ID: 955314874

View in Genome Browser
Species Human (GRCh38)
Location 3:57929483-57929505
Sequence TTTCTATTCTTGAGGAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 386}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955314874 Original CRISPR TTTCTATTCTTGAGGAAAAC TGG (reversed) Intergenic
905297908 1:36966054-36966076 TTTCTCTTCTAGAGCAAAACAGG - Intronic
905520093 1:38590930-38590952 TTTTTCTTCTTGTGGAAAACAGG - Intergenic
905734104 1:40314540-40314562 TTTTTATTTTTGAGGAAAAGGGG - Intronic
907445064 1:54502166-54502188 TTTCAATCCTAGAGGGAAACAGG - Intergenic
907922711 1:58928562-58928584 CTTCTAGTCTTGGGGAAAAGGGG - Intergenic
909603690 1:77487325-77487347 TTTATTTCCATGAGGAAAACTGG - Intronic
910104248 1:83613950-83613972 TTACTAATTGTGAGGAAAACAGG + Intergenic
910693731 1:89990815-89990837 TTTCTTTGCCAGAGGAAAACGGG + Intergenic
911312470 1:96310962-96310984 TTTTTAATTTTGAGGAAAAAAGG + Intergenic
911349400 1:96734597-96734619 TTTCATTTGTTGAAGAAAACTGG + Intronic
915000294 1:152583258-152583280 TTTCAATTCATGAGGAAAGGTGG + Intronic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
915957210 1:160231400-160231422 TTTCTACTCTTAAAGGAAACTGG - Exonic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917578128 1:176345459-176345481 CTCATATTCTTGAGCAAAACCGG - Intergenic
918123879 1:181565429-181565451 TTTCTCTTCCAGAAGAAAACTGG - Intronic
918337962 1:183539834-183539856 TTTTTATACTTCAGGTAAACTGG - Intronic
918875400 1:190034914-190034936 TTTTTCTTTTTGTGGAAAACAGG - Intergenic
922068289 1:222165935-222165957 TTTCTCTGCTTGAGGAAATTTGG + Intergenic
923835980 1:237610967-237610989 TTCATATCCCTGAGGAAAACAGG + Exonic
1063620149 10:7639574-7639596 TTTTTATTCATGAGGAAAACCGG + Intronic
1063762932 10:9100659-9100681 TATCTATTTTTCAGGTAAACTGG + Intergenic
1064248232 10:13686561-13686583 TTTCTGTTCTGGGAGAAAACAGG - Intronic
1066395049 10:35011964-35011986 TTTCTTTTCTTCTGTAAAACAGG - Exonic
1067540563 10:47148638-47148660 TTTCTATACTTTATGCAAACTGG + Intergenic
1068151580 10:53139269-53139291 TCTCAGATCTTGAGGAAAACTGG + Intergenic
1069448650 10:68497911-68497933 TTTTTATTTTTGAGGAAATGGGG + Intronic
1070318704 10:75338093-75338115 TTTCTATTCTTAAGAAACACTGG - Intergenic
1070849984 10:79555765-79555787 TTTCCAATCTTGAGGAAAGTGGG + Intergenic
1070854244 10:79593855-79593877 TTTCCAATCTTGAGGAAAGTGGG + Intergenic
1071124527 10:82318771-82318793 TTTCTATTTGTGAGGTAAAGAGG - Intronic
1073415110 10:103374586-103374608 TTTCTTTTATGGAGGAAGACAGG + Intronic
1076081580 10:127586376-127586398 ATTCTATTAGTGAGGAAAATGGG + Intergenic
1078958447 11:16232201-16232223 TTTTTATTCTGGTGGAAACCAGG - Intronic
1080212579 11:29804093-29804115 TTTCTACTCTTGAGAGAAAATGG - Intergenic
1080664317 11:34322254-34322276 TTTATATTTTTGAGGCAAGCAGG + Intronic
1081347749 11:42011131-42011153 GTTCTTTTATTGAGGAAAAAAGG - Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083095350 11:60244809-60244831 TTTCTATTCTCTAGCAAAAAGGG - Intergenic
1085849928 11:80108287-80108309 TTAGTATTCTTGAGGAAGATAGG + Intergenic
1086807219 11:91259148-91259170 TTTCTATTCTGAAGGATAGCAGG + Intergenic
1087284798 11:96253651-96253673 TGCCTTTTCTTGAGGAAAATGGG - Intronic
1087453186 11:98351166-98351188 TTTTTATTTTTTAAGAAAACAGG + Intergenic
1087455039 11:98374094-98374116 TTTCTGTTGTGGAAGAAAACTGG - Intergenic
1087673938 11:101137292-101137314 TTTCTACTCATTAGGAACACTGG + Intergenic
1088087865 11:106003145-106003167 TTTCTCTTATTGTCGAAAACAGG + Intronic
1088304443 11:108393174-108393196 TTGCTATTCTTGGGGAACAAGGG - Intronic
1088987919 11:114926392-114926414 TTTCTGTTCTGCAGAAAAACTGG - Intergenic
1090842355 11:130502364-130502386 TTTATATTCATGAGGAATATTGG + Intergenic
1092631737 12:10386789-10386811 TTTATCTTCATGAGGAAAGCAGG - Intronic
1092978201 12:13766751-13766773 TTTTTATTCTTCAGAAAAGCTGG + Intronic
1093272107 12:17076423-17076445 TCTCTCTTTTTGAGGAAAAGTGG - Intergenic
1094176333 12:27545630-27545652 TTTCTATGCTTCAGGAACACAGG - Intronic
1094797657 12:33994594-33994616 TTTTTATTCCAGAGGATAACAGG - Intergenic
1095110385 12:38288518-38288540 TTTTTATTCCAGAGGATAACAGG - Intergenic
1095247041 12:39935216-39935238 TTTCCCTTCTTGAGGAGAATGGG - Intronic
1095606662 12:44075876-44075898 TCTCTTTTCTTCAGTAAAACTGG + Intronic
1095658728 12:44702700-44702722 TTTCTTTTCTTCTGCAAAACTGG + Intronic
1096538880 12:52292130-52292152 TTTCAAATATTGAGGAAAATTGG + Intronic
1098860560 12:75705219-75705241 TCTCTTTTCTTCATGAAAACTGG - Intergenic
1099278545 12:80610791-80610813 TTTATATTTTTGAGGTAAAGAGG + Intronic
1099594823 12:84647587-84647609 TTTCTAATTTTGAAGAAAAATGG + Intergenic
1099854380 12:88144850-88144872 TGTATATTTTTGAGGAAAATTGG + Intronic
1100625972 12:96332968-96332990 TATCTTTTCTTTAGGAAAAGAGG + Intronic
1100931319 12:99613142-99613164 TTTCTATTGTTGAGTAAAGAAGG + Intronic
1101012454 12:100465171-100465193 TTTATATAATGGAGGAAAACTGG + Intergenic
1101273607 12:103175205-103175227 ATTTTATTCTTGAATAAAACTGG - Intergenic
1104585932 12:130047990-130048012 TTTCTTTTTTTAAGGAAAACAGG + Intergenic
1105297356 13:19100113-19100135 TTTCTTTTCTTGGGGGAAATTGG - Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106015849 13:25868352-25868374 ATACGATACTTGAGGAAAACTGG - Intronic
1106891638 13:34252489-34252511 TTTCTATTCTTTGGCATAACAGG + Intergenic
1107041036 13:35947639-35947661 TTTCAGTTCTGCAGGAAAACAGG + Intronic
1107797584 13:44068655-44068677 TTTCAATAGTTGAGGAAAAGGGG + Intergenic
1108333671 13:49416583-49416605 TATCTAGTCATGAAGAAAACTGG + Intronic
1108472944 13:50785769-50785791 GCTCTATTCTTGGAGAAAACTGG - Intronic
1109216950 13:59600067-59600089 TTTCTATACTTCATGCAAACTGG + Intergenic
1109764894 13:66882097-66882119 GTTCTATTTTTGTGGAACACTGG + Intronic
1109773836 13:67013776-67013798 ATTCTATATTTGAGAAAAACAGG + Intronic
1109783682 13:67146733-67146755 TTTCAATGCTTGTGGATAACTGG + Intronic
1110254110 13:73412888-73412910 TTTTTATTTATGATGAAAACTGG + Intergenic
1110745167 13:79044068-79044090 TTTCTGTTCTTCAGGAGCACAGG + Intergenic
1110926489 13:81160734-81160756 TCTATATTCATAAGGAAAACTGG - Intergenic
1111534060 13:89578363-89578385 TATCTTTGCTTGAGGAAAAGAGG - Intergenic
1111553973 13:89855233-89855255 ATTATATTCTTGAGGATAATTGG - Intergenic
1111650575 13:91086053-91086075 GTTCCTTTCTTGAGGAAAGCAGG + Intergenic
1112068955 13:95826672-95826694 TTATGATTCTTGAGGAAAACTGG + Intronic
1112081345 13:95974908-95974930 TTTCTATTTTTGATAGAAACAGG - Intronic
1112093526 13:96108081-96108103 TTTCTCTTATTGCCGAAAACGGG + Intronic
1113136516 13:107096244-107096266 TTTCTAACCTTGGGGATAACTGG + Intergenic
1113742279 13:112719736-112719758 CTCCTATTTTTGAGAAAAACCGG + Intronic
1115522670 14:34248529-34248551 TTTCTATTATTGTGGAAGAAAGG + Intronic
1116093933 14:40343631-40343653 TTTCTATTCTTAAGAAGAATTGG - Intergenic
1116493124 14:45529075-45529097 TTTATGTTCATGAGGAAAACGGG - Intergenic
1117581386 14:57155027-57155049 TTATTATTATTGAGGAAAAAAGG - Intergenic
1118831065 14:69433364-69433386 TTTCTGTTCATGAAGAATACTGG + Intronic
1119358559 14:74028057-74028079 TATCTATTTTTGAAGAAAAAGGG - Intronic
1120903453 14:89596455-89596477 TTTATATTCATGAGTGAAACTGG + Intronic
1120982716 14:90304929-90304951 TTTCTACTCTAGAGGAAAAGAGG + Intronic
1121171797 14:91860693-91860715 TTTCTATGCTTGAGGAATTCTGG + Intronic
1121388393 14:93551821-93551843 TCTTTATTCTTAAGGAAAAAGGG + Intronic
1122173688 14:99900155-99900177 TTAATATTCTTGGGCAAAACAGG - Intronic
1127608496 15:60614482-60614504 TGTGTATTTTTGAGGAAAAGAGG + Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128465227 15:67904938-67904960 TTTGTATTCTTCAGGCAAATGGG - Intergenic
1129058672 15:72842223-72842245 TTTATATTCATGAGGAATATTGG + Intergenic
1129494265 15:75962894-75962916 TTTTTATTCTTGACAAAATCTGG - Intronic
1130128951 15:81120030-81120052 TTTTTATTATTTAGGAAAACTGG - Intronic
1130747622 15:86672830-86672852 TCTCCTTTCTTTAGGAAAACAGG + Intronic
1130772260 15:86936367-86936389 TCTATATTCTTGTGGAAAACTGG + Intronic
1131551423 15:93360352-93360374 TTTCTCTACTGGAGAAAAACCGG - Intergenic
1131782812 15:95877826-95877848 TTTTTATTCTTGATGTATACTGG + Intergenic
1131853883 15:96571484-96571506 CTTCTATACTATAGGAAAACAGG - Intergenic
1133849828 16:9492266-9492288 TTCTTACTCTTGAGTAAAACAGG + Intergenic
1135604062 16:23807988-23808010 GTTCTAGTCCTGAGGCAAACAGG - Intergenic
1135656331 16:24253609-24253631 TTTCTCTTATTCAGCAAAACTGG + Intergenic
1135673903 16:24398041-24398063 TTTGTATTGTTGAGTAGAACAGG - Intergenic
1135986485 16:27188544-27188566 TTTCTTTTCTTTTTGAAAACAGG - Intergenic
1138326690 16:56178016-56178038 TCTATATTCATGAGGAATACGGG + Intergenic
1139117044 16:63967439-63967461 GTTCTATTCTTGAGTAACTCTGG - Intergenic
1140698956 16:77563596-77563618 TTTTTATTTTTCAGGAAGACAGG + Intergenic
1143418005 17:6764155-6764177 TTTCTTCTTTTGAGGAAAATGGG + Intronic
1145797566 17:27664710-27664732 TTTCCATTCCTCTGGAAAACTGG + Intergenic
1145857415 17:28174685-28174707 TTTCCATACTGGAGGAAAAGTGG - Intronic
1147114854 17:38291258-38291280 TTTCTATAGGTGAGGAAAAAAGG + Intergenic
1148419574 17:47533694-47533716 TTTCTACTTTTGTGGAAGACTGG + Intronic
1148572642 17:48682664-48682686 TTTGTATTTTTGTGGAGAACAGG - Intergenic
1148925381 17:51080188-51080210 TTACTATCCTTGATGAGAACAGG - Intronic
1149569436 17:57661993-57662015 TTTGTATTGTTGGGGAAAGCAGG - Intronic
1150998311 17:70344790-70344812 TTTCTTTTTTTAAAGAAAACAGG - Intergenic
1152823841 17:82450961-82450983 TTTCTTTTTTTCAAGAAAACTGG - Intergenic
1155072160 18:22325944-22325966 TTTCAATCCTTGAGGAATTCTGG + Intergenic
1155338597 18:24791365-24791387 GTCCTATTCCTCAGGAAAACAGG - Intergenic
1156001650 18:32391557-32391579 TTTCTGTCTTTGTGGAAAACTGG - Intronic
1156781836 18:40859423-40859445 TTTCTCTTCTTGAGTGAAAAAGG + Intergenic
1157045273 18:44095181-44095203 TCTCAGATCTTGAGGAAAACCGG - Intergenic
1157776209 18:50398397-50398419 TCTCAGATCTTGAGGAAAACTGG - Intergenic
1158207947 18:55014547-55014569 TTTCTGATATTGAGGAAAATAGG - Intergenic
1159600050 18:70420471-70420493 TTTCTATTCTAGTGGAAATCAGG + Intergenic
1159745817 18:72233278-72233300 TCTCTATTCTGATGGAAAACAGG + Intergenic
1163593245 19:18205745-18205767 TTTCTCTTCCTGGGGAAAAAAGG - Intergenic
1164077297 19:21831909-21831931 TTTCTATTCATGAGCATAAACGG - Intronic
1164132412 19:22377029-22377051 TTACTCTTTTTGAGGAAAAGTGG - Intergenic
1164694024 19:30229936-30229958 TTTCTAAACTTTGGGAAAACGGG - Intronic
1164863500 19:31582567-31582589 TATCTATTTTTTAGGAAATCAGG + Intergenic
1165396677 19:35568184-35568206 TTTCTTTTCTTGAGAAAGAGGGG + Intergenic
1165503281 19:36207183-36207205 ATTTTATTCTTAAGGAAAACAGG + Intronic
1165536157 19:36447185-36447207 TTTGTATTTTTGAGTAAAAATGG + Intronic
1165565100 19:36718936-36718958 ATTCTTTTCTAGAAGAAAACTGG + Exonic
1166912584 19:46170586-46170608 TTTCTCTTATTACGGAAAACAGG + Intergenic
925480236 2:4262473-4262495 CTTCTATTCTAGAGGGAGACAGG + Intergenic
925747676 2:7057391-7057413 TTTCTAATCTGGAGGAAATTGGG + Intronic
925747911 2:7059880-7059902 TTTCTTCTCTTGAGTAAAAGTGG + Intronic
925952717 2:8930166-8930188 TCTCAGATCTTGAGGAAAACTGG - Intronic
926278846 2:11427848-11427870 TTTCTTTTTTTGAAGAAAAATGG + Intergenic
927220095 2:20698890-20698912 TTTATATGCTTGAGGAAAATGGG - Intronic
927346860 2:22054408-22054430 TTTCTTTTTTTTAGGAAAAATGG + Intergenic
928037072 2:27834683-27834705 ATTTAATGCTTGAGGAAAACTGG - Intronic
928421789 2:31142814-31142836 TTACTTTTCTTTAGGCAAACTGG - Intronic
928598516 2:32880553-32880575 TTCATATCTTTGAGGAAAACTGG - Intergenic
929361858 2:41101461-41101483 TTTCTCTTCTTGTGGTAAATTGG - Intergenic
930280961 2:49368997-49369019 TTTCCATTCTTGAACAAAGCAGG - Intergenic
930364815 2:50425886-50425908 TTTCTGTTTTTGAAGAATACCGG - Intronic
930987509 2:57608664-57608686 TTTCTTTTCTTTAGAAAAACAGG + Intergenic
933668311 2:84982919-84982941 TTTCTCTTCTCTAGGAAAACTGG + Intronic
933905635 2:86889848-86889870 TTTCTATCCGTGAGGAAATGTGG + Intergenic
933920279 2:87039055-87039077 TTTGTATTTTTGATGGAAACAGG - Intergenic
933931345 2:87154731-87154753 TTTGTATTTTTGATGGAAACAGG + Intergenic
934002718 2:87730839-87730861 TTTGTATTTTTGATGGAAACAGG + Intergenic
934020616 2:87947785-87947807 TTTTAGATCTTGAGGAAAACCGG - Intergenic
934964426 2:98707713-98707735 TTTCTTTTCCTGAGGAATAATGG - Intronic
935847555 2:107183235-107183257 TATTTATTCTAGTGGAAAACTGG - Intergenic
936097113 2:109538959-109538981 TTTTTACTTTTGAAGAAAACAGG + Intergenic
936361776 2:111810709-111810731 TTTGTATTTTTGATGGAAACAGG - Intronic
936845271 2:116823291-116823313 TTACAATTTTTGAGGAATACAGG + Intergenic
937163787 2:119793298-119793320 TTTCTCTTATTGCTGAAAACGGG - Intronic
937816303 2:126254408-126254430 ATTCTACTATTGAGGAAAACTGG - Intergenic
938061263 2:128256431-128256453 TTTCTATACTTTATGCAAACTGG + Intronic
938256597 2:129864147-129864169 ATTCCATTCTTGAGGAAGAAGGG + Intergenic
938858533 2:135341628-135341650 TTTCTCTTATTGCTGAAAACGGG + Intronic
940204640 2:151189340-151189362 TTTCTAAAATTGAGGAACACAGG + Intergenic
940743897 2:157545703-157545725 TTTCTCTTCTTGAGTTTAACTGG - Intronic
941130894 2:161650083-161650105 GTTGTATTCTTGATGAGAACTGG - Intronic
942550885 2:177117775-177117797 TTTAGATTCCTGAGGAAAATGGG - Intergenic
943341431 2:186686598-186686620 TTGCTATGCTTCAGGAAAATGGG - Intergenic
943458545 2:188139715-188139737 TGTCTATTTTTAAAGAAAACTGG - Intergenic
943462593 2:188187917-188187939 TTTCTATTCTAAAAGTAAACTGG + Intergenic
945003667 2:205378480-205378502 TTTCTATTCTGAATGTAAACAGG - Intronic
945951273 2:216041142-216041164 TTTCAGTTTTTGAGGAAAGCGGG - Intronic
948457385 2:238111942-238111964 CTTATATTCTTGAGTAAAATTGG + Intronic
1169510672 20:6260723-6260745 TGTATATTCTGGAGGAAAAATGG + Intergenic
1169685565 20:8267382-8267404 TGTCCCATCTTGAGGAAAACTGG - Intronic
1171121222 20:22570799-22570821 TTTCTATTGTTTTGGAAGACTGG + Intergenic
1173444601 20:43106342-43106364 TTTCTAAACTGGAAGAAAACTGG - Intronic
1174489560 20:50883157-50883179 TTTGTATTCTTGTGGAATATTGG - Intergenic
1175131644 20:56794011-56794033 TTTATATTGTGGAAGAAAACTGG - Intergenic
1175363571 20:58434245-58434267 TATGTTTTCTTGAGCAAAACAGG + Intronic
1175476609 20:59279661-59279683 TTTTTACTTTTGAGGAAAAGTGG + Intergenic
1175522297 20:59609568-59609590 TTCCTGTTCTGCAGGAAAACCGG - Intronic
1175661692 20:60818702-60818724 TTTATATTCCTGAGGACAAAAGG - Intergenic
1178677099 21:34640523-34640545 TTTCTTTTCTTAAGCAAAAAAGG + Intergenic
1178998071 21:37425675-37425697 TGTCTCTTCTAGAGGAAAATGGG - Intronic
1179346028 21:40558139-40558161 TTTCTATCACTGAGAAAAACAGG + Intronic
1180730355 22:17977155-17977177 TCTCGATTCTTGAGTAAACCTGG - Intronic
1180753129 22:18139533-18139555 TTTCTATGCTTCAGTCAAACTGG - Intronic
1181909479 22:26227264-26227286 TTTTTATGCTTGAGGAAATTGGG - Intronic
1182597269 22:31431491-31431513 TTTTTATTTTTGATAAAAACGGG - Intronic
1183562581 22:38587793-38587815 TTTGTATTCTTAAGGAAGAGTGG - Intronic
949643534 3:6067150-6067172 TCTCAGATCTTGAGGAAAACCGG - Intergenic
949933963 3:9102152-9102174 TTTCTATTCTTAGGGATCACTGG + Intronic
950612776 3:14136948-14136970 TTTCTGTTGTTGATGAACACAGG + Intronic
951240772 3:20283565-20283587 TTTATATCCTTGAGGAAATCAGG - Intergenic
951820716 3:26808048-26808070 ATTCTCTTCTTGATAAAAACAGG - Intergenic
953205405 3:40823326-40823348 CTTCTATTCTTGATGAAGCCAGG - Intergenic
954506450 3:51080274-51080296 TTTCTCTACTGGAGAAAAACTGG + Intronic
955314874 3:57929483-57929505 TTTCTATTCTTGAGGAAAACTGG - Intergenic
956259349 3:67321008-67321030 TTTCTATACTTGATTCAAACTGG - Intergenic
956267832 3:67417708-67417730 TTTCTCTGCTGGAGGAAAAGGGG - Intronic
956443175 3:69299991-69300013 TCTCTATTCTTCAGTCAAACAGG + Intronic
956518334 3:70076021-70076043 TTGCTATTCTTGAGCAAATTCGG + Intergenic
957150222 3:76476820-76476842 TTTATATTCTTGGGAAAAAATGG + Intronic
957445152 3:80307381-80307403 TCTCAGATCTTGAGGAAAACTGG - Intergenic
957445897 3:80312444-80312466 TCTCAGATCTTGAGGAAAACCGG - Intergenic
957542765 3:81595759-81595781 ATTCTACTCTTGACCAAAACAGG + Intronic
958594735 3:96207405-96207427 TTCCTATTCATGAGGAATGCTGG - Intergenic
958619106 3:96533588-96533610 TTTCTGTTATTGTTGAAAACTGG - Intergenic
959204324 3:103284983-103285005 ATTCTATTCTTGAACAAAACTGG + Intergenic
959524772 3:107364295-107364317 TTTCTATTTTTGATAAAGACGGG - Intergenic
959676345 3:109040186-109040208 TTTCTTTTTTTGCCGAAAACTGG - Intronic
961425515 3:126843331-126843353 TCTCTTTTCTCGAGGAATACTGG + Intronic
962790057 3:138803155-138803177 TTTTTATTCTGGTGGAAGACTGG - Intronic
962912141 3:139862819-139862841 TTTCTCTTATTGCCGAAAACGGG + Intergenic
963031283 3:140980410-140980432 TGTCCAGTCTTGAGGAAACCAGG + Intergenic
963492415 3:146018010-146018032 TCTCAGATCTTGAGGAAAACCGG - Intergenic
964049800 3:152376837-152376859 TATCTCTTCTTGGGGAAAATGGG + Intronic
964946552 3:162232488-162232510 TGACTTTTATTGAGGAAAACAGG + Intergenic
965167854 3:165219717-165219739 CTTCTAGTTTAGAGGAAAACGGG + Intergenic
966093784 3:176173243-176173265 TTTGTATTTTTGAGGAAACAGGG - Intergenic
966157326 3:176930910-176930932 TTTCTAGTGTTAAGTAAAACTGG + Intergenic
966290236 3:178347287-178347309 TTTTTTTTCTTGAAGGAAACTGG - Intergenic
967793145 3:193570665-193570687 ATCCTATTCTTGAGTAAAGCAGG + Intronic
968323018 3:197788270-197788292 TTACAATTTTTAAGGAAAACAGG - Intergenic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
968707414 4:2086596-2086618 ATTCTCTTCTGGAGGAAAATGGG - Intronic
968885762 4:3331023-3331045 TTTCTATTCCTGTGGAAGAAGGG + Intronic
969287906 4:6218304-6218326 TTCCTATCCATGAGGAAAATTGG - Intergenic
969837330 4:9852553-9852575 TTTCTTTTCTTTAAGAATACTGG - Intronic
970200277 4:13597720-13597742 TTTCACTTCTTCAGGAAAAAAGG + Intronic
971138170 4:23892995-23893017 TTTCTATTGTTGAGAAAAAATGG - Intronic
971434616 4:26606947-26606969 TTTCTAATCTTGATGAACAAAGG - Intronic
971752816 4:30673117-30673139 TTGCTATTCTTTAGGAAAATTGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972649942 4:41006998-41007020 TTTCCAGTCTTGAGGCAAAGTGG - Intronic
974169889 4:58252472-58252494 GTCCAATTCTTGAAGAAAACTGG - Intergenic
975351231 4:73349703-73349725 TTGCTATTCTAGGGGAAAAGAGG + Intergenic
975696167 4:77015431-77015453 TTTCTAATCATTAGGTAAACTGG + Intronic
975935247 4:79571759-79571781 AATCTATTGCTGAGGAAAACAGG + Intergenic
977170831 4:93760255-93760277 TTGCTATTCTTTTGGAAAATAGG + Intronic
977371741 4:96145658-96145680 TTTCTCTTCTTATGGACAACAGG - Intergenic
977994313 4:103484009-103484031 TTTCTTTTCTTAAGGAATCCAGG - Intergenic
978231892 4:106409810-106409832 TCTCAGATCTTGAGGAAAACCGG - Intergenic
978385199 4:108171059-108171081 CTTCTAATCTTCAGGAAACCTGG - Intergenic
978995753 4:115149991-115150013 TTGCTATTCTTATGGAAGACTGG - Intergenic
979515645 4:121606921-121606943 TTTGTATCCTTGTGGAAAATCGG + Intergenic
979910770 4:126363224-126363246 TTTCTAATATTTAAGAAAACTGG + Intergenic
983225147 4:165079045-165079067 TTTCTATTCTTAAGAAATAAGGG - Exonic
983829428 4:172306480-172306502 TTTCCATTGTTTGGGAAAACAGG + Intronic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984280590 4:177665885-177665907 TTTGGATTTTTGAGGAAAAAGGG + Intergenic
984363976 4:178774490-178774512 TTTCTATTTTTGGGAAAGACGGG - Intergenic
985826597 5:2196419-2196441 CTTCTTTTCTTCAGCAAAACAGG - Intergenic
985888477 5:2698143-2698165 TGTCTCTTCTTGGGGAAGACTGG + Intergenic
986089379 5:4488927-4488949 TTTTTATGCTTGTGGAAAAGGGG + Intergenic
986134173 5:4958851-4958873 TTTCTATTCTTGATTACAACAGG + Intergenic
986513706 5:8538302-8538324 TTTATGTTCTTGAGGAATATTGG - Intergenic
986537614 5:8807077-8807099 TTTTTATTCTTGGAGGAAACTGG + Intergenic
986811910 5:11368817-11368839 TTTCTACACTTGAGGAAACTGGG - Intronic
986815628 5:11406338-11406360 TTTCTATTATAGTGGAAACCAGG - Intronic
986908463 5:12524142-12524164 TTTCTGTTTTTGATGAATACTGG + Intergenic
987191369 5:15481776-15481798 TTATTATCCTTGAGGAAGACAGG - Intergenic
987771250 5:22308242-22308264 TTACTATTCTAGAGTTAAACAGG + Intronic
987850977 5:23353744-23353766 TATCTATTCGTGTGGAATACTGG + Intergenic
988125242 5:27024133-27024155 TTTTTATTAATGATGAAAACTGG + Intronic
988426298 5:31068778-31068800 TTTTTATTCTTGCAGAAAAATGG - Intergenic
988931001 5:36035569-36035591 TTCCTGTTCTTCAAGAAAACAGG + Exonic
989951254 5:50300131-50300153 TTTTTATTACTTAGGAAAACAGG + Intergenic
990046233 5:51435238-51435260 TTTATATAATTGAAGAAAACTGG - Intergenic
990196937 5:53328013-53328035 TTTCCTTTCAGGAGGAAAACTGG - Intergenic
991289782 5:65022443-65022465 TTTCTTTTATTAAGGAAAGCTGG - Intergenic
992299228 5:75360915-75360937 TTTCTTCCCTTGAAGAAAACAGG - Exonic
992317644 5:75574457-75574479 TTTCTATTTTTTATGACAACTGG + Intronic
992546941 5:77822574-77822596 TTCCTATTCTTAATGAGAACAGG + Intronic
992695772 5:79285330-79285352 TTTCTACACTTGATGAAAAAGGG - Intronic
992996686 5:82340749-82340771 TTCCTGTCATTGAGGAAAACAGG + Intronic
993181642 5:84561092-84561114 TATCTATACTTTATGAAAACTGG + Intergenic
993788455 5:92174743-92174765 TTTGTATTGTTGAATAAAACAGG - Intergenic
994579710 5:101625335-101625357 TTTCTCTTTTTGTGGAGAACGGG - Intergenic
994859934 5:105178383-105178405 TATTTGTTCTTGAGGAAAGCAGG - Intergenic
995068915 5:107895248-107895270 CTTGTATGCTTGAGGAAGACTGG + Intronic
995265756 5:110157544-110157566 GTTTTATTCTTGAGTGAAACAGG - Intergenic
996623529 5:125540548-125540570 TTTCTTTTCTTGTCAAAAACTGG + Intergenic
997498634 5:134353178-134353200 TTTCACTTCTTGTGGAAACCAGG - Intronic
997788509 5:136735897-136735919 TCTCAGATCTTGAGGAAAACCGG - Intergenic
999022656 5:148185478-148185500 ATTCTTTTCATGAGGAAATCCGG - Intergenic
1000102798 5:158032963-158032985 TATCTAATGTTGGGGAAAACGGG - Intergenic
1000142904 5:158423778-158423800 TTCCCATTCTTGAGGAAGTCTGG + Intergenic
1003075425 6:2979814-2979836 TTACTATTGTTGATGAAAAGAGG - Intergenic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1004256566 6:14069843-14069865 TTTGTATCTTTGAGGAAAAGAGG - Intergenic
1007780490 6:44250783-44250805 TTTCTCTTCTTATGGAAATCTGG + Intronic
1008341855 6:50376034-50376056 TTTCTTTTGTTGCTGAAAACTGG + Intergenic
1008504646 6:52217980-52218002 TTTTTTTTTTTAAGGAAAACTGG - Intergenic
1009488953 6:64262910-64262932 TCTTTATTCTTCAGGAAAAAGGG + Intronic
1010452862 6:76022052-76022074 TTTTTGTTCTTTAGCAAAACAGG - Intronic
1011084314 6:83522385-83522407 TTTCTTTTCTTGAGGCTCACTGG - Intronic
1012071987 6:94633326-94633348 TTTCTCTTCTTAAAGAAAAGAGG - Intergenic
1012075824 6:94684333-94684355 TTTTTAAACTTGAGTAAAACAGG - Intergenic
1012139202 6:95600527-95600549 TTTCCATTCTTTAAAAAAACAGG - Intronic
1012141789 6:95634740-95634762 TTTCTGGACTGGAGGAAAACAGG - Intergenic
1012419000 6:99041640-99041662 TTTCTATATTTATGGAAAACTGG - Intergenic
1013178996 6:107702307-107702329 TTTCAAGTCTTGGAGAAAACTGG - Intergenic
1013752155 6:113419935-113419957 TTTCATTTCTTGACGAAAAGTGG + Intergenic
1014709645 6:124791767-124791789 TTTGTAGTCTTGGGTAAAACTGG - Intronic
1014788691 6:125646059-125646081 TTTGTATTCTTGAGGTATAGTGG - Intergenic
1015204149 6:130616093-130616115 TATCATTTTTTGAGGAAAACAGG + Intergenic
1015564579 6:134555030-134555052 TTACTATTATTGAGGGAAACGGG + Intergenic
1016248383 6:142015070-142015092 TTTTAGATCTTGAGGAAAACAGG - Intergenic
1016495314 6:144654920-144654942 TTTTTCTTCTTCAGGAAAATGGG - Intronic
1017209485 6:151838912-151838934 TTGCTATTTCTGAGGAAAATGGG + Intronic
1017619162 6:156277598-156277620 TAACAATTCTGGAGGAAAACAGG - Intergenic
1018702828 6:166440867-166440889 TGAGTATTCTTGGGGAAAACGGG + Intronic
1019002868 6:168770155-168770177 TTTCTCTTATTGCCGAAAACAGG - Intergenic
1019476103 7:1245153-1245175 TTACTATTGTTGTGGAAAATTGG + Intergenic
1020500492 7:8913400-8913422 TTTCAATTCTAGATCAAAACTGG - Intergenic
1020816139 7:12908403-12908425 ATTCTAAACTTCAGGAAAACTGG - Intergenic
1020842892 7:13243006-13243028 TTTCTGTACATTAGGAAAACAGG - Intergenic
1021795161 7:24247185-24247207 TTTCTATACTTGCTCAAAACTGG + Intergenic
1021830618 7:24604200-24604222 TTTCTTTTCTTGAAAGAAACAGG - Intronic
1022839761 7:34152278-34152300 TTCCTATTCTTGAGGAATGAGGG + Intronic
1022859093 7:34347479-34347501 TTTAAATACTAGAGGAAAACAGG + Intergenic
1023028135 7:36070545-36070567 TTTCTTTTCTTCAGCAAAATAGG + Intergenic
1023104871 7:36754017-36754039 TTTCTGTTTTTGATGAAAATTGG - Intergenic
1023668829 7:42554979-42555001 TTTCTCTTATTGCCGAAAACAGG + Intergenic
1024675009 7:51630459-51630481 TTTCTATTTTTGAGTACAAATGG - Intergenic
1024910443 7:54442133-54442155 TTCATATTCATGAGGAATACTGG + Intergenic
1027496677 7:78895814-78895836 TTTATAGTTTTGAGGAAAAAGGG + Intronic
1028570946 7:92286420-92286442 TTTATTTTCTAGAGGACAACTGG + Intronic
1028597067 7:92556933-92556955 AGTCTAATCTTGAGAAAAACAGG - Intergenic
1030088260 7:105835757-105835779 TTTCTATCCTTTAAGAAAATGGG - Intronic
1031073957 7:117194509-117194531 TACCTTTTCTTGAGGAAAATTGG + Intronic
1031404442 7:121367792-121367814 TTTCTATTTTTGTGGAAATGGGG - Intronic
1031508805 7:122623176-122623198 TTTGTATCCTTAAGAAAAACAGG + Intronic
1032311093 7:130787870-130787892 TGTATATTCTGGAGGAAAAAAGG + Intergenic
1032443085 7:131957273-131957295 AATCTATTTTTGAGGAAAAAAGG + Intergenic
1032737185 7:134703250-134703272 TTGTTATTATTGAGGAAGACAGG + Intergenic
1033572608 7:142647101-142647123 TTTCAATTCTGGCAGAAAACTGG - Intergenic
1034318297 7:150155062-150155084 TTTGTCTTCTTGAAGGAAACTGG - Intergenic
1034774456 7:153812170-153812192 TTTGTCTTCTTGAAGGAAACTGG + Intergenic
1035572877 8:685250-685272 TTTCTCTTATTGCCGAAAACGGG - Intronic
1036024769 8:4893858-4893880 TTTCTGTTTTTGGGGAAAAAAGG - Intronic
1036040858 8:5079510-5079532 TCTCTAACCTTGAGAAAAACTGG - Intergenic
1038161195 8:25040121-25040143 TATATATTCATGAGGAATACTGG + Intergenic
1039620682 8:38994882-38994904 TTTCTTTTCTCCAGGCAAACAGG - Intronic
1039954609 8:42197396-42197418 TGACTGTTCTTGGGGAAAACGGG + Intronic
1040455222 8:47591372-47591394 TTTCTATACTTCACGGAAACTGG - Intronic
1041224988 8:55689301-55689323 TTTTTCTCCTTGAGGAATACAGG - Intergenic
1042557084 8:70042729-70042751 TCTCTATTCCTGATGATAACAGG - Intergenic
1044055351 8:87562942-87562964 ATGCTATCATTGAGGAAAACGGG - Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1044533605 8:93335767-93335789 TTTCTAGTCTTGATCAAATCCGG + Intergenic
1044961671 8:97537421-97537443 ATTCAATGCTTGAGCAAAACAGG + Intergenic
1045372026 8:101533948-101533970 CTTCTATTCTAAAGGAAAAGGGG + Intronic
1046156914 8:110304083-110304105 TATCTAGCTTTGAGGAAAACTGG + Intergenic
1046229047 8:111329229-111329251 TTTCTATTCTAAAGGAGAATGGG + Intergenic
1047164252 8:122419377-122419399 TTTATATTGCTGAGGAAAATGGG - Intergenic
1047371537 8:124260082-124260104 TTTCTATGTTTGGGGAAAAAGGG + Intergenic
1047450511 8:124961309-124961331 TTTGTTTTCTGGAGGAAGACTGG + Intergenic
1048157623 8:131974447-131974469 TTCCTAGTCTTGCAGAAAACTGG - Intronic
1048356563 8:133658511-133658533 TTTCTGTTTTTGAGGAAATGAGG + Intergenic
1050085765 9:1964206-1964228 TTTCTTTGCTTGAGAAAAACAGG - Intergenic
1051586708 9:18734326-18734348 TGTCTTTTCTTCAGGAAAAAAGG - Intronic
1055348990 9:75365686-75365708 TTTAAACTTTTGAGGAAAACAGG + Intergenic
1055379722 9:75693065-75693087 TCTCTATTCTTGATAAAAACAGG - Intergenic
1055581884 9:77714484-77714506 TTTGCATTCTTGAGGAAAACAGG + Intergenic
1055656086 9:78451686-78451708 TTTCTTTTCTTGTGAAGAACAGG - Intergenic
1055843945 9:80538433-80538455 TTTTTATTCTTGATAAATACAGG - Intergenic
1056709828 9:88982929-88982951 TCTATATTTTTGAGGAATACTGG + Intergenic
1057770584 9:97964242-97964264 TTTCTATTGTTAGAGAAAACAGG - Intergenic
1057849731 9:98556120-98556142 TTTCTCTGGCTGAGGAAAACAGG + Intronic
1058253288 9:102729297-102729319 TTTCTCTTGTTGCCGAAAACAGG - Intergenic
1058416545 9:104794713-104794735 ATTCTATTCTTTAGAAAATCTGG + Intronic
1058424461 9:104864381-104864403 TTTCTGTTCTTGGGAGAAACAGG + Intronic
1058628657 9:106962471-106962493 TTTATATTTTTGAGGAATCCAGG - Intronic
1058853321 9:109034616-109034638 TTTATATTTTTGTGGAGAACGGG + Intronic
1060459590 9:123837706-123837728 TTCCTTTTCTTTAGGAAAAGAGG - Intronic
1060541874 9:124436471-124436493 GTTCTATTCTTGTGGCAAAAGGG - Intergenic
1061596453 9:131633072-131633094 TGTCTATTCTTGAAGAAATGTGG + Intronic
1188895671 X:35665564-35665586 CTTCTATTATTGAGGGGAACTGG - Intergenic
1189426172 X:40903087-40903109 TGTATATTCATGAGGAAAATTGG - Intergenic
1189974987 X:46451800-46451822 TTTATATTCTTAAGGGAAACTGG - Intronic
1190780697 X:53592227-53592249 TTTTTTCTCCTGAGGAAAACTGG - Intronic
1190951059 X:55143285-55143307 TCTCAGATCTTGAGGAAAACTGG + Intronic
1193850849 X:86535889-86535911 TCTCAGATCTTGAGGAAAACCGG + Intronic
1193941017 X:87681129-87681151 TCTCAGATCTTGAGGAAAACCGG - Intergenic
1195384309 X:104299283-104299305 TTGATATTCTTGAGTAAAACGGG + Intergenic
1196542888 X:116930418-116930440 TCTCAGATCTTGAGGAAAACTGG + Intergenic
1197252526 X:124230331-124230353 TTTGCATTGTTAAGGAAAACTGG + Intronic
1199010881 X:142757349-142757371 TGTCTATTCTTGCGGAAATAAGG + Intergenic
1199123906 X:144091344-144091366 TTTTAGATCTTGAGGAAAACCGG + Intergenic
1199763560 X:150924385-150924407 TTTCATATCTGGAGGAAAACAGG + Intergenic
1199825989 X:151499966-151499988 TTTATGTTCATGAGGAATACTGG - Intergenic
1199838412 X:151617702-151617724 TTTCTGTTCCTGATGCAAACTGG + Intronic
1200363979 X:155641657-155641679 TATCAGATCTTGAGGAAAACCGG + Intronic
1200492804 Y:3849426-3849448 TATCTATATTTGAGGAATACTGG + Intergenic
1201360540 Y:13143270-13143292 TTAATATTCTTGATGAATACTGG + Intergenic
1201639474 Y:16164114-16164136 TTTTAGATCTTGAGGAAAACTGG + Intergenic
1201663339 Y:16421210-16421232 TTTTAGATCTTGAGGAAAACTGG - Intergenic