
1165439850 19:35819027-35819049 CCCATTGTGTTCTGTTTTGCAGG - Intergenic
1166427383 19:42691636-42691658 CCTTTTCTGTCTTGTTTTGGAGG + Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925540753 2:4964978-4965000 CACAATCTGTCATGTTTTTATGG - Intergenic
928438364 2:31270924-31270946 CTCAGTCTGTCATGATTTAGTGG - Intergenic
929406316 2:41646685-41646707 TACATTCTGACATTTTTTGGTGG - Intergenic
932492326 2:72130292-72130314 CCCATTCTGGCCTGTTTTTCAGG + Exonic
932903901 2:75729516-75729538 GCGATTGTGTCATGGTTTGGTGG + Intergenic
933627530 2:84618551-84618573 CCAACTCTCTCATGTTCTGGAGG - Intronic
938803958 2:134788689-134788711 CCACATTTGTCATGTTTTGGTGG + Intergenic
943880424 2:193137573-193137595 CACTTTCCATCATGTTTTGGAGG + Intergenic
945344600 2:208698214-208698236 CCCATTGTGGGATGTTTTAGTGG + Intronic
948350613 2:237337651-237337673 CACAGTGTGTCATGCTTTGGAGG - Intronic
1171476823 20:25416379-25416401 CCCATCCTGTCATGTCTTCTAGG - Intronic
1172893947 20:38286505-38286527 CACATTCTGTGATATTGTGGGGG + Intronic
1173963340 20:47091979-47092001 CCCATTGTGTGCTATTTTGGTGG - Intronic
1174561447 20:51433339-51433361 TCCATTCTGTAGTGCTTTGGGGG + Intronic
1175726721 20:61323553-61323575 ACCATTCTGTCATGTTACGCGGG + Intronic
1177923192 21:27180300-27180322 CCCATTTTGTCTTCTTATGGAGG + Intergenic
1179175029 21:39002045-39002067 CCTATTTTGTCATATTTTGCTGG - Intergenic
1180146829 21:45925616-45925638 CCCATTCTTTCATTTTTTCTGGG - Intronic
1181316936 22:21976665-21976687 CCCATCGTGTCCTATTTTGGGGG - Intronic
950973027 3:17208771-17208793 TGCATTCTATCATATTTTGGTGG - Intronic
951686565 3:25350895-25350917 CCCATGGTGTCATTGTTTGGAGG + Intronic
951763682 3:26172955-26172977 CCTATTATATCATGTTTAGGTGG + Intergenic
952686602 3:36156992-36157014 ACTATTCTGTCATGTAATGGTGG + Intergenic
952806182 3:37355022-37355044 CCCATTCTGACATGTTCTGCTGG - Intronic
953473798 3:43189089-43189111 CCAACTCTGCCATGTTTGGGTGG + Intergenic
955288286 3:57666337-57666359 CCCATTCTGTCATGTTTTGGAGG + Intronic
956667326 3:71654422-71654444 ACCCTTCTCTCCTGTTTTGGGGG + Intergenic
960717510 3:120591964-120591986 CCCAGTATGTCTTCTTTTGGAGG + Intergenic
961187248 3:124926467-124926489 CCCAATCTTTCATGTTTGGAGGG - Intronic
962069557 3:132018958-132018980 CCCATTATTTCACGTTTTGGTGG - Intronic
966673743 3:182561801-182561823 GCCATTTTGTAATATTTTGGTGG - Intergenic
967351154 3:188515112-188515134 CACATTCTGACATGATTTGGAGG - Intronic
968960946 4:3743390-3743412 CTCATTCTGGCAGGTTCTGGGGG + Intergenic
971899007 4:32634383-32634405 CCCATTCTTTCCCATTTTGGAGG + Intergenic
972852184 4:43063931-43063953 GCCATGCTGTCATATTTGGGGGG - Intergenic
973572043 4:52250519-52250541 CCCACTCTGTGTGGTTTTGGAGG + Intergenic
975272376 4:72450866-72450888 CCCATTTATTCCTGTTTTGGGGG - Intronic
975444697 4:74449066-74449088 CACTTTCCGTCTTGTTTTGGGGG - Exonic
980272195 4:130599112-130599134 CCCATTCTGTTGTGTTTTAAAGG + Intergenic
980301533 4:131001204-131001226 CAATTTCTGTCAGGTTTTGGGGG - Intergenic
983372777 4:166883868-166883890 CCCATTCCTTTATGTTTTAGCGG - Intronic
983438287 4:167745836-167745858 CACATTCTGGGATTTTTTGGTGG + Intergenic
985938990 5:3119329-3119351 CTCATTCTTCCATATTTTGGGGG + Intergenic
986122750 5:4857401-4857423 CCCATTATCCCCTGTTTTGGGGG + Intergenic
990401541 5:55442771-55442793 AGCATTCTGTCATTTTTAGGTGG - Intronic
991563357 5:67978658-67978680 CCCATTCTGTCCTTTTAAGGAGG + Intergenic
995791611 5:115894214-115894236 CACATTATGACATATTTTGGGGG - Intronic
997125926 5:131226752-131226774 CCAATTCTGGCATGTTTAGTTGG + Intergenic
1004219220 6:13731133-13731155 CCCTCTCTCTCATATTTTGGGGG - Intergenic
1007200113 6:40100255-40100277 CCCTTTGTCTCAGGTTTTGGTGG + Intergenic
1009506345 6:64485089-64485111 CCCTTTCTTTCCTTTTTTGGGGG - Intronic
1009669330 6:66726575-66726597 CCCATTCACTCCTCTTTTGGGGG - Intergenic
1013020108 6:106206239-106206261 CCCCTTCTGCCATGTTGGGGGGG + Intronic
1013570603 6:111420699-111420721 GCCATGGTGTCAAGTTTTGGTGG - Intronic
1015045307 6:128769237-128769259 CACATTCTGCCATGATTTTGAGG - Intergenic
1015276871 6:131391255-131391277 GACATTCTGTCATTTTCTGGAGG + Intergenic
1016758094 6:147708884-147708906 CCCAGTCTGTCTGGTTTTGTTGG + Intronic
1019926249 7:4195184-4195206 CACATTCTATCATATTTTTGTGG + Intronic
1020562688 7:9750095-9750117 CCAATTCAGCCATGGTTTGGGGG - Intergenic
1021048452 7:15952718-15952740 CCCATTCTTTTTTTTTTTGGCGG - Intergenic
1023247993 7:38227047-38227069 CCCATTTTGCCACATTTTGGGGG + Intronic
1023248457 7:38232355-38232377 CCCACTCTGCCATGTTTCGGTGG + Intergenic
1023369401 7:39497995-39498017 CCCATTTTCTCATGTTTGGTGGG + Intergenic
1023901467 7:44484041-44484063 CTCTTTCTGACGTGTTTTGGGGG - Intronic
1024155912 7:46624925-46624947 TCCATTCTGTGAAGTTTTAGGGG + Intergenic
1024577023 7:50773055-50773077 CACCTTCTGTCATGATTTTGAGG - Intronic
1026720320 7:72825265-72825287 CCCATTCTCTCTTTTTTGGGGGG - Intronic
1029114232 7:98229157-98229179 CCCATCCTTCCAGGTTTTGGCGG - Exonic
1030287607 7:107842612-107842634 CCAATTCTTTCATATTTTAGAGG + Intergenic
1030553886 7:110998975-110998997 TTCAGTCTGTCATTTTTTGGAGG + Intronic
1030742709 7:113128695-113128717 CCCATTCTTTTATGTTTTCTGGG - Intergenic
1030775500 7:113529928-113529950 AGCATTGTGTCCTGTTTTGGGGG + Intergenic
1031872934 7:127107337-127107359 CCTTTTCTGTGATGTTTTGAAGG - Intronic
1032131414 7:129231599-129231621 GCCCTGCTGTCATGTTTAGGTGG + Intronic
1033200925 7:139369427-139369449 CCAATGCTATCATGTTTTGGGGG - Intronic
1034943737 7:155248773-155248795 TTCATTCTCTCATGTTCTGGAGG + Intergenic
1036681458 8:10877542-10877564 CCCCTTCAGTTATGTTCTGGAGG - Intergenic
1038461978 8:27724766-27724788 CCCATTCTTCCAAATTTTGGGGG + Intergenic
1038690113 8:29753633-29753655 CTGATTTTGTCATGTTGTGGGGG - Intergenic
1038771159 8:30481660-30481682 CTAATTCTGTCCTGTTTTGTGGG + Intronic
1038914193 8:32001921-32001943 TCCATTCTGTACTGTTTGGGAGG + Intronic
1039328099 8:36506912-36506934 CCCATTCTGTGTTGGTTTGATGG - Intergenic
1039814783 8:41083678-41083700 CCCATAATGTCATGGTTTGGGGG + Intergenic
1040106124 8:43543047-43543069 CACATCCTTTCATGTTTTTGTGG - Intergenic
1040978193 8:53217209-53217231 CTAATACTGTCATGTGTTGGTGG - Intergenic
1042442243 8:68841987-68842009 GCCACTGTGTCATATTTTGGGGG + Intergenic
1043800452 8:84603251-84603273 GTCAGTGTGTCATGTTTTGGGGG - Intronic
1045543544 8:103108411-103108433 CCCAATTTGTGATATTTTGGGGG - Intergenic
1046422958 8:114008485-114008507 CCCATTCTGTGACAGTTTGGAGG + Intergenic
1047909588 8:129513266-129513288 CACCTTCTGTCATGATTTTGAGG - Intergenic
1053024727 9:34720142-34720164 CCCTTTATGACATGTTTTGAGGG - Intergenic
1055869575 9:80858141-80858163 CCCATTATGTCAATTTTTGGTGG + Intergenic
1058371645 9:104275903-104275925 CATATTCTGTCATGTGATGGAGG - Intergenic
1060098369 9:120814166-120814188 CTTATTCTCTCATGTTTTTGAGG + Intergenic
1061991242 9:134159805-134159827 CCCCTTCAGTCTTGTTCTGGGGG + Exonic
1187425467 X:19174078-19174100 CCCACTCTGTCTTGTCTTGGAGG - Intergenic
1188262081 X:28034182-28034204 CCCATTCTGTCCTCTTTTCAGGG - Intergenic
1189948490 X:46204309-46204331 GCCAGTCTGTCAAGTTTTGGAGG + Intergenic
1195448890 X:104987094-104987116 CCCATTTTCTCACATTTTGGTGG + Intronic
1196406237 X:115365601-115365623 CCCACTCTGTCTTTTTTTGGTGG + Intergenic
1197979736 X:132202839-132202861 ACCATTCTGGCATATTTTGGGGG - Intergenic
1198570914 X:137955773-137955795 CCCAATTTGTCATTGTTTGGGGG - Intergenic
1201978395 Y:19879761-19879783 CCCATTCTTCCATTTTTGGGAGG - Intergenic