ID: 955312501

View in Genome Browser
Species Human (GRCh38)
Location 3:57903332-57903354
Sequence CATTCTAAAGAGAAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 310}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955312500_955312501 -8 Left 955312500 3:57903317-57903339 CCTGCAATGACTAGACATTCTAA 0: 1
1: 0
2: 0
3: 5
4: 112
Right 955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG 0: 1
1: 0
2: 2
3: 35
4: 310
955312499_955312501 -3 Left 955312499 3:57903312-57903334 CCAAGCCTGCAATGACTAGACAT 0: 1
1: 0
2: 1
3: 4
4: 96
Right 955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG 0: 1
1: 0
2: 2
3: 35
4: 310
955312498_955312501 25 Left 955312498 3:57903284-57903306 CCTGCATTGTGAAGGTTGTTCTC 0: 1
1: 0
2: 0
3: 11
4: 165
Right 955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG 0: 1
1: 0
2: 2
3: 35
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955312501 Original CRISPR CATTCTAAAGAGAAGAGTGA TGG Intronic
902122624 1:14180346-14180368 CATTTTGAAGAGAAAAGTAAGGG - Intergenic
905403909 1:37720705-37720727 CCTACCAAAGAGAAAAGTGAGGG + Intronic
905779914 1:40699407-40699429 CTTTTAAAAGAGAAGAGAGAAGG + Intronic
906061146 1:42949461-42949483 CTTTTAAAAAAGAAGAGTGATGG + Intronic
907166694 1:52417988-52418010 CCTTAAAAAGAGAAAAGTGATGG + Exonic
907846782 1:58215860-58215882 CATTCTCAAGAGAAGTCTGCTGG - Intronic
909319159 1:74260733-74260755 CATTCTAAAGAGATGAGAAAAGG + Intronic
911335933 1:96580247-96580269 CAATCTAAAGAGAAAAATAATGG + Intergenic
911717513 1:101151015-101151037 CATTCAAAAGATAAGAATGTGGG - Intergenic
912488166 1:110045796-110045818 GGTTCTAAAGAGAAAAGAGAAGG + Intronic
913419479 1:118649283-118649305 CATTGTCTAGAGAAGAATGAGGG - Intergenic
914260136 1:145992095-145992117 CATTTGAAAGAAAAGAGTGGCGG - Intergenic
915955365 1:160216210-160216232 CCTTCTTTATAGAAGAGTGAAGG - Exonic
917085604 1:171302723-171302745 AATTCTAAAAAGCAGAATGAAGG + Intergenic
917238214 1:172917523-172917545 GAGTCTAAAGAGAAGCTTGAAGG + Intergenic
917287627 1:173437756-173437778 GAATCTGAAGACAAGAGTGATGG - Intergenic
917570973 1:176265390-176265412 TATGCTAATGAGATGAGTGATGG + Intergenic
918449849 1:184647619-184647641 CAGTTTATAGAGAAGGGTGAAGG - Intergenic
918741525 1:188137707-188137729 AATTCAAAATAGAAGTGTGAGGG + Intergenic
918753826 1:188309958-188309980 AAATCTCCAGAGAAGAGTGAAGG - Intergenic
918878523 1:190083727-190083749 CATTGAAATGAGCAGAGTGAGGG - Intergenic
919083060 1:192889494-192889516 CATTAGAAAGAAAAGTGTGAGGG + Intergenic
920530620 1:206699442-206699464 GTTTCTAAGGAGAAGTGTGAGGG + Intronic
920882894 1:209896965-209896987 CAATCTAAAGAGGACAGGGAAGG + Intergenic
920888040 1:209952577-209952599 AAGTATAAAGAGAAGAGTTAGGG + Intronic
921507417 1:215989495-215989517 CACTGTATAGATAAGAGTGAAGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921722609 1:218490288-218490310 CATTCAAAACTGAAAAGTGAAGG - Intergenic
922683746 1:227622819-227622841 TATGCTAAAGAGATGACTGATGG - Intronic
923641836 1:235770724-235770746 CATACTAAATTGAAGAGTCATGG + Intronic
923819521 1:237422108-237422130 CATGCTAAGGTGCAGAGTGATGG - Intronic
1063207641 10:3849765-3849787 CATTATAAATGGAAGAGAGAGGG - Intergenic
1063296314 10:4810304-4810326 AATTCTGTAGAGAAGAGTGCAGG + Intronic
1064112894 10:12553657-12553679 CATTTTACAGAGAAGACTCAGGG - Intronic
1065251722 10:23822167-23822189 CAAACTAAAGAGATGAGTTAGGG - Intronic
1065552397 10:26882062-26882084 CATTAAAAAAAGAAGAGTGGAGG - Intergenic
1067988992 10:51188185-51188207 CTTTATAAAGACAAGACTGAGGG - Intronic
1068993603 10:63177797-63177819 CATTTTAAGGAAAAGATTGAAGG - Exonic
1069409654 10:68140208-68140230 CATATTGAAGGGAAGAGTGATGG + Intronic
1069743239 10:70698872-70698894 CATTCTGCTGAGAACAGTGAGGG + Intronic
1070034544 10:72709398-72709420 AAATCTAATGAGAAGATTGAAGG + Intronic
1070564424 10:77592795-77592817 TCCTCTAAAGAGAAGACTGAGGG - Intronic
1071174592 10:82909993-82910015 CACTCTAAAGCGAAAACTGAAGG + Intronic
1072887279 10:99289466-99289488 CATTCTAAAAAGAAAAATCATGG - Intergenic
1074177087 10:111018593-111018615 ATTTCTAAAGAGAAGATTTAAGG - Intergenic
1076174862 10:128360620-128360642 AATTCTAAAATGAAGAGTCAGGG + Intergenic
1078035128 11:7795949-7795971 TATTCTCAAGAGAAGAGATAGGG + Exonic
1079334900 11:19562683-19562705 CATTGTGAAGAGAAAAATGAAGG + Intronic
1080511200 11:32973439-32973461 GATTCTAAAGCAAAGAGTGGAGG + Exonic
1081014055 11:37854087-37854109 CATTTTAAAAAGAAGAGAAAAGG + Intergenic
1081786434 11:45751067-45751089 CATTCTGAAGAGGACTGTGATGG + Intergenic
1084351633 11:68604999-68605021 CATTTTAAAGAAAAAAGTGAGGG + Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085160328 11:74336983-74337005 CATGATAAACAGAGGAGTGATGG + Intronic
1087141728 11:94770598-94770620 CATTTTAAAAAGAAGGGGGAGGG - Intronic
1087596983 11:100266646-100266668 CACTTTAAAGAGAGGAATGAAGG + Intronic
1089575039 11:119435903-119435925 TCTTCTAAATAGAAGAGTCAGGG - Intergenic
1089635915 11:119811718-119811740 CATTCTGAAGGTAGGAGTGAGGG + Intergenic
1089888100 11:121849357-121849379 AATTTTAAATAGAAGAGTGAAGG - Intergenic
1089983754 11:122793959-122793981 CCATCTGAAGTGAAGAGTGATGG - Intronic
1090108184 11:123874446-123874468 AATTTTAAAGAGAGTAGTGAGGG - Intergenic
1091046340 11:132329063-132329085 GATTTTAAAGAGTAGATTGAAGG + Intronic
1091099211 11:132854542-132854564 CATGCTAATGAGATGACTGATGG - Intronic
1092607974 12:10140766-10140788 CTTTGTAAAAATAAGAGTGAAGG + Intergenic
1093216607 12:16369090-16369112 CAAAATAAAGAGAATAGTGAAGG + Intronic
1093724525 12:22488696-22488718 CATTGTAAATAGGAAAGTGAAGG - Intronic
1094384529 12:29879935-29879957 AATTCTCAAGAGGAGAGGGAGGG - Intergenic
1094435651 12:30418174-30418196 CACTCTGCAGAGAACAGTGATGG - Intergenic
1095199804 12:39370226-39370248 CTTGCCAAAGAGAAGATTGAAGG - Exonic
1095380153 12:41581335-41581357 GATCCAGAAGAGAAGAGTGAAGG + Intergenic
1095673990 12:44895114-44895136 GATTCTAGAGAGAAGCCTGATGG + Intronic
1096379454 12:51143659-51143681 CATTTTAAAGAGAAGCATGGAGG + Intronic
1097689911 12:62725196-62725218 CATCCTGCAGAGAAAAGTGAAGG - Intronic
1097971749 12:65640357-65640379 CAGTTTAAATAGGAGAGTGAAGG + Intergenic
1098093608 12:66930600-66930622 CATTCTAAATTGACTAGTGAGGG - Intergenic
1099294329 12:80811107-80811129 GATCCTAAGGAGAAGAGTGTGGG - Intronic
1099568608 12:84284473-84284495 TATTCTAAAGCAAACAGTGAAGG + Intergenic
1100700014 12:97137458-97137480 CATAGAAAAGAGAAGAGTTAGGG - Intergenic
1101320850 12:103671830-103671852 CATTTTAAAGAACAGAATGAGGG - Intronic
1102082930 12:110113012-110113034 CAGTCTGAAGAGCACAGTGATGG + Intergenic
1105954362 13:25266369-25266391 GATTGTAAAGAGAAAAATGAAGG - Intronic
1107312930 13:39099068-39099090 CATTCTAAAGAGACGTTTGAGGG - Intergenic
1107398771 13:40048138-40048160 CATTCTCAAGGGAGGGGTGAAGG - Intergenic
1107509464 13:41068542-41068564 ATTTCTAAAGAGATGAGAGAAGG - Exonic
1109043973 13:57383037-57383059 CATTCTAGATATAAGTGTGAAGG + Intergenic
1109296559 13:60539792-60539814 AATTCTAATGAGGAGGGTGATGG + Intronic
1109408097 13:61926753-61926775 TATTCAAAAGAGAAGATTAAAGG + Intergenic
1110589236 13:77235698-77235720 CATTCTAATGAGGGGAGGGAGGG + Intronic
1112833358 13:103480579-103480601 CATTCCAAATAAAAGATTGAAGG - Intergenic
1113002717 13:105661003-105661025 TATTTTAAAGAAAAAAGTGATGG + Intergenic
1113072256 13:106433439-106433461 CACTGCAAAGAGAAGAGTGATGG - Intergenic
1114587000 14:23824697-23824719 CATTTTAAAGAAGAGAGTGAGGG + Intergenic
1114782281 14:25551175-25551197 CTTTCTGCAGAGAAGAGAGAGGG + Intergenic
1117365753 14:55025868-55025890 CAGTATAAAGAGATGAGTGGTGG - Intronic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117823109 14:59672060-59672082 CATCCTAAAGCCAAGAGAGAAGG - Intronic
1120398348 14:83996512-83996534 TATTCTAGAAAGAACAGTGAAGG - Intergenic
1121037551 14:90718944-90718966 AATTCTCAAAAGAAGAGGGAAGG - Intronic
1125033630 15:35097963-35097985 TATTCTAAAAATAAGAGTGAGGG + Intergenic
1126300177 15:47185499-47185521 CATTCTAAAAAAAGGAGGGAGGG - Intronic
1126420462 15:48466939-48466961 CTTTCTGAAGAGAAGAGAGAAGG + Intronic
1127066990 15:55250938-55250960 TATTCTAATGAAAGGAGTGAAGG + Intronic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1129436855 15:75548570-75548592 ACTTCTAAAGAGAAGACAGATGG + Intronic
1129611130 15:77058382-77058404 CATTCTAGAGAGAACAGCGGAGG - Intronic
1133502657 16:6380290-6380312 CCTTGGAAAGAGAACAGTGACGG + Intronic
1133544873 16:6796224-6796246 CACTATGAAGAGAACAGTGAAGG + Intronic
1137724909 16:50650609-50650631 GATGCTCAAGAGAGGAGTGATGG + Intergenic
1138296494 16:55889821-55889843 TATTCTAATGAGATGACTGATGG - Intronic
1139080879 16:63519265-63519287 AATTCCAATGAGAAGAGTGAGGG - Intergenic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141746660 16:85930825-85930847 CATTCTAAGGGGCAGAGTGAGGG - Intergenic
1142245312 16:88967619-88967641 CTTTCTATAAAGAAGAGGGAAGG + Intronic
1144105362 17:11979875-11979897 CATTTTAAAGAGCTGAGTAATGG + Intronic
1145973659 17:28971868-28971890 CATTCTCAAGTGAAAAGTAATGG - Intronic
1146357052 17:32142891-32142913 CAGCCAAAAGAGAAGAGTGAAGG - Intronic
1149102867 17:52927529-52927551 CAGTCTTCAGAGAACAGTGATGG - Intergenic
1149559498 17:57598181-57598203 CAGCCTCAAGAGAAGAGGGAGGG + Intronic
1150885693 17:69082943-69082965 CATTCTAGAGCTAAAAGTGAAGG - Exonic
1151253929 17:72860354-72860376 CATTCAGAAGAGATGAGTAAGGG - Intronic
1152511838 17:80795256-80795278 CATTTTAATAATAAGAGTGAAGG - Intronic
1155132170 18:22947938-22947960 TATTCTAAATAGAACAGTAATGG + Intronic
1155446762 18:25921168-25921190 GATTTGAAAGAGAAGAATGAAGG - Intergenic
1155906918 18:31462863-31462885 GGTTTTAAAGAGAAGAGTAAGGG - Intronic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1156210350 18:34933408-34933430 CAGTTTACTGAGAAGAGTGAAGG - Intergenic
1156320755 18:36019416-36019438 GTTTCTAAAGAGGAGTGTGATGG + Intronic
1156704911 18:39868753-39868775 CATTCTGCAGAAAAGAATGAGGG - Intergenic
1158155047 18:54416172-54416194 GATTCTTAAGAGGAGAGTGTGGG - Intergenic
1159108741 18:64032049-64032071 CAATCTAAAGAGCAGAGTGATGG - Intergenic
1160318827 18:77871537-77871559 CTTTCTATAGAAAAGAGTCAAGG + Intergenic
1162194500 19:8973904-8973926 CTATCTGAAGAGAAGAGAGATGG + Exonic
1162704456 19:12544954-12544976 CACTCCTAAGAGATGAGTGAGGG + Intronic
1163252242 19:16132861-16132883 CAGTTAAAAAAGAAGAGTGAGGG - Exonic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1165659767 19:37567041-37567063 CATTCTAAAGACAAAACTGTAGG - Intronic
1166476262 19:43127609-43127631 CATCCTAAAAAGAAGACTCACGG + Intronic
1166600184 19:44086923-44086945 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166602299 19:44107608-44107630 CATTCCAATGTGAAGAGTGTGGG + Exonic
1166602323 19:44107860-44107882 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166604865 19:44132146-44132168 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166604890 19:44132398-44132420 CATTCAAATGTGAAGAGTGTGGG + Exonic
1166663984 19:44666135-44666157 CATTATTAAAAGAAGAGTCAAGG - Intronic
925834799 2:7934132-7934154 CATCCAAAAGAGTTGAGTGAAGG + Intergenic
928031041 2:27779506-27779528 ATTTATAAAGAGAAGACTGAGGG + Exonic
929359155 2:41063257-41063279 CATTTTAAAGAGAAGTGAAAAGG + Intergenic
929426033 2:41845652-41845674 CATTCCAAGGGGAAGAGTGCAGG - Intergenic
930144279 2:47985403-47985425 CATTTTAAAGAGAAGATTTCGGG + Intergenic
931172869 2:59823311-59823333 CCAGCTAATGAGAAGAGTGAGGG - Intergenic
931546911 2:63398472-63398494 TATTCTAATGACAAGAATGATGG + Intronic
932909047 2:75786166-75786188 CATCCTAAAGAGGAGAGGGTGGG + Intergenic
933082586 2:78011239-78011261 GACTCTAAAGAGAAAAGAGAAGG + Intergenic
934957993 2:98640758-98640780 CATAGTTAAGGGAAGAGTGAAGG + Intronic
935875575 2:107503295-107503317 CATTTCAAAAAGAAGACTGATGG - Intergenic
936252048 2:110874535-110874557 CCTTCTAATGAGGACAGTGATGG - Intronic
936417539 2:112331151-112331173 CTTGCTAAAGAGAAAAGTAAAGG + Exonic
936893853 2:117404741-117404763 CGGTCTAAAGAAAAGAGTCATGG - Intergenic
937418364 2:121735489-121735511 CATTCCAAAAAGGAGAGTGGAGG - Intronic
939349248 2:141012275-141012297 AATTCTAAAGAGAAGGGAAATGG + Intronic
939635069 2:144571866-144571888 CATTATAAAGAGGAGAGTTTGGG - Intergenic
939801626 2:146718431-146718453 GATTATAAAGAGAATAGTGGTGG + Intergenic
940134436 2:150420604-150420626 CATTTCAAAGACAAGACTGAGGG - Intergenic
941624544 2:167816832-167816854 CACTTTAAAGAGCAGAATGAGGG + Intergenic
942679363 2:178460974-178460996 CCTTTTAGATAGAAGAGTGATGG + Exonic
943002747 2:182349546-182349568 CTTTCTAATCAGAAGATTGATGG - Intronic
943153831 2:184148646-184148668 CATTCTCCAGAGAACAGTAAGGG + Intergenic
943314706 2:186372600-186372622 TATTTTAAAAAAAAGAGTGAGGG + Intergenic
945503162 2:210603770-210603792 TATTCTCAAGGGAAGAGCGAGGG - Intronic
1169047640 20:2547903-2547925 AATGGTAAAGAGAACAGTGAAGG - Intronic
1169996096 20:11558324-11558346 CATTTTAAAAAGCGGAGTGACGG - Intergenic
1171151251 20:22828122-22828144 CATTCCAAGGAGATGAGGGAGGG - Intergenic
1175362223 20:58421670-58421692 TATTTTAAAGAGAGGAGGGAGGG + Intronic
1177498530 21:21919664-21919686 CATGCAAGAGAGGAGAGTGAAGG - Intergenic
1177995716 21:28094715-28094737 CATTCTAAAGAGGAGAATTATGG - Intergenic
1179252633 21:39685320-39685342 CAGTCTAAAGAAAAAAATGAAGG - Intergenic
1179589455 21:42396861-42396883 CATTATAAAAACAAGTGTGATGG + Intergenic
1179936546 21:44609493-44609515 AAATCCAAAGACAAGAGTGAAGG + Intronic
1182234503 22:28864806-28864828 CTTTCTAAAGAAAATAGTGAAGG - Intergenic
1182450624 22:30418466-30418488 GATACTAAAGAGAAGATAGAGGG - Intronic
950980146 3:17295145-17295167 CATTCTAAAGAGTTGATTTAGGG + Intronic
952707297 3:36392238-36392260 AATTCTAGAGAGTAGAGTGGAGG - Intronic
953250039 3:41237180-41237202 CATTCTATAGAGATCATTGATGG + Intronic
953517349 3:43607575-43607597 CATTCTAAACATAATAGTGAAGG + Intronic
953807744 3:46086050-46086072 CATCCTCCAGAGAAGAGTGCAGG - Intergenic
954534067 3:51344876-51344898 CATTCTAAAGATAATTGTGGTGG + Intronic
955312501 3:57903332-57903354 CATTCTAAAGAGAAGAGTGATGG + Intronic
955467932 3:59255626-59255648 CATGCATAAGAGAAGAGTGCAGG - Intergenic
955523250 3:59795469-59795491 AAACCAAAAGAGAAGAGTGAGGG + Intronic
955524345 3:59805299-59805321 CATTTTAAAGATAAAAGTGATGG + Intronic
956714367 3:72065230-72065252 CATTCAAAGGAAAAGAGAGAGGG + Intergenic
958150040 3:89680229-89680251 AATTCTAAAGAGAAGAGAAGAGG + Intergenic
959015501 3:101129749-101129771 GATTCGGAAGAGAAGAGTAAAGG + Intergenic
959936567 3:112035531-112035553 AATTTTGAAGAGAAGAGTGAGGG + Intronic
962028170 3:131571129-131571151 CATGCTAAAGAGAAGTCAGAGGG - Intronic
962324141 3:134419359-134419381 TGTTCCAAATAGAAGAGTGATGG + Intergenic
962418116 3:135202102-135202124 CAATATAGAGAGAAGAGAGAAGG - Intronic
962649683 3:137475919-137475941 CTTTCTACAAAGAAGAGTGAGGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
970227719 4:13877154-13877176 CGTTCTAAAGGGAAGAGTTGTGG - Intergenic
970301836 4:14689485-14689507 CATTAGACAGAGATGAGTGATGG - Intergenic
970456568 4:16228357-16228379 CCTTTTAAATAGAAGAGAGAGGG + Intergenic
972071883 4:35030846-35030868 CATTTTAAATTGAAGACTGATGG - Intergenic
972766902 4:42159634-42159656 CATTCCAAAGAGAGGATGGAGGG - Intergenic
972819382 4:42682468-42682490 CATACTAATGTGAAGAGAGAGGG + Intergenic
972842243 4:42945035-42945057 CATTCATAAAGGAAGAGTGAAGG - Intronic
973028582 4:45306096-45306118 TATTGTAAGGAGAAGATTGAAGG + Intergenic
973744808 4:53953136-53953158 CTTTCCAAAAAGAAGACTGAGGG - Intronic
974454696 4:62112631-62112653 AATTTTATAGAGAAGAGTAAAGG - Intergenic
975299278 4:72770792-72770814 CATACTGAAAAGAAGACTGATGG - Intergenic
975547377 4:75573664-75573686 CATTTTAAAGAGCAGTGTTAAGG - Intergenic
976043225 4:80912926-80912948 CACTCTAAAGAGAAGAAAGAGGG + Intronic
976048037 4:80976385-80976407 TATTCTAAAAATAAAAGTGAGGG + Intergenic
976831281 4:89317630-89317652 TGTTTTAAAGAGAAGAGGGATGG + Intergenic
976862910 4:89688065-89688087 TATGCTAATGAGAAGAGTGGCGG + Intergenic
979881690 4:125967669-125967691 GATACTAAAGAGGAGAGTGAGGG + Intergenic
979986559 4:127323583-127323605 AATTCTAATGAGCAGAGGGAGGG - Intergenic
980616776 4:135238052-135238074 GATCCTAAAGAGAACACTGAAGG - Intergenic
981152595 4:141396436-141396458 CATTAGAGAGAGAAGACTGAGGG + Intergenic
981767369 4:148266480-148266502 CATTCCAGAGAGAAAAATGAGGG + Intronic
982560310 4:156921526-156921548 AATTAGAAAGAGAAGAGAGAGGG + Intronic
983066774 4:163219378-163219400 CATTCTAAAAAGAAAAGCAAGGG + Intergenic
983197338 4:164822096-164822118 CATTGTAATGAGAATAGGGATGG + Intergenic
984006409 4:174315037-174315059 CATTCTACAGAGAAGAGCTGAGG + Intronic
984391235 4:179136836-179136858 CATTATAAAGAAAAGAGCGGTGG + Intergenic
985239324 4:187913326-187913348 CAATAGAAAGAGAAGAGTGTGGG - Intergenic
986607043 5:9532814-9532836 TAAACCAAAGAGAAGAGTGAGGG + Intronic
987085025 5:14460215-14460237 CATTTTAAAAAGAAATGTGAGGG - Intronic
987205782 5:15623817-15623839 CCTTCTCAAGAGAAGTGTAATGG - Intronic
987788247 5:22529714-22529736 CAGTCTAAAGAGGACTGTGATGG - Intronic
988862839 5:35302625-35302647 CATTCAAAAGAGGACAGTGTGGG - Intergenic
989193294 5:38691883-38691905 GATTTTAAATAGAGGAGTGATGG - Intergenic
989424033 5:41274954-41274976 CAATATAAAGAGTAGATTGAGGG - Intergenic
989620978 5:43384170-43384192 CATTATAAAAATAAGAGAGATGG + Intronic
990797325 5:59558620-59558642 TATTTTAAAGAGAAAACTGAAGG + Intronic
991076950 5:62551097-62551119 CATTCTAAAGAGAAGTAACATGG + Intronic
991181418 5:63755753-63755775 CAATCATAATAGAAGAGTGAAGG + Intergenic
993759585 5:91776532-91776554 CAATCTCATGAGAAGTGTGAAGG - Intergenic
993763718 5:91829863-91829885 CATTCTGGAGAGAAGAGTTCGGG + Intergenic
993950025 5:94163406-94163428 CATACTAAAGAAAAAAGTGGTGG - Intronic
994471698 5:100216133-100216155 CATTACAAAGAGAACAGTGAGGG + Intergenic
994504704 5:100628033-100628055 CATTCAAAAGACAAAAGAGAAGG - Intergenic
995107550 5:108391933-108391955 CATTCTAAATAGTTGTGTGATGG - Intergenic
995704553 5:114973955-114973977 CAGTTAAAAGAGGAGAGTGAGGG + Intergenic
996197314 5:120624861-120624883 CATTATCACGAGAACAGTGAAGG - Intronic
997100513 5:130963429-130963451 CAGTCCAAAGGGAAGAGAGATGG + Intergenic
997945356 5:138195962-138195984 CAATCTTAAGAGTAGAGTGATGG - Intronic
998599362 5:143569272-143569294 CATTCCAGAGTGAAGAGTGTGGG + Intergenic
998909520 5:146943614-146943636 CATTCTAAAGAGTTGAAAGATGG - Intronic
999233435 5:150076555-150076577 CATTGTAAAGAGGAGAGTGATGG - Intronic
999293253 5:150441421-150441443 TATTCTAAAGACAACAGGGAGGG + Intergenic
999712581 5:154331824-154331846 TATTATAAAGAGAGGGGTGAAGG - Intronic
999870905 5:155750167-155750189 GATTCTAAAGGTAACAGTGAAGG - Intergenic
1000520387 5:162287805-162287827 CATTCTTATGAGCAGAGTGAAGG + Intergenic
1000956993 5:167555005-167555027 CTTTCCAGAGAGATGAGTGATGG - Intronic
1002630967 5:180578087-180578109 CCTTCCAAAGGGAAGAGTGCAGG + Exonic
1002809919 6:617773-617795 CAGGCTAACAAGAAGAGTGAGGG - Exonic
1002961514 6:1919254-1919276 CACTATAGAGAGAAAAGTGAGGG - Intronic
1003453131 6:6255837-6255859 GATTTTAAAAAGAAGATTGAGGG + Intronic
1003914467 6:10773105-10773127 TCTTCTAAAGAGAAGACAGATGG + Intronic
1004678224 6:17865286-17865308 GATTCCAAAGAGAAGAGATAGGG - Intronic
1005459885 6:26058082-26058104 CAGTCTAATGAGATTAGTGATGG + Intergenic
1005827701 6:29644875-29644897 CATTTTACAAAGAAGATTGAAGG + Intergenic
1007019136 6:38501774-38501796 CATAATAAAGAGAAGACTGCTGG - Intronic
1008191322 6:48461828-48461850 CATTCTAAAAACAAGAATTAGGG - Intergenic
1008441995 6:51542369-51542391 CTTTCTAAAGAGCACAGTGGGGG - Intergenic
1009647178 6:66420512-66420534 AATCCTGAAGAGAAGGGTGAAGG + Intergenic
1009924385 6:70102320-70102342 CATTCTAAACAGTAGAATAAAGG - Intronic
1010319848 6:74493363-74493385 CATTTAAAAAAAAAGAGTGATGG - Intergenic
1010898075 6:81391296-81391318 CATTATAATGAGAAGAGCAAGGG - Intergenic
1010928358 6:81770663-81770685 CTTTATAAGAAGAAGAGTGAGGG - Intergenic
1010967575 6:82229400-82229422 GATTTTAAAGACAAGAGTGAGGG - Intronic
1011258932 6:85451898-85451920 CATTTTAATGAGATGAGAGAAGG + Intronic
1012867114 6:104631915-104631937 CATTCAGAAGAGAATATTGAAGG + Intergenic
1013029632 6:106320756-106320778 CATACCAAACAGAAGACTGAGGG + Intronic
1013335173 6:109150913-109150935 CACTCTAAAGAGAACACTAAAGG + Intronic
1014780917 6:125563693-125563715 CATTCTACAGAGAAGATTCTTGG - Intergenic
1014795575 6:125720355-125720377 CATTCTAACAGGAAGAGAGAGGG + Intergenic
1016376980 6:143431091-143431113 GATTCTAAGGAGAACAGTGGTGG - Intronic
1017296744 6:152805056-152805078 CTTTCTAAACTGAAGAGTGAAGG + Intergenic
1018881621 6:167888114-167888136 GAGACTAAAGAGATGAGTGAAGG + Intronic
1018958771 6:168431731-168431753 GGTTCCAAAGAGAAGAGAGAGGG - Intergenic
1019024641 6:168948808-168948830 CATTCAAAAGAGAAGTATGGAGG - Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020498585 7:8888295-8888317 AATAGTAAACAGAAGAGTGAAGG + Intergenic
1020679101 7:11214856-11214878 CATTCTGAAGAGAAGGGTGGTGG - Intergenic
1024560458 7:50640487-50640509 CCTTCTAAAGAGAAGGGTGGAGG - Intronic
1025988023 7:66473080-66473102 CCTTTTAAATAGAAGAGAGAGGG - Intergenic
1026991580 7:74588996-74589018 CAACCTAAAGAGAAGAGGCAGGG - Intronic
1027633344 7:80636721-80636743 CATTTTAAAGTAAAGAGTGTTGG - Intronic
1027682162 7:81234257-81234279 TATTCTAAAGTGAAGAATGAGGG + Intergenic
1028109709 7:86925190-86925212 CATTTTAAAGAGTAGCATGATGG - Intronic
1028293993 7:89104744-89104766 AATTAACAAGAGAAGAGTGAAGG - Intronic
1031750834 7:125570995-125571017 CATTCTAGACAGTAGAGTAAAGG + Intergenic
1032667432 7:134050934-134050956 CAATCCAATGAGAAGAGTGTAGG + Intronic
1033502381 7:141965259-141965281 CATTCAAAAGAAAAGGGTGGGGG - Intronic
1037462925 8:19131375-19131397 CATTTTACAGAGGAGGGTGAGGG + Intergenic
1038835446 8:31116239-31116261 CCTTCTAAAGAAAAGACTAAAGG - Intronic
1038838546 8:31157084-31157106 CTTTCTAAAGTGAATAGAGAGGG + Intronic
1040880614 8:52200777-52200799 GAGTCTGAAGAGAAGAGTCAAGG + Intronic
1041243864 8:55872664-55872686 CAATCTAAGGAGAAAAGTGATGG - Intergenic
1042450400 8:68938575-68938597 CATTAAAAAGTGAAGAGTGCAGG - Intergenic
1042967861 8:74374859-74374881 CATTCTACAAAGAAGATTCAAGG + Intronic
1044420724 8:91993031-91993053 CTGTCTAAAGATAAGAGTGCTGG - Intronic
1044459986 8:92432911-92432933 CATTTTAAACAGAAAAGTGGAGG - Intergenic
1044466843 8:92516581-92516603 CATTCTAAAGAGAGGTATTAAGG + Intergenic
1044529390 8:93290491-93290513 TACTCTATAGAGAAGAGAGAGGG + Intergenic
1044885856 8:96776306-96776328 CATTCTAGACTGAAGACTGAGGG + Intronic
1045444761 8:102249308-102249330 CATTCAAAAAATATGAGTGAGGG + Intergenic
1046607431 8:116387564-116387586 CATTCTTTAAAAAAGAGTGAAGG - Intergenic
1047358174 8:124142921-124142943 CATTGTAAAGAAAAGAGAAAAGG + Intergenic
1048418962 8:134258239-134258261 CATTATAATGAGAACAGTGTGGG - Intergenic
1048591795 8:135827156-135827178 GATGCTAAAGAGAAAAGGGAAGG - Intergenic
1048600306 8:135912842-135912864 CATTTTAGAGAGAAGACTCATGG - Intergenic
1050212636 9:3280065-3280087 CATTCTAACCACAAGAGTAAGGG + Intronic
1051069970 9:13153783-13153805 TATTCTTAAGAAAAGAGTTAAGG - Intronic
1051636437 9:19184842-19184864 CAATCAAAAGAGAAAAGTAAAGG - Intergenic
1052769094 9:32671181-32671203 CATTCTAAAGAGCTTAGAGATGG + Intergenic
1052845105 9:33328708-33328730 CATTTTAAAGAAAACATTGATGG - Intronic
1055847877 9:80589174-80589196 CATCTTAAGGAGAAGAGTGAGGG + Intergenic
1055979209 9:81985312-81985334 CATATTAAAGAGAAGAGGAAGGG + Intergenic
1056447084 9:86676609-86676631 CATTCTGAAGATTAGAGTCACGG + Intergenic
1059041216 9:110817418-110817440 CACTTTCAAGACAAGAGTGAGGG + Intergenic
1060258899 9:122056647-122056669 CATTCTTGGGAGAAGAGTCAGGG + Intronic
1060556535 9:124510824-124510846 CATTTTATAGAGAAGAGAGAAGG - Intergenic
1061975532 9:134066580-134066602 CATTTTAAAGAAAAGAGTAAGGG + Intronic
1185936191 X:4259023-4259045 GATGCTAAAGAGAAAAGTCATGG + Intergenic
1186048463 X:5562856-5562878 CAATAGAAAGAGAAGAGTCAAGG - Intergenic
1186242138 X:7580463-7580485 AATGATAAAGAGAAGAGTGGAGG + Intergenic
1186602350 X:11051321-11051343 CATTTTGAAGGGAAGTGTGATGG + Intergenic
1187060028 X:15777169-15777191 CCTTTTAAAGGGAAGAGTGAAGG + Intronic
1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG + Intergenic
1188652241 X:32645901-32645923 AATTCTAAAGAGAAGATCCAGGG + Intronic
1188993841 X:36857932-36857954 GAGTTTAAAGAGAAGAGAGAGGG + Intergenic
1189648708 X:43164556-43164578 CTTTGTAAAGAGAAAAATGAAGG + Intergenic
1189719296 X:43898967-43898989 CATACTAAAGAGAACAGAGCTGG + Intergenic
1192346999 X:70318296-70318318 CATTTTAAATGGAAGAATGAAGG - Intronic
1192700544 X:73466454-73466476 CCTACTAAAGATATGAGTGATGG - Intergenic
1194758926 X:97770874-97770896 CTTTGAAAAGAGAACAGTGAGGG + Intergenic
1195135057 X:101897503-101897525 CATTATAAAAAAAAGAGTAAAGG + Intronic
1196097263 X:111813873-111813895 CATGCCAAAGAGAAGCGAGAGGG + Intronic
1196170660 X:112584760-112584782 CATTATCAAGAGAACAGTGCAGG + Intergenic
1196213088 X:113017644-113017666 CATCCCAAAGAGATGAGAGATGG + Intergenic
1197647802 X:129036775-129036797 GATTCTAAAGAGGAAAGGGAGGG + Intergenic
1198487413 X:137102020-137102042 AATGATAAAGAGATGAGTGAGGG + Intergenic
1198929908 X:141843966-141843988 CACTCCAAAGAGAAGAGAAAGGG - Intronic
1199531569 X:148853835-148853857 CATGCTGCTGAGAAGAGTGACGG + Intronic