ID: 955298716

View in Genome Browser
Species Human (GRCh38)
Location 3:57756953-57756975
Sequence GAGGTTCTCCGCGCGAGGCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955298716_955298722 5 Left 955298716 3:57756953-57756975 CCACGCCTCGCGCGGAGAACCTC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 955298722 3:57756981-57757003 CCGCCGTCTCGGATCGTGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 29
955298716_955298724 9 Left 955298716 3:57756953-57756975 CCACGCCTCGCGCGGAGAACCTC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 955298724 3:57756985-57757007 CGTCTCGGATCGTGCCAGGCCGG 0: 1
1: 0
2: 0
3: 4
4: 34
955298716_955298725 10 Left 955298716 3:57756953-57756975 CCACGCCTCGCGCGGAGAACCTC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 955298725 3:57756986-57757008 GTCTCGGATCGTGCCAGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 58
955298716_955298726 11 Left 955298716 3:57756953-57756975 CCACGCCTCGCGCGGAGAACCTC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 955298726 3:57756987-57757009 TCTCGGATCGTGCCAGGCCGGGG 0: 1
1: 0
2: 0
3: 0
4: 39
955298716_955298718 -6 Left 955298716 3:57756953-57756975 CCACGCCTCGCGCGGAGAACCTC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 955298718 3:57756970-57756992 AACCTCAGCCACCGCCGTCTCGG 0: 1
1: 0
2: 0
3: 7
4: 115
955298716_955298729 30 Left 955298716 3:57756953-57756975 CCACGCCTCGCGCGGAGAACCTC 0: 1
1: 0
2: 0
3: 8
4: 86
Right 955298729 3:57757006-57757028 GGGGACCGCGTCCCCCTTCCCGG 0: 1
1: 0
2: 0
3: 15
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955298716 Original CRISPR GAGGTTCTCCGCGCGAGGCG TGG (reversed) Exonic
921355435 1:214281031-214281053 GAGGGTCGCGGCGCTAGGCGGGG + Intergenic
1067806887 10:49398513-49398535 GAGGAGCGCCGGGCGAGGCGAGG - Intergenic
1084516888 11:69642285-69642307 GACCTTCTCCGAGCGAGCCGGGG + Intronic
1084806802 11:71584698-71584720 GAGGTGCCCCCCGCGATGCGAGG + Intronic
1092537479 12:9403192-9403214 GAGGCACACCTCGCGAGGCGGGG + Intergenic
1092538066 12:9404940-9404962 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092538441 12:9405894-9405916 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092539098 12:9408626-9408648 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1092556580 12:9567705-9567727 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1094513924 12:31117326-31117348 GAGGCACGCCACGCGAGGCGGGG + Intergenic
1094514023 12:31117692-31117714 GAGGCACTCCCCGCGAGGCGAGG + Intergenic
1094514072 12:31117851-31117873 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514601 12:31119565-31119587 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514776 12:31120117-31120139 GAGGTACACCCCGCGAGGCGGGG + Intergenic
1094514891 12:31120448-31120470 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094514976 12:31120804-31120826 GAGGCTCCCCCCGCGAAGCGGGG + Intergenic
1094515066 12:31121045-31121067 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515328 12:31122458-31122480 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1094515507 12:31122933-31122955 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1096723485 12:53542133-53542155 TAGGGTCTCCGGGCCAGGCGTGG + Intronic
1103412867 12:120725207-120725229 GAGCTTCTCGGAGCGAGTCGGGG + Intergenic
1104841636 12:131828619-131828641 GAGGTCCTCGGCGCGCGGCGCGG - Exonic
1107941691 13:45382166-45382188 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1109537980 13:63741139-63741161 GAGGCACACCCCGCGAGGCGGGG - Intergenic
1109538151 13:63741694-63741716 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1109545661 13:63837999-63838021 GAGGCACTCCCCGTGAGGCGGGG + Intergenic
1109546287 13:63840713-63840735 GAGGCACACCCCGCGAGGCGGGG + Intergenic
1109546712 13:63842329-63842351 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1110891890 13:80705756-80705778 GAGGCACCCCTCGCGAGGCGGGG + Intergenic
1121470048 14:94145860-94145882 GAAGTTCTCTGGGCCAGGCGTGG - Intergenic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1132779090 16:1613097-1613119 GGGGTTCTCAGCCCGAGACGAGG + Intronic
1134044071 16:11088615-11088637 GAAGCTCTCCGCGCGTGGCTGGG - Intronic
1134625440 16:15719556-15719578 GAGGCTCTCCTAGCAAGGCGAGG + Intronic
1143749964 17:9021174-9021196 GAGGCTCTCCGGGCGGCGCGGGG + Intergenic
1160851385 19:1194563-1194585 GAGGATCTCACCGCGGGGCGGGG + Intronic
1164835773 19:31354262-31354284 GAGGTTCTCGGAGGGAGGCTTGG + Intergenic
1165832274 19:38735859-38735881 GTGGTTCTGCGGGCGGGGCGGGG + Intronic
936396913 2:112138407-112138429 GAGACAGTCCGCGCGAGGCGGGG - Exonic
944451691 2:199850687-199850709 TAGGTTCTCCGCGGGTGGGGAGG - Intronic
946882241 2:224188051-224188073 GAGGTTCTCAGTCCAAGGCGTGG - Intergenic
948835870 2:240625709-240625731 GGGGTTCTCAGAGCGAGGTGAGG + Intronic
1181141095 22:20805540-20805562 GAGGTTGTCAGGGCCAGGCGCGG + Intronic
1183539580 22:38422273-38422295 GAGATTCTCCTGGCCAGGCGTGG - Intergenic
1183656191 22:39186144-39186166 GAGGTTCTCCAGGCTGGGCGCGG + Intergenic
1184760010 22:46538504-46538526 GTGGTTCCCCGCAGGAGGCGGGG - Intergenic
1185335691 22:50270080-50270102 GAGGTTCTCGGCGTGGGGAGGGG - Intronic
949883466 3:8678495-8678517 GAGGCACCCCCCGCGAGGCGGGG + Intronic
949883522 3:8678653-8678675 GAGGCACCCCCCGCGAGGCGGGG + Intronic
955298716 3:57756953-57756975 GAGGTTCTCCGCGCGAGGCGTGG - Exonic
964121924 3:153194102-153194124 GAGCTTCTCCGCGTCAGGTGTGG + Intergenic
966715584 3:183010388-183010410 AAGGTTCTCCGCACTAGGCAAGG + Intergenic
969260905 4:6032846-6032868 GAGGGTCTCAGCGGGAGGCGGGG + Intronic
1002269317 5:178059374-178059396 GATGTTCTCCTGGCCAGGCGTGG - Intergenic
1004881222 6:20010545-20010567 GAGGTTCTCAGGGCGAGGAGAGG - Intergenic
1034303314 7:150034060-150034082 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304025 7:150036891-150036913 GAGGCACTCCCCGCGAGGCGGGG - Intergenic
1034304172 7:150037360-150037382 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304544 7:150038788-150038810 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304658 7:150039178-150039200 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034304914 7:150039963-150039985 GAGGCAATCCCCGCGAGGCGGGG - Intergenic
1034304940 7:150040042-150040064 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034305234 7:150041535-150041557 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034305545 7:150042487-150042509 GAGGCAATCCCCGCGAGGCGGGG - Intergenic
1034305573 7:150042566-150042588 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1034801303 7:154058166-154058188 GAGGCAATCCCCGCGAGGCGGGG + Intronic
1034801806 7:154060018-154060040 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034801944 7:154060415-154060437 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1034802257 7:154061704-154061726 GAGGCAATCCCCGCGAGGCGGGG + Intronic
1034802623 7:154062816-154062838 GAGGCACCCCCCGCGAGGCGGGG + Intronic
1044973653 8:97643890-97643912 GAGGGGCTCCGTGCAAGGCGGGG - Intergenic
1051774734 9:20621664-20621686 GAGGTGCTGAGCGCGAGCCGAGG - Intronic
1052035462 9:23675354-23675376 GAGGTGCTGCACACGAGGCGGGG + Intergenic
1053736227 9:41104675-41104697 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736253 9:41104755-41104777 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736572 9:41106685-41106707 GAGGCACTCCCCGCGAGGCGGGG + Intergenic
1053736619 9:41106845-41106867 GAGGCACCCCTCGCGAGGCGGGG + Intergenic
1053736688 9:41107081-41107103 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736727 9:41107186-41107208 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1053736835 9:41107499-41107521 GAGGCACACCCCGCGAGGCGGGG + Intergenic
1053737228 9:41108968-41108990 GAGGCACCCCCCGCGAGGCGGGG + Intergenic
1054691121 9:68322351-68322373 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691538 9:68323898-68323920 GAGGCACACCCCGCGAGGCGGGG - Intergenic
1054691591 9:68324056-68324078 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691646 9:68324214-68324236 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691683 9:68324319-68324341 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054691752 9:68324555-68324577 GAGGCACCCCTCGCGAGGCGGGG - Intergenic
1054691799 9:68324715-68324737 GAGGCACTCCCCGCGAGGCGGGG - Intergenic
1054692120 9:68326645-68326667 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1054692147 9:68326725-68326747 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1061040602 9:128138926-128138948 GAGGAACCCCCCGCGAGGCGGGG - Intergenic
1061040708 9:128139243-128139265 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1061040841 9:128139644-128139666 GAGGCACCCCCCGCGAGGCGGGG - Intergenic
1061216010 9:129222436-129222458 GAGGTTCTCGGTGAGAGGTGAGG - Intergenic
1193254914 X:79336907-79336929 GAGGTTCTCAGCACCAGGCCTGG - Intergenic