ID: 955310578

View in Genome Browser
Species Human (GRCh38)
Location 3:57882589-57882611
Sequence ATGGCTAATTTCCCTTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955310578_955310582 4 Left 955310578 3:57882589-57882611 CCATTATAAGGGAAATTAGCCAT 0: 1
1: 0
2: 2
3: 24
4: 163
Right 955310582 3:57882616-57882638 AATATGCAAATGAATGGACCTGG 0: 1
1: 2
2: 19
3: 139
4: 715
955310578_955310581 -2 Left 955310578 3:57882589-57882611 CCATTATAAGGGAAATTAGCCAT 0: 1
1: 0
2: 2
3: 24
4: 163
Right 955310581 3:57882610-57882632 ATGGACAATATGCAAATGAATGG 0: 2
1: 7
2: 70
3: 261
4: 884

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955310578 Original CRISPR ATGGCTAATTTCCCTTATAA TGG (reversed) Intronic
907416723 1:54319481-54319503 TTTGGAAATTTCCCTTATAAAGG - Intronic
907962718 1:59297848-59297870 ATGGTGAATTTCCCTCATCATGG + Intronic
908126811 1:61040313-61040335 ATGGCTTATTTTCCTTATTAAGG - Intronic
909007924 1:70299016-70299038 ATGGCTTTTTTCCCTTCTATTGG - Intronic
909544116 1:76824982-76825004 ATAGCAAATTTCCCTGATCAGGG - Intergenic
909945072 1:81654776-81654798 ATGGCTGAATTTCATTATAATGG + Intronic
910133536 1:83938178-83938200 ATGGCACACTTCCCTTAAAAGGG + Intronic
913273028 1:117112513-117112535 AGGTCTAATTTCCATGATAATGG - Intronic
915272010 1:154760202-154760224 ATGGCTGATATCTCTTAGAAAGG - Intronic
915796230 1:158736762-158736784 ATTGCTAATTTGCTTTAGAAAGG + Intergenic
917112950 1:171570320-171570342 ATGGCTTATTTCTCTTATTGGGG + Intronic
917963914 1:180166639-180166661 ATGGTCCCTTTCCCTTATAAAGG - Intronic
921815678 1:219560709-219560731 CTGGCTAATTTCTCTTGTTATGG - Intergenic
922817898 1:228464016-228464038 ACGGCATATTTCCCTTAGAAAGG - Intergenic
1063523657 10:6763400-6763422 ATGATTAACTTCCCTTTTAATGG + Intergenic
1065730137 10:28702929-28702951 ATTGCTAATTTTCCTCATACAGG + Intergenic
1067009437 10:42696097-42696119 ATGGCTTATCTCCTTTATATTGG - Intergenic
1068076394 10:52260901-52260923 ATTTATAATTTCCCTTATTAAGG - Intronic
1068747645 10:60553154-60553176 ATGGCAAACTTCCCTAATACGGG + Intronic
1068826183 10:61442395-61442417 ATGGCTAATTTTTCTTCTATAGG - Intronic
1073497167 10:103903184-103903206 ATGGTTACTTTCTGTTATAATGG + Intronic
1074254340 10:111785194-111785216 ATTGGTAATTTCCCAGATAATGG + Intergenic
1075746143 10:124729118-124729140 ACAGATAATTTCCATTATAAAGG + Intronic
1076468845 10:130704497-130704519 ATGGATCAATTCCCTTATGAGGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1079324261 11:19478070-19478092 ATAGCTTATTACCCGTATAAGGG - Intronic
1079496379 11:21049297-21049319 ATGGCCTAGCTCCCTTATAAAGG - Intronic
1079779552 11:24583588-24583610 GTGTCTACTTTCCCTTATGAGGG - Intronic
1081283770 11:41244078-41244100 ATGGATAATTTCCACTATGAAGG + Intronic
1085832337 11:79914919-79914941 ATGGCTAATTTTTCTTGAAAGGG - Intergenic
1086781889 11:90917157-90917179 ATAGCTATTTTCCCTTTAAATGG - Intergenic
1087976201 11:104550431-104550453 ATTGTTAATTTGCCTTATAGAGG - Intergenic
1089463311 11:118665905-118665927 AAGCCTAATGTCCCTTACAAAGG + Intronic
1090192225 11:124780830-124780852 TTGGCTAATTTACCTCTTAAAGG - Intronic
1092754373 12:11749495-11749517 ACGTCTAATTTCCCAAATAAAGG - Intronic
1097007348 12:55928736-55928758 AGGCCTAATTTGTCTTATAAAGG - Intronic
1098018075 12:66127385-66127407 CTGGCTTATTTCCCTTAGCATGG - Intronic
1099549918 12:84031037-84031059 ATTGGTTATTTCCCTTATATAGG + Intergenic
1099686388 12:85894757-85894779 ATGCCAAATTTCCCTTGGAAAGG + Intergenic
1099854623 12:88148089-88148111 CTGGATAATGTCCCTGATAACGG - Intronic
1100843483 12:98636602-98636624 CTGGCTAATTTCTATTATACGGG + Intronic
1101678636 12:106943016-106943038 AAGGCTGATTACCCTGATAAGGG - Intergenic
1102966621 12:117132661-117132683 ATGGCAGAGTTCACTTATAAAGG - Intergenic
1105373713 13:19823601-19823623 ATGGTTAATTTCCATTTTATTGG - Intronic
1106658962 13:31778618-31778640 ATGGCTAGTTTCCTTAATCAGGG - Intronic
1108038621 13:46318617-46318639 ATCACTAATTTCCCTGATGAGGG + Intergenic
1109464352 13:62709873-62709895 TTGGCTAATTGCCCTTGTTAGGG + Intergenic
1111352412 13:87048591-87048613 ATGGCTAATTTGGCTTATTTTGG - Intergenic
1111502441 13:89139320-89139342 GATGCTAATTTCCCTTATAACGG - Intergenic
1112905019 13:104406903-104406925 ATGGATAATTACTTTTATAATGG + Intergenic
1112976917 13:105331559-105331581 TTGTCTAATCTCCCTTAGAAAGG - Intergenic
1114325111 14:21581215-21581237 ATGGCTGCTTTCCCATACAATGG - Intergenic
1114884394 14:26830264-26830286 ATGACTCATGTCCCTTATACTGG - Intergenic
1115693861 14:35875694-35875716 ATGGTTAATTGCACTTATTAAGG + Intronic
1124799523 15:32817344-32817366 AAGTCTAATTTCCCTAATATTGG + Intronic
1125098073 15:35877525-35877547 ATGTCAAATTTCCGTGATAATGG + Intergenic
1126315058 15:47361300-47361322 ATGGGTAGTATCCCTTATCAAGG - Intronic
1127056998 15:55142316-55142338 ATGGATTATTGCCTTTATAAAGG + Intergenic
1127310692 15:57749552-57749574 ATGACAAATTTCTCTTATACTGG - Intronic
1131815883 15:96220711-96220733 ATGGCTCATCTCCCTTACAGAGG + Intergenic
1135007037 16:18834879-18834901 TTGGCTAACTTACCTTGTAAGGG + Exonic
1137089010 16:36164917-36164939 ATGACTAATTTTCTTTACAATGG - Intergenic
1140761991 16:78117971-78117993 ATATCTAATTTGCCTTACAAAGG + Intronic
1141378136 16:83550519-83550541 ATGGCAAATTCCGCTCATAATGG + Intronic
1146933878 17:36797936-36797958 ATAGCTAAAGTCCCTTCTAATGG + Intergenic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1155511485 18:26581871-26581893 ATGGCTAAGTTTACTTATGATGG - Intronic
1156938848 18:42741062-42741084 ATGGCTGATTTGACTAATAAAGG - Intergenic
1158778904 18:60622641-60622663 ATGGCCAAATTCCATTATACAGG - Intergenic
1165344482 19:35235881-35235903 ATGGCTAATGTCTATTACAAGGG + Intergenic
1166385595 19:42378845-42378867 TTGGATAATTGCCCTTATGATGG + Intergenic
926590897 2:14739272-14739294 ATGGCAGATTTGCCTTAGAAAGG + Intergenic
926631013 2:15136334-15136356 ATGGCAAATTTCCCCTGGAAAGG + Intergenic
926731480 2:16038957-16038979 ATGGCTGATTTCACCCATAAAGG + Intergenic
928928893 2:36603447-36603469 TTGGCTAATTTGACTAATAAAGG - Intronic
931889554 2:66656092-66656114 AAGGCTCATGTCCCATATAATGG + Intergenic
932738242 2:74270900-74270922 ATGGCCTCTTTCCCTTAGAATGG + Intronic
932929416 2:76016059-76016081 ATAGCTAATTTCTCTAATAAGGG - Intergenic
934093914 2:88580677-88580699 ATGTCTGATATCCCTTATAAGGG + Intronic
934499403 2:94843540-94843562 TTGGCTAATTTTCTTTTTAAGGG - Intergenic
936552537 2:113459617-113459639 ATGGCTATTTTCATTTATAAAGG - Intronic
938928599 2:136066499-136066521 ATGGCCACTTTCCCTTACAGGGG + Intergenic
939205208 2:139093335-139093357 ATGGGTAATTTGCATTTTAAGGG - Intergenic
943005252 2:182381436-182381458 GTGGCGAATTGCCCTTTTAAAGG + Intronic
947983935 2:234433250-234433272 AGGGTTAGTTTCCCTAATAAAGG + Intergenic
1168883896 20:1230328-1230350 ATTTCTAATTTCTCTTATAAAGG - Intronic
1171239652 20:23554837-23554859 ATAGCTAATTTGCCTGTTAAGGG + Intergenic
1171890626 20:30710236-30710258 TTGGCTAATTTTCTTTTTAAGGG - Intergenic
1173191715 20:40881999-40882021 ATTGCTTATTTCCATTTTAAAGG - Intergenic
1176675282 21:9771821-9771843 AGGGCTTATTGCCCTTATAAAGG + Intergenic
1177459610 21:21393816-21393838 ATGGCTAATTTGTCTTCTATTGG - Intronic
1177500577 21:21949691-21949713 ATGGCTAATCTCATTCATAAGGG - Intergenic
1183208041 22:36432905-36432927 GTGGCTAATTTTCCTTTTTAGGG - Intergenic
949205163 3:1429367-1429389 ATAACTAATTTCCCTTGAAAGGG + Intergenic
950371723 3:12536651-12536673 ATGGCTGATTTCCTTTATTAGGG + Intronic
950986391 3:17373336-17373358 ATGGCTTATTTCCTTTATATTGG - Intronic
951934645 3:28008478-28008500 AGGGCTAATTTCCTTCATGAGGG - Intergenic
952381005 3:32805294-32805316 ATGGCTTATTTCACTTATTATGG - Intergenic
953869863 3:46617163-46617185 ATGGCTATTTTCCTTTTTAGGGG + Intronic
953871653 3:46632030-46632052 CAGGATATTTTCCCTTATAATGG - Intergenic
954308052 3:49741791-49741813 AGGGCTCATTTACCTTTTAAGGG - Intronic
955100896 3:55848693-55848715 ATGCCTGATTTCCCTGATTATGG + Intronic
955310578 3:57882589-57882611 ATGGCTAATTTCCCTTATAATGG - Intronic
959468771 3:106722576-106722598 ATGGCTACTTTGCCCTACAATGG - Intergenic
959737371 3:109675052-109675074 ATGTCTAATTTGGCTAATAAAGG - Intergenic
961409656 3:126710011-126710033 ATGGCTGCTTTCCCCTACAATGG - Intronic
963893594 3:150662091-150662113 ATTCCTAATTTCCCTTTTAGTGG - Intronic
970467759 4:16344387-16344409 ATGGAGAATTTGCCTTAGAATGG - Intergenic
970506040 4:16731449-16731471 ATGGATCAGTACCCTTATAAGGG + Intronic
972973834 4:44609638-44609660 ATGGCTAATTTGTGTTACAAAGG - Intergenic
976033796 4:80791471-80791493 ATTGCTAATATACCTTATTAAGG - Intronic
979305891 4:119143126-119143148 ATGGCTTAATTACCTTTTAAAGG + Intronic
980243441 4:130205451-130205473 ATTGCTTCTTTCCTTTATAAGGG + Intergenic
983165295 4:164468918-164468940 CTGTATAATTTCCCCTATAATGG + Intergenic
983403316 4:167293407-167293429 AAGGCTAAATTCCTTTATAATGG - Intergenic
984243924 4:177251666-177251688 ATGGCTAATTAGGCTCATAATGG + Intergenic
985400268 4:189586876-189586898 AGGGCTTATTGCCCTTATAAAGG - Intergenic
987662190 5:20891228-20891250 ATGGCTAACTTCCATATTAAAGG - Intergenic
987672469 5:21029187-21029209 GTGGCTAATGTATCTTATAAAGG - Intergenic
988246508 5:28689228-28689250 ATGCCTAATAGCTCTTATAAAGG + Intergenic
994161564 5:96562380-96562402 ATGCTAAATTTCCCTCATAAGGG + Intronic
995821176 5:116234746-116234768 TTGGATAATTTCACTTATAAGGG + Intronic
996174311 5:120335900-120335922 ATTGCTAATTTCAGCTATAATGG + Intergenic
996225793 5:120994582-120994604 GTGGCTTATTTCCCTTTTATCGG - Intergenic
996740823 5:126797088-126797110 CTGGCTAATTTTCTTTTTAATGG + Intronic
998074914 5:139227959-139227981 ACGGGTAATTTTCCTTAAAATGG + Intronic
998429309 5:142056937-142056959 GGGGCTAATTTCCCTTTCAAAGG + Intergenic
999991395 5:157053424-157053446 TTGGATTGTTTCCCTTATAAGGG - Intronic
1000026036 5:157360135-157360157 AGGCTTATTTTCCCTTATAAAGG + Intronic
1000949636 5:167465241-167465263 ATGGCTTTTTTCCCATGTAACGG + Intronic
1000999602 5:167993395-167993417 ATGCTTAATTTCCCTTCTGATGG - Intronic
1002669315 5:180853006-180853028 TTGGCAAATTCCCCTTAAAAGGG - Intronic
1003415271 6:5901998-5902020 ATGCCTAGAGTCCCTTATAAGGG + Intergenic
1003898879 6:10634568-10634590 ATGGACAAATTCCCTTGTAAGGG - Exonic
1010029785 6:71261436-71261458 ATAACTAATTTCCCATGTAATGG + Intergenic
1011688597 6:89844779-89844801 ATGGCTACTTATCCTTAGAAAGG - Intronic
1014159439 6:118151260-118151282 ATGGATAATATCCCTAAGAAAGG - Intronic
1016057785 6:139596791-139596813 ATTTTTAATTTCCATTATAATGG - Intergenic
1016203290 6:141440053-141440075 ATGGCTAATTTACTATATAGTGG - Intergenic
1017266930 6:152457789-152457811 ATGGTTAATTTCACTTAAAAAGG - Intronic
1017612098 6:156198478-156198500 ATGGGTAAGTTCCCTCAGAAGGG - Intergenic
1021111961 7:16705917-16705939 GTGACTATTTTACCTTATAATGG + Intronic
1024420957 7:49166044-49166066 ATGACTTATATGCCTTATAATGG - Intergenic
1024980465 7:55153672-55153694 ATGTTTAATTTCCCTTATAAAGG - Intronic
1025512019 7:61581825-61581847 CTGACTAATTTTCCTTACAATGG + Intergenic
1028414841 7:90568668-90568690 ATAGTTAAATGCCCTTATAATGG + Intronic
1028690489 7:93644266-93644288 TTGGCTGATTTCACTAATAAAGG - Intronic
1030567879 7:111183297-111183319 ATGACTAATATCCCTTATAAAGG - Intronic
1031457797 7:122005509-122005531 ATGGCTAGTCTCTCTTACAAGGG + Intronic
1032134100 7:129258857-129258879 AAGGCTCATTTACATTATAATGG - Intronic
1032755517 7:134887016-134887038 CTGTCTTATTGCCCTTATAATGG - Intronic
1033620512 7:143058214-143058236 ATTCATAAGTTCCCTTATAAGGG - Intergenic
1033890175 7:146002852-146002874 ATAGCTCAGTTCCCTTAAAAAGG + Intergenic
1039230363 8:35439902-35439924 ATGGCGTATTTCACTTTTAAAGG + Intronic
1040773113 8:51003305-51003327 CTTATTAATTTCCCTTATAATGG - Intergenic
1041836187 8:62218780-62218802 ATGGCTCATGTCCTTTCTAATGG - Intergenic
1042989731 8:74625931-74625953 TTGGCTAATTTACCATTTAAAGG - Intronic
1044408572 8:91859582-91859604 ATATCAAAATTCCCTTATAAAGG + Intergenic
1044852188 8:96440019-96440041 ATTCCAAATTTCCCTTATAAAGG + Intergenic
1046021269 8:108668116-108668138 ATGGGTAGTTTGCCTTTTAAAGG - Intronic
1046606557 8:116377890-116377912 ATGGCTGTTTTCACTTACAAAGG - Intergenic
1049900464 9:157564-157586 ATGGCTATTTTCATTTATAAAGG + Intronic
1053657752 9:40237003-40237025 TTGGCTAATTTTCTTTTTAAGGG + Intronic
1053743509 9:41167865-41167887 ATGGCTATTTTCATTTATAAAGG + Intronic
1053908119 9:42866283-42866305 TTGGCTAATTTTCTTTTTAAGGG + Intergenic
1054348782 9:63997666-63997688 ATGGCTATTTTCATTTATAAAGG + Intergenic
1054369877 9:64383275-64383297 TTGGCTAATTTTCTTTTTAAGGG + Intronic
1054446512 9:65324051-65324073 ATGGCTATTTTCATTTATAAAGG + Intergenic
1054483763 9:65697458-65697480 ATGGCTATTTTCATTTATAAAGG - Intronic
1054526844 9:66139222-66139244 TTGGCTAATTTTCTTTTTAAGGG - Intronic
1054677504 9:67873029-67873051 TTGGCTAATTTTCTTTTTAAGGG + Intronic
1054684835 9:68263411-68263433 ATGGCTATTTTCATTTATAAAGG - Intronic
1055882121 9:81013985-81014007 TTGGCTAATTTGACTAATAAAGG - Intergenic
1058676441 9:107404186-107404208 ATATCTAAGTTTCCTTATAAGGG - Intergenic
1059137289 9:111819341-111819363 ATGGGTTATTTCACTGATAATGG - Intergenic
1060906507 9:127311811-127311833 ATGGCTAGTTTCACTCATATAGG - Intronic
1203560253 Un_KI270744v1:48016-48038 TTGGCTAATTTTCTTTTTAAGGG - Intergenic
1188252771 X:27919219-27919241 ATGTGTATTTTCCCTTATACCGG - Intergenic
1188360970 X:29253213-29253235 ATGACTGATTTTCATTATAAGGG - Intronic
1188517443 X:31002855-31002877 ATGGCTTAATCACCTTATAAAGG + Intergenic
1190755319 X:53396368-53396390 ATGGGTCATTTCCCTAAAAAAGG + Exonic
1191885762 X:65886340-65886362 ATATCTAAGTGCCCTTATAAGGG + Intergenic
1192913054 X:75625418-75625440 ATGACTTATTTCCCTGAAAACGG - Intergenic
1192941409 X:75916017-75916039 AAGGGTAATTTCCCATAGAAAGG + Intergenic
1193439578 X:81522675-81522697 ATGGAGAATTTTCCTTTTAATGG + Intergenic
1193843144 X:86434469-86434491 ATGGCTCATTTCTCTTATCATGG + Intronic
1195161092 X:102172599-102172621 TTGGCTAAATTCTCTTAGAAGGG - Intergenic
1195528159 X:105918654-105918676 ATGGCTAATTTTGCTAATACAGG + Intronic
1195831664 X:109066124-109066146 CTGGCTTATTTCACTTATCATGG + Intergenic
1197196328 X:123704967-123704989 AGGGCTATTTTCCATTAGAAGGG + Intronic