ID: 955302789

View in Genome Browser
Species Human (GRCh38)
Location 3:57799031-57799053
Sequence CAGCTACATCATGCAGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955302789_955302791 -3 Left 955302789 3:57799031-57799053 CCCATCTCTGCATGATGTAGCTG 0: 1
1: 0
2: 0
3: 13
4: 150
Right 955302791 3:57799051-57799073 CTGCAGAAGCAGCCCAATGCAGG 0: 1
1: 0
2: 0
3: 22
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955302789 Original CRISPR CAGCTACATCATGCAGAGAT GGG (reversed) Intronic
901846162 1:11983938-11983960 CAGATAAATCAGGCAGAGTTTGG + Intronic
904086186 1:27910292-27910314 CATCTACTACATGTAGAGATTGG - Intronic
906075588 1:43049608-43049630 AGGCTGCATCAGGCAGAGATGGG + Intergenic
906157393 1:43621789-43621811 CAGCTACATCAGGCAGTGTGCGG - Intronic
906451651 1:45954503-45954525 GAGCTACCTCATGCAAAGACTGG - Intronic
907293963 1:53437720-53437742 CAGCAACATCAGGAAGAGAAGGG + Intergenic
907710945 1:56880897-56880919 CAGCTAGATGTGGCAGAGATGGG + Intronic
908410780 1:63862518-63862540 CAGCTACATGAAGAACAGATGGG - Intronic
911137732 1:94459156-94459178 CAGCTACTTCAGGCTGAGGTAGG - Intronic
913572089 1:120130922-120130944 CAGCTAGAATGTGCAGAGATGGG + Intergenic
914293012 1:146292558-146292580 CAGCTAGAATGTGCAGAGATGGG + Intergenic
914554056 1:148743341-148743363 CAGCTAGAATGTGCAGAGATGGG + Intergenic
915472910 1:156136467-156136489 CAGCTGCATCAGGGAGAGAGTGG + Intronic
915997307 1:160576303-160576325 CATCAACATCATGCTGATATTGG + Intronic
917392485 1:174553827-174553849 CAGCTAATTTTTGCAGAGATGGG - Intronic
918002363 1:180509344-180509366 CACCCACATCCTGCTGAGATTGG - Intergenic
920148411 1:203883317-203883339 CAGCTAAATTTTGTAGAGATGGG - Intergenic
921668440 1:217900533-217900555 CAGCTATTTTTTGCAGAGATGGG - Intergenic
1063795465 10:9509766-9509788 CAGCTAGATATTGCAGATATGGG + Intergenic
1068605000 10:58995520-58995542 AGGGTACATCATGCAGTGATGGG - Intergenic
1069236919 10:66087267-66087289 GAGCTTCCTCATGCAGAGAAAGG - Intronic
1069349996 10:67513778-67513800 AAGCTGCATGATGCTGAGATTGG - Intronic
1069359214 10:67622769-67622791 CAGTAAAATCATGCAGAAATTGG + Intronic
1069597478 10:69681733-69681755 TAGCTCCATGATGCAGATATGGG + Intergenic
1070241649 10:74688077-74688099 TAGCTACATCATGCAGGCAAAGG - Intronic
1070473945 10:76813856-76813878 CACCTACATGCTGGAGAGATCGG + Intergenic
1071690564 10:87815326-87815348 CAGCTACATCAATCAAAGCTAGG + Intronic
1075143354 10:119861674-119861696 AAGCTACATCAAGCAGTGACTGG + Intronic
1075676964 10:124302415-124302437 CAGCTACAAAATGCAGAAACAGG - Intergenic
1079883341 11:25954165-25954187 CTGCTACATCATGCTGACAGAGG - Intergenic
1081863928 11:46349294-46349316 AGGCTACATCCTGCAGAGCTGGG - Intronic
1083788456 11:64968431-64968453 CAGCTAATTTTTGCAGAGATGGG + Intronic
1083900124 11:65639574-65639596 CAGCAACATCATGCGGGGCTGGG - Intronic
1090266321 11:125355421-125355443 CAGTTACAGCATGCTGAAATTGG - Intronic
1092698186 12:11197617-11197639 CATCTACATCATTTGGAGATGGG - Intergenic
1093449608 12:19300002-19300024 CAGGTACACCATGCAGAGAACGG - Intronic
1093847200 12:23987495-23987517 CAACTCCATCATGAAGAGCTGGG + Intergenic
1096842972 12:54390528-54390550 CAGCTACAGCAGGGAGAGAGAGG + Intronic
1097201691 12:57284329-57284351 CATATACATGATGCTGAGATTGG + Intronic
1098084993 12:66833103-66833125 TGGCTGCATCCTGCAGAGATGGG - Intergenic
1098756095 12:74365235-74365257 CTACAACTTCATGCAGAGATGGG - Intergenic
1100428297 12:94507837-94507859 CAGCTACAATATGCATAGTTAGG - Intergenic
1101462813 12:104913898-104913920 CAGCTAATTTTTGCAGAGATGGG - Intronic
1104362372 12:128146024-128146046 CACCACCATCATGCAGACATGGG - Intergenic
1109082901 13:57929854-57929876 CAGCAATATCATGCAGATAATGG - Intergenic
1109379136 13:61535554-61535576 CAGCTGCTTCATGCAGAGCAGGG - Intergenic
1110758792 13:79207371-79207393 CAGCTACATCTTTAAGAGATGGG - Intergenic
1112818489 13:103302052-103302074 TAGGTACAGCAAGCAGAGATGGG + Intergenic
1113665325 13:112137050-112137072 CAGCTCCAGCATGCTGAGCTAGG + Intergenic
1113886149 13:113659266-113659288 CATCAACCTCCTGCAGAGATGGG - Intergenic
1117088507 14:52225797-52225819 CAGCTACTTCCTGCTGAGAAGGG - Intergenic
1121526162 14:94620945-94620967 CAGCTACCTCCTGAAGAGAAAGG + Intronic
1121787811 14:96675643-96675665 AAGTTCCATTATGCAGAGATAGG + Intergenic
1123130301 14:105980310-105980332 AAGCTTCATCATGCATGGATAGG + Intergenic
1123480083 15:20622955-20622977 CATCTACATCATCTAGAAATAGG - Intergenic
1123580532 15:21711438-21711460 AAGCTTCATCATGCATGGATAGG + Intergenic
1123617180 15:22154061-22154083 AAGCTTCATCATGCATGGATAGG + Intergenic
1123637924 15:22377409-22377431 CATCTACATCATCTAGAAATAGG + Intergenic
1126067480 15:44837222-44837244 AAACTACATCAAGGAGAGATGGG + Intergenic
1126363162 15:47866796-47866818 CAGATACATCATGCACATCTGGG - Intergenic
1131817883 15:96241262-96241284 CAGTTATAGCATGAAGAGATAGG - Intergenic
1132424820 15:101706786-101706808 CAGTTAAATCATGCAGATACGGG - Intronic
1202989402 15_KI270727v1_random:445683-445705 AAGCTTCATCATGCATGGATAGG + Intergenic
1133113532 16:3563610-3563632 CAGCTGCTTCCTGCAGAGAGAGG - Exonic
1136060543 16:27723411-27723433 CAGGAATATCAGGCAGAGATGGG - Intronic
1137423150 16:48353389-48353411 CAGCTACTTGAGGCTGAGATGGG + Exonic
1141092150 16:81137656-81137678 CAGCTCCCTTCTGCAGAGATGGG + Intergenic
1141208640 16:81955845-81955867 AAATTACATCTTGCAGAGATGGG - Intronic
1143587897 17:7860263-7860285 CAGCTACTCAAGGCAGAGATGGG - Exonic
1146785126 17:35713215-35713237 CACCTACAGCATGGAGCGATTGG - Intronic
1147562032 17:41515190-41515212 CATCTATCTCATGCAGAGAATGG + Intronic
1149407225 17:56365699-56365721 CAGCTACATCATTAAGCAATAGG - Intronic
1151092108 17:71452893-71452915 CAGTTACATCAGGCACAAATGGG - Intergenic
1151254809 17:72868287-72868309 CATCCAGATCATGCAGAGTTGGG - Intronic
1156859206 18:41816830-41816852 CAACTACATCAGGGAGAGATGGG + Intergenic
1158626838 18:59078865-59078887 AGGCTACATCTTGCAGATATGGG + Intergenic
1160787642 19:908694-908716 CAGGTGCATCAGGCAGAGACCGG - Intronic
1161504672 19:4637456-4637478 CAGCCAGATGAGGCAGAGATGGG - Intergenic
1162663577 19:12191078-12191100 CTGCTGCATTATGCAGAGATGGG + Intergenic
1164533815 19:29069192-29069214 CAGGTTCAGCATGCAGAGCTTGG + Intergenic
1167413623 19:49359458-49359480 CCGCTACATCAAGCTGAGAACGG - Exonic
925685235 2:6464546-6464568 CAGGCACATTCTGCAGAGATAGG - Intergenic
925702781 2:6655500-6655522 CTCCAACATCATGCAGAGATAGG + Intergenic
926689766 2:15725253-15725275 CAGCTCCCTCATGCACACATGGG + Intronic
927455043 2:23241969-23241991 CAGCGACAGCCTGCAGAGCTAGG + Intergenic
930363254 2:50408429-50408451 CAGCTACATCATGCAGCCTTGGG - Intronic
930664400 2:54087935-54087957 CAGTTAGATTATGCAAAGATGGG + Intronic
931684972 2:64785036-64785058 CAGCTGCACCAAGGAGAGATGGG + Intergenic
935841600 2:107117712-107117734 CCTCTACCTCATGGAGAGATTGG + Intergenic
940391869 2:153141606-153141628 GAGCTTCATCATGCAGAGCTGGG + Intergenic
940840503 2:158574895-158574917 TAGCTACATCATGCATGTATAGG + Intronic
941716854 2:168773151-168773173 ATGCAACATCATGAAGAGATTGG - Exonic
942931729 2:181501989-181502011 CCGCTACAACATGAAGAGGTTGG + Intronic
947962819 2:234253836-234253858 CAGATCAATCATTCAGAGATGGG + Intergenic
1168803223 20:657237-657259 AAGCCTCATAATGCAGAGATTGG - Intronic
1169619694 20:7491586-7491608 CAAGTACAACATGGAGAGATGGG + Intergenic
1169657188 20:7938234-7938256 CAGCTACATGATGCAGTGTGAGG + Intronic
1171135150 20:22688859-22688881 CAGGAACAGCATGCACAGATGGG - Intergenic
1172355192 20:34275031-34275053 CAGCTGCACCATGAAGGGATTGG + Intergenic
1173282244 20:41639245-41639267 CAGCTAGTTCATGCAGAGTTGGG - Intergenic
1173841324 20:46158958-46158980 CAGCTACACCAGACTGAGATGGG + Intergenic
1173958832 20:47055689-47055711 CAGTTACATCATGAAGACGTGGG - Intronic
1178183641 21:30193784-30193806 AAGCTTCATCATGCAGAAAAGGG + Intergenic
1178780916 21:35602983-35603005 CATCTGCATGATGCAGAGACAGG - Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180100980 21:45585610-45585632 TTGCTACATCCTGAAGAGATGGG - Intergenic
1183363239 22:37393838-37393860 CAGCTCCATTAGGCAGAGATCGG - Intronic
1183492582 22:38124528-38124550 CAGCTTCATCAAGCTGAGATGGG - Intronic
1184552496 22:45212039-45212061 CACCTACTTCATGGAGAAATGGG - Exonic
1184872573 22:47250236-47250258 CATCTACAAAATGCGGAGATGGG + Intergenic
952906550 3:38142797-38142819 CAACAAGATCATGCAGAGAGGGG - Exonic
955302789 3:57799031-57799053 CAGCTACATCATGCAGAGATGGG - Intronic
956004327 3:64762414-64762436 CTGCTACATCATGCATTGAAAGG - Intergenic
958541785 3:95486362-95486384 TAGCTACATCATCGATAGATTGG + Intergenic
960016542 3:112896167-112896189 CATATACATCATGGATAGATAGG + Intergenic
964857182 3:161159245-161159267 AAGGTGCACCATGCAGAGATAGG - Intronic
972528029 4:39935267-39935289 CAGCTACTTCCAGTAGAGATGGG + Intronic
974060319 4:57027417-57027439 CAGCTACTTGAGGCTGAGATGGG - Intronic
976108370 4:81643756-81643778 AAGCTTCATCATGCTGAGATGGG - Intronic
976370121 4:84278514-84278536 CACCAACAGCATGCAGAGAATGG + Intergenic
980033100 4:127853033-127853055 CAGCTTCCTCATGCAGAGGAAGG - Intergenic
981193567 4:141891902-141891924 CACCTACATCAGGCAGTGAGAGG - Intergenic
983816844 4:172140217-172140239 CAGCTACATGTTGCAGAAAAAGG + Intronic
984575287 4:181440666-181440688 CAGCTATTTCATGCACAGGTTGG - Intergenic
985424992 4:189821261-189821283 CAGGTACATCATACTGAGACAGG - Intergenic
985424995 4:189821316-189821338 CAGGTACATCATACTGAGACAGG - Intergenic
993153981 5:84198140-84198162 ATGCCACATTATGCAGAGATTGG - Intronic
993347303 5:86800213-86800235 CAGCTACATCCTGCTGAGAGGGG + Intergenic
996743260 5:126821730-126821752 CAGCTCCTTGATGCAGAGCTAGG - Intronic
1002074024 5:176697539-176697561 CAGCTCCATCCTGCAGGGCTGGG + Intergenic
1003494491 6:6652381-6652403 CAGCTAAATCCTCCAGAGATGGG + Intronic
1004373985 6:15076080-15076102 CAGCTACATCCTCCAGTGACAGG + Intergenic
1010409913 6:75549607-75549629 CCCCTACATCATGCACACATAGG + Intergenic
1016058483 6:139603468-139603490 GAGTTACATGATGCAGAGAAAGG + Intergenic
1016199715 6:141393984-141394006 CAGCAAGATCAGGCAGAGAGGGG + Intergenic
1016875097 6:148856579-148856601 TAGCTACCTCTTGAAGAGATGGG + Intronic
1017822720 6:158060828-158060850 CAGCCACCTCATGCGGAGAAGGG + Intronic
1018226867 6:161637122-161637144 CCGCTAAATCATGCTGAAATTGG + Intronic
1020237530 7:6367827-6367849 AAGCTACAACAGGCAGAAATGGG - Intergenic
1020509362 7:9033969-9033991 CAGGAATATCATGCAGAGAATGG - Intergenic
1021205332 7:17773183-17773205 CAGCTAGTTCTTGAAGAGATTGG - Intergenic
1023320073 7:38986537-38986559 CAGCTAGTTCAGGCAGAGAGTGG + Intronic
1026565321 7:71485266-71485288 CAGCTAATTTTTGCAGAGATGGG + Intronic
1029289465 7:99491074-99491096 CACCTACATCAGGGAGAGAGTGG + Intronic
1030326434 7:108223817-108223839 CAGCTAAATCAAGTAGAGAGAGG - Exonic
1030516308 7:110542973-110542995 CAGCTTCATCCTCAAGAGATGGG - Intergenic
1030887111 7:114951866-114951888 CAGCTACATGATTCAGAAAATGG + Intronic
1032943731 7:136826099-136826121 CAGCTTTCTCATGCACAGATTGG - Intergenic
1034022561 7:147661065-147661087 TAGGTACATCATGGAGAAATAGG - Intronic
1037307223 8:17517978-17518000 TAGTTTCATCATGCAAAGATAGG + Intronic
1043984903 8:86682580-86682602 GAAGTACATGATGCAGAGATTGG + Intronic
1046385718 8:113506818-113506840 CAGCTCCTTCAGGAAGAGATTGG + Intergenic
1055864319 9:80794497-80794519 CATCTACATCATCCAGGGCTTGG - Intergenic
1056306913 9:85299527-85299549 CAGCTACATCAAAGACAGATGGG - Intergenic
1060772528 9:126342919-126342941 CAGCTACAACAGACAGAGAGAGG - Intronic
1061223897 9:129269195-129269217 CAGCAACATCATGTAAATATTGG + Intergenic
1061377526 9:130235133-130235155 CACCAACATCCTGCAGGGATGGG + Exonic
1061762008 9:132857675-132857697 CAGGTACAGGATGCAGAGAAGGG + Intronic
1187127043 X:16463523-16463545 CCGCTACATCATTCAGTCATGGG + Intergenic
1189144437 X:38641440-38641462 CAGCTACTTCCTTCAGAGAGGGG - Intronic
1189280364 X:39816720-39816742 CAGCTGCATTAAGAAGAGATTGG + Intergenic
1189507753 X:41629348-41629370 CAGCAACATCATTCTGAAATAGG + Intronic
1199893901 X:152114625-152114647 AAGCTGCTTCATGCAGGGATGGG + Intergenic
1200318867 X:155163679-155163701 CAGCTTCAGCAAGCAGAGCTTGG + Intergenic