ID: 955311236

View in Genome Browser
Species Human (GRCh38)
Location 3:57888922-57888944
Sequence AATCTCGCTCTGTCATACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 13, 3: 67, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955311236 Original CRISPR AATCTCGCTCTGTCATACAG TGG Intronic
901749886 1:11399581-11399603 AGTCTTGCTCTGTCACCCAGTGG + Intergenic
903076208 1:20768798-20768820 AGTCTCGCTCTGTTACACAATGG - Intronic
903100931 1:21029055-21029077 AGTCTCGCTCTGGGGTACAGTGG + Intronic
903149034 1:21392192-21392214 TATATCGTTCTGTCATAAAGAGG + Intergenic
903149039 1:21392291-21392313 TATATCGTTCTGTCATAAAGAGG + Intergenic
903149042 1:21392342-21392364 TATATCGTTCTGTCATAAAGAGG + Intergenic
903198925 1:21716986-21717008 AGTCTCGCTCTGTCGTGCAGTGG - Intronic
904649415 1:31993494-31993516 GGTCTCGCTCTGTCACCCAGTGG + Intergenic
904974199 1:34443217-34443239 ACACTGGCTCAGTCATACAGAGG + Intergenic
905154007 1:35958037-35958059 GATCTTGCTCTGTCACCCAGAGG - Intronic
905158740 1:36012293-36012315 GGTCTCGCTCTGTCATCCAGTGG - Intronic
905805593 1:40874667-40874689 ACTCTTGCTCTGTCACCCAGTGG - Intergenic
905826479 1:41029236-41029258 AGTCTCGCTCTGTCACCCAGGGG + Intronic
906317429 1:44797224-44797246 AGTCTCACTCTGTCATACTCAGG + Intergenic
906434468 1:45783640-45783662 AGTCTCGCTCTGTCACCCAGTGG + Intergenic
906437067 1:45805075-45805097 AGTCTCGCTCTGTCGCCCAGGGG + Intronic
906698646 1:47841810-47841832 AGTCTCGCTCTGTCATGCAATGG + Intronic
908200747 1:61793098-61793120 AGTCTCGCTCTGTCACCCAGAGG + Intronic
909171287 1:72299059-72299081 AGTCTCACTCTGTCGCACAGTGG - Intergenic
910913166 1:92259760-92259782 ACTCTTGCTCTGTCACCCAGTGG + Intronic
912423526 1:109565221-109565243 AGTCTCACTCTGTCACCCAGTGG - Intronic
913151112 1:116045067-116045089 AATCTTGCTCTGTCATGCCCAGG + Intronic
915451508 1:156008652-156008674 AATCTCGCTCTGTCACCTAGTGG - Intergenic
915552632 1:156644206-156644228 ACTCTCCCACTGTCAGACAGAGG + Intronic
916769839 1:167897467-167897489 AATCTTACTCTGTCACCCAGTGG - Intronic
917263470 1:173194853-173194875 AAGTTCTCTCTGTCATGCAGTGG - Intronic
917399299 1:174629560-174629582 AGTCTCGCTCTGTCGCCCAGTGG + Intronic
918252868 1:182719484-182719506 AGTCTCTCTCTGTCACCCAGTGG + Intergenic
919774084 1:201182660-201182682 AGTCTTGCTCTGTCATGCAGTGG + Intergenic
920114644 1:203611566-203611588 AGTCTAGCTCTGTCACCCAGTGG - Intergenic
923969416 1:239183008-239183030 AATCTCCCTCTGTCATCCAGTGG + Intergenic
924222676 1:241894472-241894494 ATTCTTACTCTGTTATACAGAGG + Intronic
924704586 1:246489860-246489882 AGTCTCGCTCTGTCACCCAGTGG + Intronic
1063073009 10:2685888-2685910 AATCTCACTCTGTCATGCCCAGG + Intergenic
1063905389 10:10775584-10775606 AGTCTCTCTCTGTCATGCAGCGG - Intergenic
1064026434 10:11852557-11852579 AGTCTCACTCTGTCCTCCAGTGG + Intronic
1064204144 10:13308898-13308920 AGTCTCGCTCTGTCACCCGGGGG - Intergenic
1065667793 10:28081790-28081812 AGTCTTGCTCTGTCACTCAGTGG + Intronic
1066147580 10:32577320-32577342 AGTCTCGCTCTGTCACCCAGTGG - Intronic
1068226392 10:54112112-54112134 AGTCTCACTCTGTCACTCAGTGG - Intronic
1070529884 10:77327377-77327399 AGTCTCGCTCTGTCACACCCAGG + Intronic
1070984819 10:80679576-80679598 AGTCTCGCTCTGTCACACCCAGG - Intergenic
1072917224 10:99545514-99545536 GATCTCACTCTGTCATCCAGTGG - Intergenic
1072924403 10:99603969-99603991 AGTCTCGCTCTGTCATGCAGTGG + Intergenic
1073203325 10:101753793-101753815 GGTCTCGCTCTGTCATCCAGTGG + Intergenic
1075663648 10:124215641-124215663 AGTCTCTCTCTGTCACCCAGTGG + Intergenic
1075946560 10:126438277-126438299 AATCTGGCACTGTCAGAAAGTGG - Intronic
1078389260 11:10921986-10922008 GGTCTCGCTCTGTCATGTAGTGG - Intergenic
1080527628 11:33142898-33142920 AATCTCTCACGGGCATACAGTGG - Intronic
1082032593 11:47616384-47616406 AGTCTCACTCTGTCACCCAGTGG + Intergenic
1082857298 11:57819867-57819889 AGTCTTGCTCTGTCACTCAGGGG + Intergenic
1083456382 11:62781633-62781655 AGTCTCGCTCTGTCGCCCAGTGG - Intronic
1085281048 11:75331049-75331071 AGTCTCGCTCTGTCGCCCAGTGG + Intronic
1085390033 11:76177573-76177595 AATCTGCCTCTGACACACAGCGG + Intergenic
1085623612 11:78055640-78055662 AGTCTCGCTCTGTCATGCCCAGG + Intronic
1085990446 11:81836527-81836549 AATCTCATTCTTTCATACATCGG + Intergenic
1087069784 11:94066526-94066548 AGTCTCGCTCTGTCACACCCAGG - Intronic
1087273335 11:96135235-96135257 CATCTTGCTGTGTCATACCGTGG - Intronic
1088397418 11:109383658-109383680 AATCTCATTCTGTCAGTCAGAGG - Intergenic
1091074757 11:132604998-132605020 AATCTGGCCCTGACATGCAGAGG + Intronic
1091470502 12:721994-722016 AATCTCGCTCTGTCACAGGCTGG - Intergenic
1091510841 12:1123954-1123976 AATCTTGCGCTGTCACCCAGGGG - Intronic
1093943307 12:25079702-25079724 AAACTCGCTCTGTAAGAAAGAGG + Exonic
1093972642 12:25389191-25389213 AGTCTCACTCTGTCACCCAGTGG - Intergenic
1094088414 12:26620080-26620102 AAACCAGCTCTGTGATACAGAGG - Intronic
1094548256 12:31425287-31425309 AGTCTCGCTCTATCACGCAGCGG - Intronic
1097120918 12:56731295-56731317 AGTCTCGCTCTGTCGCCCAGTGG + Intronic
1098439945 12:70506513-70506535 AGTCTCACTCTGTCACCCAGGGG - Intergenic
1100307795 12:93367168-93367190 AATCTTGCTCTGTCACCCAGTGG + Intergenic
1100622452 12:96291656-96291678 AGTCTCGCTCTGTCATGCAGTGG + Intronic
1103404935 12:120668434-120668456 AGTCTCGCTCCGTCACCCAGTGG - Intergenic
1103792546 12:123481896-123481918 AGTCTCGCTCTGTCGCTCAGAGG + Intronic
1104009345 12:124918374-124918396 TATCTCGCTCTGTCATGCAGTGG + Intergenic
1104722554 12:131053033-131053055 GAGCTCCCTCTGCCATACAGTGG + Intronic
1104995919 12:132656386-132656408 AGTCTCGCTCTGTCGCCCAGGGG + Intronic
1105040411 12:132956556-132956578 GGTCTCGCTCTGTCACCCAGTGG + Intergenic
1105525274 13:21171535-21171557 AGTCTCGCTCAGTCGTGCAGTGG - Intronic
1108527007 13:51293948-51293970 AGTCTCACTCTGTCGTGCAGTGG + Intergenic
1108636253 13:52337851-52337873 AGTCTCGCTCTGGAATGCAGTGG + Intergenic
1108955724 13:56155029-56155051 AGTCTCCCTCTGTCATACCCAGG - Intergenic
1109694076 13:65930282-65930304 AGTCTTGCTCTGTCATGCAGTGG + Intergenic
1111402430 13:87757562-87757584 AGTCTCGCTCTGTCGCCCAGTGG - Intergenic
1112423196 13:99272490-99272512 AAACTCGTGCTGTCATAGAGTGG + Intronic
1112501288 13:99945263-99945285 AGTCTCGCTCTGTCACCCAGAGG - Intergenic
1113855004 13:113438652-113438674 AGTCTCGCTCTGTCACCCAGTGG - Intronic
1114341703 14:21752434-21752456 AGTCTCGCTCTGTCGCTCAGTGG + Intergenic
1114404549 14:22444141-22444163 AGTCTCACTCTGTCACCCAGGGG + Intergenic
1114464064 14:22908430-22908452 AATCTCGCTCTGTCGTGCAGTGG + Intronic
1114661788 14:24350877-24350899 AGTCTTGCTCTGTCACCCAGTGG - Intergenic
1114703638 14:24704519-24704541 AATCATGGTCTGTCATCCAGTGG + Intergenic
1114970600 14:28023175-28023197 ATTCTTGCTCTGTATTACAGAGG + Intergenic
1115764208 14:36606100-36606122 GTTCTTACTCTGTCATACAGCGG - Intergenic
1116935128 14:50731795-50731817 AGTCTCGCTCTGTCACCAAGTGG - Intronic
1119339013 14:73859886-73859908 AGTCTCGCTCTGTCATGCAGTGG + Intronic
1119514387 14:75236513-75236535 CGTCTCGCTCTGTCACCCAGTGG + Intergenic
1120009371 14:79395779-79395801 AGTCTAGCTCTGTCACCCAGCGG - Intronic
1121017954 14:90559862-90559884 ATTCTAGCTCTGCCATACACTGG - Intronic
1123698663 15:22898285-22898307 AGTCTCACTCTGTCACCCAGGGG + Intronic
1124981764 15:34574331-34574353 GTTCTCGCTCTGTCACCCAGGGG + Intronic
1125086225 15:35733186-35733208 AATTTCCCTTTGTCATGCAGGGG - Intergenic
1126614649 15:50565019-50565041 AGTCTCACTCTGTCTCACAGTGG + Intronic
1126696157 15:51327519-51327541 AATCTTGCTCTGTCATATAGTGG + Intronic
1127802835 15:62492514-62492536 AGTCTCGCTCTGTCGCCCAGGGG - Intronic
1127872433 15:63084372-63084394 GATCTTGCTCTGTCACCCAGGGG + Intergenic
1128259936 15:66226272-66226294 AGTCTCACTCTGTCACCCAGGGG + Intronic
1129045013 15:72726137-72726159 AGTCTCGCTCTGTCGCCCAGGGG + Intronic
1130507905 15:84563661-84563683 AGTCTTGCTCTGTCACCCAGAGG + Intergenic
1130672194 15:85922505-85922527 ACTCTCGCTCTCTCATCCACAGG - Intergenic
1132795053 16:1716335-1716357 AGTCTCCCTCTGTCATGCAGTGG + Intronic
1133560480 16:6945861-6945883 AGTCTTGCTCTGTCACCCAGTGG - Intronic
1133737386 16:8626474-8626496 AAGCTCGCTCTGTCACCCAGGGG + Intronic
1134206994 16:12246598-12246620 AGTCTCGCTCTGTCACCCAGTGG - Intronic
1134611391 16:15611417-15611439 AGTCTCGCTCTGTCGCCCAGTGG - Intronic
1135257063 16:20949236-20949258 AGTCTCCCTCTGTCACCCAGAGG - Intronic
1136613093 16:31379154-31379176 AGTCTTGCTCTGTCATTCAGTGG + Intronic
1138264377 16:55650101-55650123 AACCTCCCTCTGTCTTAGAGAGG + Intergenic
1138849825 16:60614507-60614529 AGTCTCACTCTGTCATGCAGTGG + Intergenic
1139300884 16:65944234-65944256 AGTCTCCCTCTGTCACCCAGTGG - Intergenic
1139565861 16:67775762-67775784 AGTCTCACTCTGTCACCCAGTGG - Intronic
1139712384 16:68786083-68786105 AATCTGACTCTGGCATACACTGG - Intronic
1139833217 16:69817696-69817718 AGTCTCGCTCCGTCACACAGGGG + Intronic
1139854603 16:69970411-69970433 AGTCTTGCTCTGTCACCCAGCGG - Intergenic
1139883586 16:70193327-70193349 AGTCTTGCTCTGTCACCCAGCGG - Intergenic
1140368925 16:74402192-74402214 AGTCTTGCTCTGTCACCCAGCGG + Intergenic
1140553367 16:75892425-75892447 GATCTCACTCTGTCACCCAGAGG + Intergenic
1140598374 16:76443063-76443085 AATGTGGCTCTGTCATACACTGG - Intronic
1141595872 16:85096608-85096630 AGTCTCACTCTGTCACCCAGTGG - Intergenic
1143611716 17:8021722-8021744 AGTCTCGCTCTGGAATGCAGTGG - Intergenic
1143713346 17:8749287-8749309 AGTCTCGCTCTGTCACACCCAGG + Intergenic
1144856856 17:18273974-18273996 AGTCTCGCTCTGTCGTCCAGTGG + Exonic
1144999995 17:19297914-19297936 AGTCTCACTCTGTCACCCAGTGG + Intronic
1146192186 17:30779255-30779277 AGTCTCGCTCTGTCACCCAGAGG + Intronic
1146337352 17:31985993-31986015 AGTCTCGCTCTGTCACCCAGAGG + Intronic
1147608620 17:41788140-41788162 AGTCTCGCTCTGTCATGCCCAGG - Intergenic
1148274384 17:46290484-46290506 AGTCTCGCTCTGTCGTGCAGTGG + Intronic
1148358131 17:46989895-46989917 GGTCTCGCTCTGTCATTCATGGG - Intronic
1149896301 17:60431108-60431130 AATCTCAGTCTGTAATACATGGG - Intronic
1150408670 17:64924087-64924109 AGTCTCGCTCTGTCGTGCAGTGG - Intergenic
1150562356 17:66303972-66303994 AATCTCGCTCTGTCTCACCCAGG - Intronic
1150735121 17:67730284-67730306 AGTCTCGCTCTGTCGCCCAGAGG + Intronic
1152708482 17:81858230-81858252 AGTCTCGCTCTGTCGTGCAGTGG - Intronic
1152971383 18:164972-164994 AGTCTCCCTCTGTCACTCAGGGG + Intronic
1153315211 18:3714671-3714693 AGTCTCGCTCTGTCATGCAATGG + Intronic
1154284672 18:13041603-13041625 AGTCTCTCTCTGTCACACAGTGG + Intronic
1155471833 18:26199771-26199793 AGTCCCGCTTTGTCATCCAGAGG - Intergenic
1155632549 18:27910240-27910262 TATCTTACTCTGTCATGCAGTGG - Intergenic
1156177083 18:34558685-34558707 AAGGTCTCTTTGTCATACAGTGG + Intronic
1156241222 18:35256519-35256541 AGTCTTGTTCTGTCATGCAGTGG - Intronic
1157365726 18:47062342-47062364 GATCTCACTCTGTTATGCAGTGG - Intronic
1157820417 18:50763694-50763716 AATCTCGCTCTGTCACCCAGTGG - Intergenic
1158003389 18:52644713-52644735 GATCTCACTCTGTCACACAGTGG - Intronic
1159034219 18:63261817-63261839 AATCTCGCTCTGGAGTGCAGTGG + Intronic
1160649221 19:212786-212808 AGTCTCGCTCTGTCACCCAGGGG - Intergenic
1161144968 19:2672075-2672097 AGTCTCGCTCTCTCACCCAGTGG + Intronic
1161885988 19:6996072-6996094 AGTCTCTCTCTGTCACCCAGTGG + Intergenic
1161924609 19:7291830-7291852 AGTCTCGCTCTGTCGCCCAGTGG + Intronic
1162353300 19:10164886-10164908 AGTCTCTCTCTGTCATGCAATGG - Intronic
1162355155 19:10178712-10178734 AATCTCGCTCTGTTGCCCAGTGG - Intronic
1162831536 19:13287539-13287561 TTTCTTGCTCTGTCGTACAGTGG + Intronic
1163087345 19:14991863-14991885 AGTCTTGCTCTGTCACGCAGTGG + Intronic
1163344628 19:16732625-16732647 AGTCTTGCTCTGTCATCCACTGG - Intronic
1164213596 19:23123152-23123174 AATCTGACTTTGTTATACAGTGG - Intronic
1164229748 19:23276641-23276663 AGTTTCGCTCTGTCACCCAGTGG - Intergenic
1164311190 19:24048032-24048054 AGTCTCGCTCTGTCACCCAGAGG + Intronic
1165019323 19:32910236-32910258 AGTCTCGCTCTGTCACCCAGGGG - Intronic
1165923288 19:39311907-39311929 AGTCTCGCTCTGTCACCCAATGG + Intronic
1166548128 19:43646818-43646840 AGTCTCACTGTGTCATGCAGTGG + Intronic
1167024794 19:46907516-46907538 AGTCTCGCTCTGTCCAGCAGTGG + Intergenic
1167092914 19:47356911-47356933 GGTCTCGCTCTGTCACCCAGTGG - Intronic
1167111748 19:47466458-47466480 AACCTCTTTCTGTCATACAAAGG + Intronic
1168135812 19:54350777-54350799 AGTCTCGCTCTGTCACACCCAGG + Intergenic
1168213804 19:54910542-54910564 AGTCTCGCTGTGTCGTGCAGTGG - Intronic
1168663993 19:58188576-58188598 AGTCTCACTCTGTCACGCAGTGG - Intronic
925775425 2:7330537-7330559 GGTCTCACTCTGTCATACAGTGG - Intergenic
926660402 2:15459520-15459542 AGTCTCGTTCTGTCACCCAGGGG + Intronic
929138793 2:38649608-38649630 AATCTCGCTCTGTCACGCAGTGG + Intergenic
929504230 2:42515864-42515886 AGTCTCGCTCTGTCATTCCCAGG + Intronic
930847983 2:55925773-55925795 AGTCTCACTCTGTCACTCAGAGG - Intergenic
931337192 2:61358164-61358186 AATCTCGCTCTGTCTTGCCCAGG - Intronic
931346781 2:61454162-61454184 AGTCTCCCTCTGTCACCCAGGGG + Intronic
935550307 2:104445868-104445890 AATCTGGCTCTGTCCTAACGTGG - Intergenic
935857369 2:107289572-107289594 AATCTCTCTCTTGGATACAGGGG - Intergenic
936133964 2:109873319-109873341 AATCTTGCTCTGTCACATAGTGG + Intergenic
936210733 2:110498166-110498188 AATCTTGCTCTGTCACATAGTGG - Intergenic
936435262 2:112499272-112499294 AGTCTTGCTCTGTCACACAGTGG - Intronic
937116797 2:119412105-119412127 AGTCTCGCTCTGTCGCCCAGTGG + Intergenic
937117217 2:119416352-119416374 AGTCTCGCTTTGTCATCCAGTGG - Intergenic
939022559 2:136976659-136976681 AGTCTCGCTCTGTCGCTCAGTGG + Intronic
940388335 2:153100987-153101009 AGTCTCACACTGTCACACAGTGG - Intergenic
940989354 2:160082348-160082370 AGTCTCACTCTGTCGTGCAGTGG - Intergenic
941433335 2:165437474-165437496 AGTCTCCCTCTGTCACCCAGAGG + Intergenic
942244541 2:173995014-173995036 AATCTGGTTCTGACATGCAGTGG + Intergenic
943123012 2:183760924-183760946 AAGCTTGCTCTTTCATAAAGAGG + Intergenic
944577487 2:201103555-201103577 AATCTCGCTCTGTCGCACTCAGG + Intergenic
944905292 2:204256097-204256119 GATCTCTCTCTGTCACACACAGG + Intergenic
946222215 2:218237604-218237626 AGTCTCGCTCTGTTGTGCAGTGG + Intronic
946938142 2:224743219-224743241 AATCCTGCTCAGTCATACTGAGG - Intergenic
947357333 2:229310762-229310784 AGTCTCTCTCTGTCATGCAGTGG + Intergenic
948667019 2:239542461-239542483 AATCTGGCTCTTCCACACAGCGG + Intergenic
1169794818 20:9450686-9450708 AGTCTTGCTCTGTCATGCAGTGG + Intronic
1171523254 20:25791679-25791701 AATCTCACTCTGTCACTCAGTGG - Intronic
1171553572 20:26064204-26064226 AATCTCACTCTGTCACTCAGTGG + Intergenic
1172545743 20:35759967-35759989 AGTCTGGCTCTGTCACCCAGTGG + Intergenic
1173757539 20:45531244-45531266 AATCTCGCTCTGGAGTGCAGTGG + Intergenic
1175039091 20:56028786-56028808 AGTCTCGCTCTGTCATACCCAGG + Intergenic
1175059855 20:56232050-56232072 AATGTCCCTAGGTCATACAGTGG - Intergenic
1176961705 21:15166150-15166172 ATTCTCCCTCTGGCATTCAGAGG + Intergenic
1177973549 21:27820093-27820115 AGTCTTGCTCTGTCACCCAGTGG + Intergenic
1178779739 21:35590437-35590459 AGTCTCACTTTGTCAAACAGTGG - Intronic
1179774782 21:43654593-43654615 AACCTCACTCTGTCAGACTGTGG + Intronic
1182627225 22:31656316-31656338 AGTCTCGCTCTGTCATGCCCAGG - Intronic
1184948219 22:47819432-47819454 AATCTCGCTCTGTCTCACCTAGG + Intergenic
950356964 3:12419500-12419522 AGTCTCGTTCTGTCTTGCAGTGG + Intronic
952309076 3:32170816-32170838 AGTCTTGCTCTGTCACCCAGTGG + Intergenic
952597415 3:35034930-35034952 AATCTCACTCTGTCGCCCAGGGG - Intergenic
953450935 3:43005426-43005448 CATCTCGCTCTGTCCTACCTGGG + Intronic
953918152 3:46933947-46933969 AGTCTCGCTCTGTCGTCCACTGG + Intronic
954281152 3:49579002-49579024 AATCTTACTCTGTCACCCAGAGG + Intronic
955311236 3:57888922-57888944 AATCTCGCTCTGTCATACAGTGG + Intronic
955810084 3:62778928-62778950 AGTCTTGCTCTGTCACCCAGTGG + Intronic
956830096 3:73038401-73038423 AGTCTCACTCTGTCACCCAGTGG + Intronic
957301258 3:78394410-78394432 AATCTTGCTCTGTCATGCCCAGG + Intergenic
960306241 3:116064473-116064495 AGTCTCGCTCTGGAATGCAGTGG - Intronic
961020539 3:123502801-123502823 AAGCTCTTTCTGCCATACAGGGG - Intronic
962534848 3:136318348-136318370 AGTGTCACTCTGTCATGCAGTGG - Intronic
964000581 3:151767103-151767125 AGTCTCGCTCTGTCCTAGGGTGG + Intergenic
964773427 3:160249495-160249517 AGTCTCGCTCTGTCATGCCCAGG + Intronic
965237118 3:166138439-166138461 AGTCTCGCTCTGTCATGCCCAGG + Intergenic
967217167 3:187220521-187220543 AGTCTCGCTCTGTCACACCCAGG + Intronic
968450265 4:672629-672651 AGTCTCGCTCTGTCACCCAATGG + Intronic
968753823 4:2404280-2404302 AGTCTCGCTCCGTCCTGCAGTGG - Intronic
969105213 4:4802266-4802288 AGTCTCACTCTGTCACCCAGTGG - Intergenic
970902400 4:21174872-21174894 TGTCTCGCTCTGTCACCCAGGGG - Intronic
971013160 4:22461338-22461360 AGTCTCGCTCTGTCTTGCAGTGG + Intronic
972298224 4:37760744-37760766 ATTCTGGCTCTGTCACTCAGAGG - Intergenic
972544675 4:40069088-40069110 AGTCTCGCTCTGTCACTCAGTGG - Intronic
973272767 4:48278591-48278613 AGTCTCGCTCTGTCACCCAGAGG + Intergenic
973561388 4:52139768-52139790 AGTCTTGCTCTGTCACCCAGTGG - Intergenic
974462500 4:62205861-62205883 AGTCTCGCTCTGTCACCCAGTGG - Intergenic
977272785 4:94938465-94938487 AGTCTCGCTCTGTGACCCAGTGG - Intronic
978260914 4:106757423-106757445 AATCTCACTCTGTCGCCCAGTGG - Intergenic
979088889 4:116452914-116452936 AATCTCTCTCTATCATACTAAGG - Intergenic
981036925 4:140180409-140180431 AATCTCACTCTGTCACCCAGTGG - Intergenic
982743753 4:159084955-159084977 AGTCTCGCTCTGTCGTGCAGTGG + Intergenic
983917148 4:173304369-173304391 GGTCTCGTTCTGTCATCCAGCGG - Intronic
986099545 5:4594667-4594689 AATCTCAATCTGCCATGCAGAGG + Intergenic
988179922 5:27776997-27777019 AATCTCGCTGTGTCGTGCAGTGG - Intergenic
988281836 5:29159179-29159201 AGTCTCCCTCTGTCACCCAGTGG + Intergenic
988306724 5:29502262-29502284 AGTCTCACTCTGTCATCCAGGGG - Intergenic
988568587 5:32341816-32341838 TATATCGTTCTGTCATAAAGAGG - Intergenic
989475979 5:41872979-41873001 AGTCTTGCTCTGGCATGCAGAGG - Intergenic
989721844 5:44538263-44538285 AGTCTCACTCTGTCGTGCAGTGG - Intergenic
991905124 5:71502212-71502234 AATCTCGCTCTGTCACGTAGTGG + Intronic
992542316 5:77777261-77777283 ATTCTCACTCTGTCGTGCAGTGG + Intronic
992567707 5:78016030-78016052 AACTTCGATCTGTCATACTGAGG - Intronic
992725798 5:79606077-79606099 AGTCTCACTCTGTCGCACAGTGG - Intergenic
992840487 5:80686328-80686350 AGTCTTGCTCTGTCACCCAGGGG + Intronic
994413283 5:99437109-99437131 AGTCTCGCTCTGTAGTGCAGTGG + Intergenic
995068021 5:107884225-107884247 AATGTTGTTCTGTCCTACAGTGG - Intronic
996777941 5:127153184-127153206 GAACTTGCTCTGTCATGCAGTGG + Intergenic
999176763 5:149637303-149637325 AGTCTCGCTCTGTCTTACCCAGG + Intergenic
999992898 5:157065277-157065299 AGTCTCGCTCTGTCGCGCAGTGG - Intergenic
1003269916 6:4599525-4599547 AGTCCCGCTCTGTCACCCAGGGG + Intergenic
1005454393 6:26005244-26005266 AATATAGCTCTGTCAGGCAGTGG - Intergenic
1005718795 6:28580412-28580434 AGTCTCGCTCTGTCGTGCAGTGG - Intronic
1006555910 6:34866371-34866393 AGTCTCGCTCTGTCGCCCAGGGG - Intronic
1006936063 6:37719028-37719050 GATCTCTCTCTGTCACCCAGAGG - Intergenic
1007487630 6:42192850-42192872 AGTCTCGCTCTGTCACCCAGTGG - Intronic
1007831662 6:44643553-44643575 ATTCTTGCTGTGTCATCCAGGGG + Intergenic
1008291364 6:49720369-49720391 AGTCTCTCTCTGTCACCCAGAGG + Intergenic
1008462692 6:51794074-51794096 AGTCTCACTCTGTCGTGCAGTGG + Intronic
1010136883 6:72565513-72565535 AGTCTCGCTCTGTCGCCCAGCGG + Intergenic
1012547733 6:100438766-100438788 AATATCACTCAGTCATAAAGAGG + Intronic
1013328771 6:109076008-109076030 AGTCTCTCTCTGTCATCCAAGGG + Intronic
1013785243 6:113772295-113772317 AGTCTCCCTCTGTCACCCAGTGG + Intergenic
1016949864 6:149568855-149568877 TATCTCGCTCTGTCTCACACAGG + Intronic
1017865083 6:158435952-158435974 AGTCTCGCTCTGTCGCCCAGTGG + Intronic
1020954259 7:14720328-14720350 AGTCTCGCTCTGTAACCCAGGGG + Intronic
1022963716 7:35454294-35454316 AATCTCTCTCTCTCATCCCGGGG - Intergenic
1023820052 7:43975562-43975584 AGTCTTGCTCTGTCGTACAGTGG + Intergenic
1024106485 7:46093102-46093124 ATTCTTTCTCTGTCATCCAGGGG + Intergenic
1025757677 7:64360246-64360268 AGTCTTGCTCTGTCACCCAGGGG - Intergenic
1025767759 7:64472586-64472608 AGTCTTGCTCTGTCACCCAGTGG - Intergenic
1025832839 7:65069144-65069166 AGTCTTGCTCTGTTGTACAGTGG + Intergenic
1025902610 7:65758665-65758687 AGTCTTGCTCTGTTGTACAGTGG + Intergenic
1025923602 7:65938166-65938188 AGTCTCGCTCGGTCGCACAGCGG - Intronic
1026551454 7:71372489-71372511 AATCTTGCTCTGTTACCCAGTGG + Intronic
1026863267 7:73807618-73807640 AGTCTCGCTCTGTCTTACCCAGG - Intronic
1026867811 7:73834183-73834205 AGTCTCGCTCTGTCACCCAGTGG + Intergenic
1027382075 7:77621641-77621663 AGTCTCGCTCTGTCACACCCAGG - Intronic
1027838081 7:83271936-83271958 GATCTCGCTCTGTCACTCGGTGG - Intergenic
1029271990 7:99382507-99382529 GGTCTGGCTCTGTCACACAGTGG + Intronic
1029713361 7:102312046-102312068 AGTCTCACTCTGTCACCCAGTGG - Intronic
1029748331 7:102529015-102529037 AGTCTTGCTCTGTCGTACAGTGG + Intergenic
1029766278 7:102628102-102628124 AGTCTTGCTCTGTCGTACAGTGG + Intronic
1031636294 7:124104956-124104978 AGTCTCGCTCTGTCACCCAGTGG - Intergenic
1031894149 7:127328888-127328910 AGTCTTGCTCTGTCACCCAGGGG + Intergenic
1031959063 7:127972617-127972639 AGTCTTGCTCTGTCACCCAGGGG + Intronic
1032871611 7:135991869-135991891 AGTCTCGCTCTGTCATGCCCAGG - Intergenic
1033089364 7:138371033-138371055 AATCTCACTCTGTCATCCAGAGG + Intergenic
1034925843 7:155120958-155120980 AATCTTGCTCTGTTGTGCAGTGG + Intergenic
1035385160 7:158466999-158467021 AGTCTCGCTCTGTCCTACAGTGG - Intronic
1035774059 8:2173782-2173804 CCTCTCACACTGTCATACAGGGG - Intergenic
1036523326 8:9512588-9512610 AATCTAGCTCTGTCATGCCCAGG + Intergenic
1037018728 8:13941837-13941859 AGTCTCCCTCTGTCACCCAGTGG + Intergenic
1037672762 8:21029323-21029345 AGTCTCGCTCTGGCACCCAGGGG + Intergenic
1039764225 8:40611378-40611400 AGTCTCGCTCTGTCACCCAGTGG + Intronic
1040992010 8:53362368-53362390 AACCTCGCACTGTGACACAGGGG + Intergenic
1042540183 8:69900433-69900455 AATCTCACTCTGTCATAGGCTGG + Intergenic
1044601983 8:94014571-94014593 AGTCTTGCTCTGTCACCCAGAGG + Intergenic
1047737673 8:127780873-127780895 AGTCTCCCTCTGTCACCCAGGGG + Intergenic
1047786451 8:128158197-128158219 AGTCTAGCTCTGTCACCCAGTGG - Intergenic
1048130642 8:131693498-131693520 AATCTTACTCTGTCATGCAGTGG + Intergenic
1048233590 8:132668476-132668498 AGTCTCGCTCTGTCGCCCAGTGG + Intronic
1049145276 8:140996043-140996065 AGTCTCACTCTGTCACCCAGTGG - Intronic
1050443336 9:5689074-5689096 AGTCTCGCTCTGTCGCCCAGCGG + Intronic
1050474623 9:6027710-6027732 TGTCTCGCTCTGTCATGCAGTGG - Intergenic
1050860847 9:10428277-10428299 AGTCTTGCTCTGTCGTGCAGTGG - Intronic
1052349243 9:27441575-27441597 AATCTTGCTCTGTCCTACCTGGG - Intronic
1052615650 9:30837246-30837268 AATCCCACTTTGTCATAAAGTGG + Intergenic
1052815353 9:33098789-33098811 AGTCTTGCTCTGTCGTCCAGCGG - Intergenic
1053157082 9:35789055-35789077 AGTCTTGCTCTGTCGCACAGTGG + Intergenic
1054110364 9:61101467-61101489 AATCTCGCTCTGTCACCCAGGGG + Intergenic
1054610493 9:67229658-67229680 AATCTCGCTCTGTCACCCAGGGG - Intergenic
1054853826 9:69876505-69876527 AATCTCACTCTGTCATCCCCAGG - Intronic
1056528519 9:87466705-87466727 AGTCTGGCTCTGTCATGCAGTGG + Intergenic
1056638256 9:88348822-88348844 AGTCTCACTCTGTCATGCAATGG - Intergenic
1057404456 9:94756218-94756240 AGTCTTGCTCTGTCACCCAGTGG - Intronic
1057522097 9:95768292-95768314 AGTCTCACTCTGTCACCCAGAGG - Intergenic
1057856172 9:98602430-98602452 AGTCTAGCTCTGTCACCCAGTGG - Intronic
1057900808 9:98946533-98946555 AATTGGGCTCTGTCTTACAGAGG + Intronic
1061124951 9:128668786-128668808 AGTCTCGCTCTGTTTTCCAGGGG - Intergenic
1061682298 9:132249043-132249065 AGTCTCCCTCTGTCACCCAGAGG - Intergenic
1061696185 9:132375720-132375742 AATCTCTCTCTCTCATGCGGTGG + Exonic
1062511013 9:136906070-136906092 AATCTTGCTCTGTCGTGCAGTGG - Intronic
1189473141 X:41329786-41329808 AGTCTCGCTCTATCACCCAGGGG - Intergenic
1190233767 X:48601053-48601075 AGTCTCGCTCTGTCGCCCAGTGG - Intronic
1190768977 X:53499502-53499524 AGTCTCGCTCTATCACCCAGTGG + Intergenic
1192245227 X:69366518-69366540 AGTCTCACTCTGTCACCCAGTGG + Intergenic
1193833522 X:86315890-86315912 AACCGCTCTCTGTCATAGAGAGG + Intronic
1196385200 X:115141196-115141218 AGTCTTGCTCTGTCACCCAGTGG - Intronic
1196705118 X:118710843-118710865 AGTCTCACTCTGTCACCCAGTGG + Intergenic
1197627188 X:128815351-128815373 AGTCTCACTCTGTCGTACACAGG + Intergenic