ID: 955319402

View in Genome Browser
Species Human (GRCh38)
Location 3:57963686-57963708
Sequence AACTGTCCCCAAAGAGAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955319400_955319402 7 Left 955319400 3:57963656-57963678 CCATTTATTGAGCATACACTCTG No data
Right 955319402 3:57963686-57963708 AACTGTCCCCAAAGAGAACTAGG No data
955319399_955319402 26 Left 955319399 3:57963637-57963659 CCTTTGTTTGTTAACACTTCCAT No data
Right 955319402 3:57963686-57963708 AACTGTCCCCAAAGAGAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955319402 Original CRISPR AACTGTCCCCAAAGAGAACT AGG Intergenic
No off target data available for this crispr