ID: 955314630

View in Genome Browser
Species Human (GRCh38)
Location 3:57926081-57926103
Sequence TAGTTGACTGTTCAGTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955314630 Original CRISPR TAGTTGACTGTTCAGTTCAT TGG (reversed) Intronic
900075817 1:816807-816829 GAGTTTTCTGTTCTGTTCATTGG - Intergenic
904317134 1:29672903-29672925 TTGTTGATTGTGCAGTTCTTGGG + Intergenic
906253738 1:44331630-44331652 TATTTCACTGTTCAGTTAGTTGG - Intronic
907839835 1:58146128-58146150 TAATTGACTGTTTAGGTTATTGG + Intronic
909381204 1:75000648-75000670 TTGTTAAGTGTTCAGTTCAGTGG + Intergenic
910468005 1:87520946-87520968 TAGTTGACTGTACATTTTAAAGG - Intergenic
913480272 1:119281277-119281299 TAATTGCCTGTTGAGTTCTTGGG + Intergenic
913483642 1:119314178-119314200 TACTTGACAGTTCAGTTCAGAGG - Intergenic
914324429 1:146597698-146597720 TAGTTCACTTTTCGGTTCCTAGG + Intergenic
915695293 1:157735255-157735277 TATTTGACTTTTAAGTTCAGGGG + Intergenic
916307931 1:163360559-163360581 TAATTGACTGTTTAGGTTATTGG - Intergenic
918435618 1:184509530-184509552 TAAGTGACTGTTCAGTTATTTGG + Intronic
918654632 1:187009307-187009329 TTGTTGAGTCTTCAGTTCACAGG - Intergenic
920318958 1:205102624-205102646 TATTTAACTGTACAGTTCAGTGG - Intronic
920390691 1:205598702-205598724 AAGTTGAGTGTTGGGTTCATTGG + Intronic
921646567 1:217625484-217625506 TAGTTGACTGTTTATTTCTCGGG - Intronic
922755238 1:228092917-228092939 GAGTTGACTGTCCCGTTCTTTGG + Intronic
923871920 1:238004415-238004437 TTTTTAAATGTTCAGTTCATTGG + Intergenic
923917088 1:238520754-238520776 TAGCTGACAGATCAGGTCATGGG + Intergenic
1064420166 10:15184175-15184197 TAGTTAACTGTTTACTTCGTAGG + Intergenic
1071171980 10:82877343-82877365 AAGTTCACAGTTCAGTGCATAGG + Intronic
1073537236 10:104288688-104288710 AATTTGTCTGTTCAGTTCAGGGG + Intronic
1074423703 10:113331953-113331975 TCGTAGCATGTTCAGTTCATGGG - Intergenic
1074969232 10:118521950-118521972 TATGTGACTGTTCAGGTCACAGG - Intergenic
1075118825 10:119649619-119649641 TAATTGACTGTTCATGTTATTGG - Intergenic
1077708176 11:4508779-4508801 TATTTAACTTTTAAGTTCATGGG - Intergenic
1078968363 11:16374181-16374203 TAATTCCCAGTTCAGTTCATAGG - Intronic
1078993849 11:16676654-16676676 TAGATGACTACTAAGTTCATGGG - Intronic
1081062132 11:38492587-38492609 TGATTGACTGTTCCTTTCATGGG + Intergenic
1081940892 11:46940861-46940883 TAGTTCATTGTTCAGTTCCTTGG + Intronic
1085971270 11:81593700-81593722 TAATGGACTGTTCATTCCATGGG + Intergenic
1086813010 11:91334486-91334508 CAGTAGACTGTTCAGTTGTTGGG - Intergenic
1090231776 11:125112052-125112074 TAGATGACTGTGCAGTTCTCTGG - Intergenic
1090823688 11:130367959-130367981 CATTTGATTGTTCAGTTCACTGG + Intergenic
1093974826 12:25409986-25410008 TAATTGACTGTTCATGTTATTGG - Intronic
1097730940 12:63127336-63127358 TAATTGACTGTTCACATTATTGG + Intergenic
1105362042 13:19728378-19728400 TATTTCACTGTTCAGTTTAAAGG - Intronic
1107510597 13:41080109-41080131 TTGTTCACTGTTCAGGTTATAGG + Intronic
1109350885 13:61179648-61179670 TACTTCACATTTCAGTTCATAGG - Intergenic
1109584031 13:64374504-64374526 TAATTGACTGTCCATTTCACAGG + Intergenic
1109831336 13:67793260-67793282 TAGTTCACTGGAAAGTTCATAGG - Intergenic
1111321126 13:86630493-86630515 CGGTTGACTGTGCAGTTGATAGG + Intergenic
1115971331 14:38948050-38948072 TAGTTGACTGTTTATGTTATAGG - Intergenic
1116087638 14:40261286-40261308 TATTTGACTTTTTAGTTCATAGG + Intergenic
1124965346 15:34429179-34429201 TAGTGGACAGTTCAGAGCATGGG - Intronic
1124981964 15:34575381-34575403 TAGTGGACAGTTCAGAGCATGGG - Intronic
1126057583 15:44745292-44745314 TAGATGACTACTAAGTTCATGGG + Intronic
1127702139 15:61512078-61512100 TAGTGGAAAGTTCAGTTCCTTGG - Intergenic
1128328081 15:66738012-66738034 TTTTTGAGTGTTCAGTTCAGTGG + Intronic
1128896096 15:71375456-71375478 TAATTGCCTGTTCAGTTGTTTGG + Intronic
1129354963 15:74984128-74984150 TAGTAGACTTCTGAGTTCATAGG - Intronic
1130997655 15:88912795-88912817 CAGTTGGCTGGACAGTTCATTGG - Intronic
1132121592 15:99180623-99180645 AAGTTGAGTGTTCAGATGATGGG - Intronic
1140009131 16:71113149-71113171 TAGTTCACTTTTCGGTTCCTAGG - Intronic
1140311068 16:73848975-73848997 TCTTCGACTGTTCAGTTCACTGG + Intergenic
1143004607 17:3821225-3821247 TAGTTGCCTGCTCAGCTCTTGGG - Intronic
1143424584 17:6824337-6824359 TTTTGGAATGTTCAGTTCATTGG - Intronic
1149120387 17:53156358-53156380 TATTTGCCTGTTCAGTCAATTGG + Intergenic
1155663016 18:28274363-28274385 AAGTTAACAATTCAGTTCATTGG - Intergenic
1156757035 18:40540597-40540619 TAATTGACTCTTCATTTTATAGG + Intergenic
1157150609 18:45213745-45213767 AATTTGACTGGTCACTTCATTGG - Intronic
1158176256 18:54659851-54659873 TAGTTGACTTCTCATTTGATGGG + Intergenic
1158221344 18:55154079-55154101 TAGTGGACTGCTCTGTTCATGGG - Intergenic
1164873533 19:31667194-31667216 AAGGTGTCTATTCAGTTCATTGG - Intergenic
1168578724 19:57535538-57535560 AAGGTGACTGTTCAGTTCTGTGG + Intronic
926565086 2:14459922-14459944 TAGTTGTCTTTGCTGTTCATTGG + Intergenic
926654957 2:15392440-15392462 CAGTTGATTCTTCAGTTTATTGG - Intronic
929279163 2:40059527-40059549 AATTTGACTTTTAAGTTCATGGG - Intergenic
930272755 2:49275927-49275949 CAGTGGACTGTCCAGTCCATTGG - Intergenic
930805968 2:55490853-55490875 TGGTTGGTTGTTCAGTTCTTTGG + Intergenic
931956033 2:67426267-67426289 AAGTTGACTATTCAATTTATAGG - Intergenic
933427524 2:82131594-82131616 GAGATGACTGTTTGGTTCATGGG - Intergenic
936115494 2:109699452-109699474 TAACTGACTGTTCTGGTCATTGG - Intergenic
939709277 2:145496119-145496141 GAGTTGAGTTTTCCGTTCATGGG + Intergenic
942703516 2:178740912-178740934 AAGCTGACTGCTCAATTCATTGG + Exonic
943244897 2:185434299-185434321 TAGTTGACTGTTTATATTATTGG + Intergenic
944624569 2:201558363-201558385 TAGTTGTTTATTCAGTGCATTGG - Intronic
949081899 2:242107899-242107921 GAGTTTTCTGTTCTGTTCATTGG + Intergenic
1170491580 20:16881270-16881292 TAGTTCTCTATTCTGTTCATTGG + Intergenic
1173953203 20:47009508-47009530 AAATTGAATGGTCAGTTCATAGG - Intronic
1175629546 20:60523424-60523446 TTGTTGAGTGTGCAGTTCATTGG - Intergenic
1177594846 21:23225180-23225202 TTGTTTCCTGTTCAGTTCAAAGG - Intergenic
1177936569 21:27354050-27354072 CAGTTGACAGTTCATATCATAGG - Intergenic
1178162569 21:29936977-29936999 TGGTTGATTGTTTAGTTGATCGG + Intronic
1180759351 22:18187807-18187829 TATTTAACTTTTCAGTTCAGGGG - Intergenic
1180769659 22:18372103-18372125 TATTTAACTTTTCAGTTCAGGGG - Intergenic
1180827599 22:18875064-18875086 TATTTAACTTTTCAGTTCAGGGG - Intergenic
1181195388 22:21181849-21181871 TATTTAACTTTTCAGTTCAGGGG + Intergenic
1181214059 22:21310925-21310947 TATTTAACTTTTCAGTTCAGGGG - Intergenic
1181270163 22:21653892-21653914 CAGTTGACTGATCAGTTGAGTGG + Intronic
1182949378 22:34357906-34357928 GTGTTGACTGTTTATTTCATTGG + Intergenic
1184396134 22:44242580-44242602 GAGCTGTCTGTTCTGTTCATTGG + Intergenic
951421030 3:22484953-22484975 TAATTGCCTGTTGATTTCATAGG + Intergenic
953078288 3:39591864-39591886 TAGATGCCTGTTTGGTTCATAGG - Intergenic
953192731 3:40702968-40702990 TAGATGTCTGTTCAGGTCTTTGG + Intergenic
955115822 3:56000447-56000469 GAGTTTACTGTTTTGTTCATTGG - Intronic
955314630 3:57926081-57926103 TAGTTGACTGTTCAGTTCATTGG - Intronic
956070722 3:65448023-65448045 TAGTTCACTGTCCAGCTCCTCGG + Exonic
956568919 3:70672324-70672346 AAGTGGACTGTTGAGTACATGGG - Intergenic
957389543 3:79546259-79546281 AAGTTGACTGTTCACATGATCGG + Intronic
958589795 3:96141166-96141188 TATTTAACTTTTAAGTTCATGGG - Intergenic
958726576 3:97912918-97912940 TCTTTAACTGTACAGTTCATTGG + Intronic
960111107 3:113845853-113845875 TAATTAGCAGTTCAGTTCATTGG + Intronic
960724277 3:120654518-120654540 TAGTTGATTGATCAGTTGGTGGG - Intronic
961527050 3:127510940-127510962 GAGATGCCTGTTCAGTTCAGAGG - Intergenic
965415886 3:168391563-168391585 TATTTAACTTTTAAGTTCATGGG - Intergenic
965418840 3:168431026-168431048 TAGGAGACTGTTCATTTCTTAGG - Intergenic
967405055 3:189106037-189106059 TTGTTGAATTTTCAGTTCCTAGG - Intronic
970422402 4:15917924-15917946 TAATTGACTGTTTAGGTTATTGG + Intergenic
970743791 4:19270087-19270109 TATTTTCCTGTTCAGTTCAGAGG - Intergenic
971826947 4:31635881-31635903 TAGTTACCTCTTCAGTTTATTGG - Intergenic
973558279 4:52108295-52108317 TAATTGACTGTTCATGTCATTGG + Intergenic
974992333 4:69109147-69109169 TTGTTCACTTATCAGTTCATTGG + Intronic
977341960 4:95770409-95770431 GTGTTGTCTCTTCAGTTCATTGG - Intergenic
978545752 4:109870941-109870963 TATTTGTCTTTTCAGTTCAGAGG - Exonic
980192698 4:129544963-129544985 TACATGACTATTCAATTCATGGG - Intergenic
981842410 4:149127852-149127874 TTGTTGACTGTTCATTCCTTTGG - Intergenic
982922775 4:161296700-161296722 TAGTTGTCTGTTAAGGTCTTTGG - Intergenic
986398571 5:7355759-7355781 TAGGTGTCTGTTAAGATCATTGG + Intergenic
986648300 5:9939776-9939798 TAGTTGAATGTGCAGGTCTTGGG + Intergenic
988126195 5:27041345-27041367 TAGTTTAATCTTCAGGTCATAGG - Intronic
989035243 5:37163904-37163926 TTATTGACTTTTCAGTACATAGG - Intronic
990650284 5:57890878-57890900 TTTTTGACTGTTCATTTCTTAGG - Intergenic
990826933 5:59910881-59910903 TAGTTCACTGTCTAGTTCCTGGG - Intronic
992313655 5:75530066-75530088 TAGTTGATTTTTCAGTTTTTAGG + Intronic
993575898 5:89600416-89600438 TATTTGGATGTTGAGTTCATAGG - Intergenic
994267782 5:97738512-97738534 TCCTTCCCTGTTCAGTTCATAGG - Intergenic
997986410 5:138504866-138504888 CACTTGGCTGTTCAGTTCCTAGG + Intergenic
999609746 5:153356003-153356025 TTGTTGCCATTTCAGTTCATGGG + Intergenic
1000664493 5:163978578-163978600 TATTTCAATGTACAGTTCATTGG + Intergenic
1002705510 5:181158844-181158866 AAGTTGTCTGTTCATTTTATTGG + Intergenic
1004201501 6:13552939-13552961 TATTTGACTGTTCAATGCCTGGG - Intergenic
1004229781 6:13821703-13821725 TATTTGAGTGTTCTGTTCATGGG + Intergenic
1004308295 6:14521204-14521226 TAACTGTCTGCTCAGTTCATTGG + Intergenic
1005619287 6:27605100-27605122 CAGTTGACTGATCAGTTGAACGG + Intergenic
1007962304 6:45970832-45970854 TAGTTGTCCCTTCATTTCATAGG - Intronic
1010991060 6:82480348-82480370 TAGTTGAGTATCCAGTTGATAGG + Intergenic
1011224884 6:85095076-85095098 CAGGTGCCTGTCCAGTTCATGGG - Intergenic
1015850112 6:137563138-137563160 TTGATGACTGTTCAGTGAATGGG - Intergenic
1024330580 7:48150814-48150836 TAGTAGAGTGTTCAGAACATAGG + Intergenic
1026113577 7:67477674-67477696 TAGATGACTTTTAAGTTCAGGGG + Intergenic
1029874101 7:103730540-103730562 TAGTGGATTGTTGAGTTCAATGG - Intronic
1030867069 7:114712808-114712830 TCATAGACTGTTCAGTGCATCGG - Intergenic
1033630674 7:143154353-143154375 TAGTTGACCTTTCAGGTCACTGG - Intergenic
1035141031 7:156761212-156761234 TAGTTTACTCTTGAGTTCATAGG + Intronic
1035539816 8:424692-424714 GAGTTTTCTGTTCTGTTCATTGG + Intronic
1039587087 8:38716257-38716279 TATTTAACTGTTCTGTTGATTGG - Intergenic
1041614970 8:59895831-59895853 TAATTGACAGTTCATGTCATGGG + Intergenic
1041881363 8:62754243-62754265 TAGTGGACTGCTCAGTTCTGGGG + Intronic
1043308410 8:78826399-78826421 TATTTGCCTGTTCAGTTTGTGGG + Intergenic
1045772808 8:105763975-105763997 TAGTTTACTATTCAGTTTCTGGG - Intronic
1051016890 9:12488812-12488834 GAGTTGTCTGTTCAGGTCATTGG - Intergenic
1052574011 9:30267870-30267892 TCTTTGTCTGTTTAGTTCATGGG - Intergenic
1053030738 9:34775499-34775521 TTGTTGAGTGTACAGTTCACTGG - Intergenic
1055490188 9:76796796-76796818 TATTTGAGTCTTCAGTTGATTGG - Intronic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1058239741 9:102541918-102541940 TAGTTCATAATTCAGTTCATAGG + Intergenic
1058974881 9:110116548-110116570 TACTTGACTGATCAGTCCTTGGG + Intronic
1186025150 X:5302269-5302291 TAATTGACTGTTCACGTTATCGG + Intergenic
1186686384 X:11929240-11929262 TAGTTAACTTTTAAGTTCAAGGG - Intergenic
1187078047 X:15955689-15955711 TATTTTACTGATCAGTTCATTGG + Intergenic
1187090425 X:16090393-16090415 TAGTTAACTTTTCAGTTGAGTGG + Intergenic
1187808800 X:23152763-23152785 TAATTGACTGTTCATTTCCTTGG - Intergenic
1191128644 X:56984820-56984842 TATATGAGTGTGCAGTTCATGGG - Intronic
1193393035 X:80951737-80951759 TACTTAACTGTTCAGTACCTTGG + Intergenic
1193433717 X:81445446-81445468 GTGTTGACTGTTCAGGTGATTGG - Intergenic
1194271912 X:91825746-91825768 TATTTAACTGAGCAGTTCATGGG - Intronic
1198999761 X:142621167-142621189 TAGTTGTCTTTTCAGATAATAGG + Intergenic
1199418395 X:147614190-147614212 TAATTGACTGTTTATGTCATTGG + Intergenic