ID: 955303179

View in Genome Browser
Species Human (GRCh38)
Location 3:57803698-57803720
Sequence CTGGAGGCACAAATCCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955303176_955303179 8 Left 955303176 3:57803667-57803689 CCACTCTCTTTTTGTCTGTCTGA 0: 1
1: 0
2: 6
3: 128
4: 1091
Right 955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG 0: 1
1: 0
2: 0
3: 13
4: 177
955303174_955303179 17 Left 955303174 3:57803658-57803680 CCTTCCTCTCCACTCTCTTTTTG 0: 1
1: 0
2: 8
3: 115
4: 1084
Right 955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG 0: 1
1: 0
2: 0
3: 13
4: 177
955303175_955303179 13 Left 955303175 3:57803662-57803684 CCTCTCCACTCTCTTTTTGTCTG 0: 1
1: 0
2: 5
3: 86
4: 1175
Right 955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955303179 Original CRISPR CTGGAGGCACAAATCCAACA TGG Intronic
902612747 1:17606913-17606935 CTGGAGGGACAGGTCCCACAAGG - Intronic
906646259 1:47477660-47477682 CTGGAGGCTCAAATCCAAAGAGG - Intergenic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
908834488 1:68215021-68215043 CTTGAGGCATAAATCCACCGTGG + Intronic
909650551 1:77971443-77971465 CTGAAGTCATAAATTCAACATGG + Intronic
910458929 1:87427253-87427275 CTGGAGAAGCAAATGCAACAAGG - Intergenic
910493163 1:87795392-87795414 CTGGAGGCTCAGAACCAGCAAGG - Intergenic
912407157 1:109449700-109449722 CTGGAGGATCAAATCCAGCCTGG + Intergenic
912465666 1:109871726-109871748 CTGTAGTCAAAAGTCCAACAGGG - Intergenic
913119444 1:115726289-115726311 CTGGTGGGACAAATCCAGCCAGG + Intronic
914316211 1:146514152-146514174 CTGGAGAAGCAAATGCAACAAGG - Intergenic
914498144 1:148219209-148219231 CTGGAGAAGCAAATGCAACAAGG + Intergenic
914898922 1:151701551-151701573 CTGGAGTCACAAAGCCAGTAAGG - Intergenic
914945050 1:152057693-152057715 ATGGAGCCACAAATCCAAGCTGG + Intergenic
918403166 1:184184795-184184817 CTGGAGGCACATATACACCATGG - Intergenic
918535072 1:185564935-185564957 CTCTAGGCACAAAGCCAACTGGG - Intergenic
920176268 1:204103891-204103913 CTGGAGGCACACATCACACTGGG + Intronic
920531397 1:206705303-206705325 CCAGAAGCACAAAGCCAACAGGG - Intronic
920994606 1:210977077-210977099 CTGGTGGCACATATACACCATGG + Intronic
921926730 1:220716601-220716623 GTGGTGGCACAAATCCATCGCGG + Intergenic
924495221 1:244582277-244582299 CTGGAGGAAGACAACCAACATGG + Intronic
1063691598 10:8292845-8292867 CTGGAGGAAGAAATGCAGCACGG - Intergenic
1065231442 10:23602666-23602688 CTTTAGGCAGAAATTCAACAGGG + Intergenic
1065848384 10:29765397-29765419 TTGGAGAAAAAAATCCAACAGGG + Intergenic
1068987262 10:63118764-63118786 CTGTAGTCACAAAACCTACAAGG - Intergenic
1073939119 10:108673506-108673528 CTGAAGGCATAAAGCCAGCAAGG - Intergenic
1074846745 10:117405497-117405519 CTGGAATCAAAATTCCAACAGGG + Intergenic
1075073750 10:119336570-119336592 CAGGGGGCACAAAGCTAACAAGG - Intronic
1075244882 10:120812008-120812030 CTGGAGGCAGAAAGGCAAAAAGG - Intergenic
1076994909 11:293140-293162 CTGGACACACAAGTCCAAGATGG - Intronic
1082173261 11:49031757-49031779 CTGAATGCACAAAGTCAACAGGG + Exonic
1085719544 11:78900851-78900873 TTGAAGGCACAAAACTAACAAGG - Intronic
1086435425 11:86775295-86775317 CTGGAGGCAGAAGCCTAACATGG - Intergenic
1086740896 11:90367660-90367682 ATAGAGGCACAAATATAACAGGG + Intergenic
1087351319 11:97036192-97036214 CTGTATGCAGAAATCCAACATGG - Intergenic
1089586544 11:119513183-119513205 CTGGAGGCACAGAGACACCAGGG - Intergenic
1094201718 12:27801662-27801684 CTGGAAGCACCAATCTGACATGG - Exonic
1094311128 12:29084990-29085012 CTGCTGGCACAAATGCAAAATGG + Intergenic
1095668952 12:44835723-44835745 CTGGTTTCACTAATCCAACAGGG + Intronic
1098414881 12:70221806-70221828 CAGGTGCCAGAAATCCAACATGG + Intergenic
1099092506 12:78330851-78330873 TTTGAGGCACAAAACAAACAGGG - Intergenic
1099517521 12:83615959-83615981 CTGAAGGCACAAATGTGACATGG - Intergenic
1102616529 12:114159512-114159534 CTGGAGTCACAAAGCCACGATGG + Intergenic
1102633035 12:114298849-114298871 CTGAAGTCACAAATCCTTCACGG - Intergenic
1104729577 12:131097592-131097614 CTGGAGTCACAGATCCGCCAGGG + Intronic
1104950372 12:132437259-132437281 CTGGGGGCACTAATCCCATAAGG + Intergenic
1107106984 13:36654599-36654621 ATGGAGGCAGCAAACCAACACGG - Intergenic
1107211201 13:37856687-37856709 TTGCAGGGATAAATCCAACATGG - Intronic
1110556088 13:76861013-76861035 CTGGAGGCAAAAATGGAAAATGG + Intergenic
1110597084 13:77330683-77330705 CTGAAGGGAAAAATTCAACATGG + Intergenic
1110603345 13:77401933-77401955 CTCTAGGCACAAAGCCAAAAAGG + Intergenic
1112720285 13:102236511-102236533 CTGGTGGCACAAATAGAACGAGG + Intronic
1113414927 13:110121348-110121370 CTGGAGGGACAAAACTAATATGG - Intergenic
1115627364 14:35207328-35207350 CTGAAGGCAGAAATCAGACAAGG + Intronic
1115879484 14:37899162-37899184 CAGGAAGCACAAATGCCACATGG - Intronic
1117537088 14:56712843-56712865 CTGCAGGCAGAAATCTGACATGG - Intronic
1118686698 14:68298629-68298651 CTGGAGGGACAAAAACACCAAGG + Intronic
1120927472 14:89811770-89811792 CTGGAGGCCAAAATCCAAAATGG - Intronic
1122155067 14:99745938-99745960 CTGGAGAGGCAAATCCCACAAGG - Intronic
1124875825 15:33592471-33592493 CTGGATACAGATATCCAACAAGG - Intronic
1124921994 15:34036468-34036490 CTTGGGGCACAAATGCACCATGG + Intronic
1128480224 15:68031104-68031126 CTGAAGTCATAAATCCAAAACGG - Intergenic
1128606279 15:69038803-69038825 CTGCAGGCCCAAAGCCACCAGGG - Intronic
1131615226 15:94009465-94009487 CTGGATGCACAATTCCCACCTGG + Intergenic
1132005897 15:98226629-98226651 CTGGAAGCACTAGTCCACCACGG + Intergenic
1132736476 16:1388448-1388470 CTGGAGGCCATAAACCAACAGGG + Intronic
1135469588 16:22718007-22718029 CTGGAGGTTAGAATCCAACAGGG + Intergenic
1136929269 16:34404473-34404495 CTGGAGACGCAAAACCTACAGGG + Intergenic
1136975305 16:35007331-35007353 CTGGAGACGCAAAACCTACAGGG - Intergenic
1138278892 16:55757662-55757684 CTGGAGACCCAAATTCAAAAAGG - Intergenic
1138289642 16:55835926-55835948 CTGGAGACCCAAATTCAAAAAGG + Intergenic
1140289633 16:73641013-73641035 CTGGAAGCTCAAAGACAACAGGG + Intergenic
1141976189 16:87518070-87518092 CTGGCGGCACGGATCCAGCACGG - Intergenic
1142613589 17:1122782-1122804 CTAGAGAAACAAAACCAACAGGG - Intronic
1143763369 17:9120973-9120995 CTGGAGACAGAAAACCATCAGGG + Intronic
1145122724 17:20275188-20275210 CTGGGGGCAAAATTCCAACTTGG + Intronic
1150775431 17:68078096-68078118 GTGGAGGCAAAACTCCAAAATGG - Intergenic
1152264743 17:79287733-79287755 CTGGAGGGACAGAGCCCACAGGG + Intronic
1152849142 17:82621570-82621592 CAGGAGGCACAACACCAACAAGG + Intronic
1153555861 18:6312559-6312581 GTGGAGGCTGAAATCCACCATGG + Intronic
1153595384 18:6720133-6720155 GTGGAGGCACAACTGCAAAATGG + Intergenic
1154060501 18:11055692-11055714 CTGGAGACCCAAATCCCTCAGGG - Intronic
1156000976 18:32383535-32383557 TTAGAGGTACAAATCCAATATGG + Intronic
1156223603 18:35079723-35079745 CTGGATACAGAAATCTAACAGGG - Intronic
1156888904 18:42167116-42167138 CTGGAGGAACATATCACACAGGG - Intergenic
1157790772 18:50529057-50529079 CGGAAGGCAGAAATCCAGCAAGG - Intergenic
1158585569 18:58730727-58730749 CTGGTGGCACAAATGTAAAATGG - Intronic
1159070795 18:63621776-63621798 GTGGAGCTACAAATCAAACAGGG - Intergenic
1160218679 18:76956764-76956786 CAGGAGGCAGAATTCCAGCAGGG + Intronic
1164560709 19:29290209-29290231 CTGGAGTCATAAATCCTACCAGG - Intergenic
1164704281 19:30308520-30308542 CTGGAGCAACAAAACCAAGATGG - Intronic
1164881407 19:31735486-31735508 CTGGTGGCTTAAGTCCAACATGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926023273 2:9515853-9515875 CTGGCAACACAATTCCAACAAGG - Intronic
926119626 2:10235015-10235037 CTGGAGGCACAAATCCATGTGGG + Intergenic
930697246 2:54424519-54424541 CTTGAGACACATATCCCACAGGG + Intergenic
938753517 2:134358488-134358510 CTGGACTCACAAATACAAAAAGG + Intronic
939998516 2:148943180-148943202 CAGAAGGCAGAAATCCAACATGG - Intronic
944028504 2:195202262-195202284 CTGAAGGCACAAATTCCACAAGG + Intergenic
944783113 2:203040284-203040306 CTGGAGGCAGAAATGTGACAAGG + Intronic
946733258 2:222729665-222729687 CTGCAGGCACACATCCCACCGGG + Intergenic
946900020 2:224363440-224363462 CTGGAGGCCAGAGTCCAACATGG + Intergenic
947306435 2:228753501-228753523 CTGGTGGCAGAAACACAACAAGG + Intergenic
1170139498 20:13111632-13111654 CAGCAGGCACAAATCACACAGGG - Intronic
1174220613 20:48951821-48951843 CTGGCAGCAGAAATCGAACAGGG - Intronic
1179838436 21:44053744-44053766 CTGGAGGCACATGTGGAACAAGG - Intronic
1180207381 21:46269600-46269622 CTGGAGCCACAGATCAACCAAGG + Intronic
1181595402 22:23911351-23911373 CTGTAGGGAGAAAACCAACAAGG + Intergenic
1182010721 22:26998730-26998752 CTGAAGGCACATTTCCAAGATGG + Intergenic
1182933762 22:34200347-34200369 CTGGAATCATAAATCCAAAAAGG - Intergenic
1183111062 22:35648880-35648902 GTGGAGGGACAAATGCAACTTGG - Intronic
1184121257 22:42451927-42451949 CTGGAGGCACAAAACGGGCAAGG + Intergenic
1203292563 22_KI270736v1_random:9576-9598 CTGGGTCCACAAATCTAACATGG - Intergenic
950655494 3:14433840-14433862 CTGCAGGGAAAAACCCAACATGG + Intronic
951690839 3:25394998-25395020 CTTGAAGCATAAATCCCACAGGG - Intronic
952109872 3:30109775-30109797 TTGGATGCATAAATCCAAAATGG - Intergenic
954008580 3:47614232-47614254 CTGGTAGCAGAAATCCAAAAAGG + Intronic
955303179 3:57803698-57803720 CTGGAGGCACAAATCCAACATGG + Intronic
956282500 3:67572378-67572400 GTGGAGGAACAAATACAAGAAGG + Intronic
956858937 3:73303391-73303413 CAGTAGCCACAAATCCAAGAAGG - Intergenic
960142889 3:114168011-114168033 CTGCAGGCACAGTTCCATCAGGG - Intronic
960449453 3:117788673-117788695 CTGGAGGCTCTCATCCCACATGG - Intergenic
961263189 3:125618997-125619019 GTGGAGGCAAACATCCAGCATGG - Intergenic
962174790 3:133141693-133141715 CTGCTGGCACAAATACCACAAGG + Intronic
963648512 3:147946953-147946975 ATAGAGGCACAAGTCCCACATGG + Intergenic
966447651 3:180021228-180021250 ATGGAGGCACAAGTCCAATTTGG + Intronic
967025571 3:185561164-185561186 CTGGAGGCACCCCTCCAGCAGGG - Intergenic
967129658 3:186458722-186458744 CTGCATGCACCAATCCAAGAGGG + Intergenic
967396592 3:189015875-189015897 CTGTAGGCACAGATCCCTCATGG + Intronic
967949365 3:194829019-194829041 TTTAAGCCACAAATCCAACAAGG - Intergenic
968280313 3:197472120-197472142 CAGGAGGCCCAAATTCAGCAAGG + Intergenic
969390332 4:6888099-6888121 CTGGAGCTGCAGATCCAACAAGG - Intergenic
971432379 4:26581578-26581600 CTGGTGGCACATATACACCATGG - Intronic
973229532 4:47825460-47825482 CTGGAGGGTCTGATCCAACATGG - Intronic
973318816 4:48789130-48789152 AAGGAGGCTCAAATTCAACAAGG + Intergenic
976666542 4:87600274-87600296 CTTAAAGCATAAATCCAACAAGG + Intergenic
979694284 4:123594324-123594346 CTGAAGGCAGGAATCCATCAGGG - Intergenic
980877312 4:138674862-138674884 CTAGAGGTACAAAGCCCACAGGG + Intergenic
981723908 4:147828349-147828371 CTGGTGGCTCAAAACCAACAGGG - Intronic
983661011 4:170130933-170130955 TTGGAAGCACAAATTCAGCAGGG - Intergenic
985648460 5:1096277-1096299 CAGGAGGGACACAGCCAACATGG + Intronic
986462556 5:7987266-7987288 CTGGAGGCAAAAGTCCAAGATGG - Intergenic
986551453 5:8960692-8960714 ATGTAAGCACAAATCAAACAAGG + Intergenic
986699725 5:10394490-10394512 CTTGAGTAACAAATCCAAGACGG + Intronic
987706690 5:21468346-21468368 CTGGAGGAAGAAATGCAGCACGG + Intergenic
989119873 5:37993825-37993847 CTGGAGGAATAAATCCCAAAGGG - Intergenic
991186129 5:63810263-63810285 TTGGAGGCAAAATTGCAACATGG - Intergenic
993815707 5:92542472-92542494 ATGGATGCAGAAAACCAACATGG + Intergenic
999297343 5:150468072-150468094 GTCGAGGCACAAACCCAGCATGG - Intergenic
1003683643 6:8279800-8279822 CTGGAGGAAGAAATGCAAAAGGG + Intergenic
1009555902 6:65166394-65166416 CTGGATTCACAATTCCATCATGG - Intronic
1009786830 6:68351171-68351193 CTGGAGGGAAAAATAAAACATGG + Intergenic
1010677773 6:78764053-78764075 CTGGGGGCACCACACCAACATGG + Intergenic
1012806635 6:103903108-103903130 CTGGAGGCACAAATGAAGAAAGG + Intergenic
1014674764 6:124349814-124349836 TTGGAGCCACAAATACCACAGGG + Intronic
1015113727 6:129622127-129622149 ATGGAGACACACATCCTACAGGG + Intronic
1016141393 6:140616027-140616049 CTGCAAGCATATATCCAACAAGG - Intergenic
1017372424 6:153728141-153728163 CCTGAGGCACACATTCAACATGG + Intergenic
1021950252 7:25767337-25767359 CTGGAGCCACAAAACCAGAAGGG + Intergenic
1026213965 7:68331856-68331878 CTGGTTGAAGAAATCCAACAAGG - Intergenic
1026445413 7:70480511-70480533 CTGGAGGGACCAATCCATAAGGG + Intronic
1027491962 7:78839269-78839291 CTGGAGGTACATTTCTAACATGG + Intronic
1031580097 7:123463181-123463203 CTGCAGGCAGAAATGCAACATGG + Intronic
1032460967 7:132110989-132111011 CTTGAGGCAAATATCCAACAGGG - Intergenic
1034397272 7:150836639-150836661 CTGGAGACTCACATCCAAAATGG + Intronic
1034889383 7:154826578-154826600 CTAGAGCTACAAATCAAACATGG + Intronic
1038435845 8:27535502-27535524 CTGGAGGCAGAGATCCACTAGGG - Intronic
1043174140 8:77002696-77002718 CTGTAGTCAGAAGTCCAACATGG + Intergenic
1045244592 8:100431849-100431871 CTGGATGCTCAAATCCATCTGGG - Intergenic
1047643872 8:126849695-126849717 CTGGAGGCCCTAATCTAACCTGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048850504 8:138640953-138640975 ATGGAGGCAGGAAGCCAACAAGG - Intronic
1050355256 9:4776750-4776772 GTGGAGGAAGACATCCAACAAGG + Intergenic
1051226443 9:14904344-14904366 CAGAAAGCACAAATCCAAGAGGG + Intronic
1057008381 9:91580955-91580977 CTGGGGGCACAAATCCTTCAGGG + Intronic
1057064179 9:92033478-92033500 CTGAGGGCACAAAACCAGCACGG + Intronic
1057250498 9:93497383-93497405 CAGGAGCCAGAAATTCAACAAGG - Intronic
1058398659 9:104587631-104587653 CTGTAGGCACAACGCCTACAGGG + Intergenic
1058436588 9:104968969-104968991 CTTGAGGCACAAGCCCTACAAGG + Intergenic
1059573976 9:115470341-115470363 CTGGATGCTCAAAGCCAGCAGGG - Intergenic
1185745916 X:2573332-2573354 CTTGAGGCAGAGGTCCAACATGG + Intergenic
1187569524 X:20486892-20486914 CTGGAGGCAGAAAACCAAGGTGG + Intergenic
1188630262 X:32348443-32348465 CTGGAGGCTGAAATTCAGCAGGG - Exonic
1188971056 X:36615686-36615708 ATCGAGGCACAAAACTAACAAGG + Intergenic
1188982888 X:36743091-36743113 CTGCAGGGACAAATCCCTCATGG - Intergenic
1190263425 X:48813958-48813980 CTGGAGGCCCAAATGGAGCATGG - Intronic
1192711704 X:73597699-73597721 CTGGGTGCACCAATCCACCATGG - Intronic
1193707748 X:84843695-84843717 CTGGTGGCACATATACACCATGG + Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1198200547 X:134412892-134412914 CTGAATGAACAAATTCAACAAGG - Intronic
1200664355 Y:6001834-6001856 ATAGAGGGACAAATCAAACAAGG + Intergenic