ID: 955325780

View in Genome Browser
Species Human (GRCh38)
Location 3:58008557-58008579
Sequence CTCGGTTACCGGCATCCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955325780_955325784 -7 Left 955325780 3:58008557-58008579 CCACCAGGATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325780_955325786 4 Left 955325780 3:58008557-58008579 CCACCAGGATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955325780 Original CRISPR CTCGGTTACCGGCATCCTGG TGG (reversed) Exonic
913088632 1:115460918-115460940 CTCTGTCACCAGCTTCCTGGGGG + Intergenic
917045392 1:170853921-170853943 CTCTGTTCCTGGCATCTTGGTGG - Intergenic
1062856293 10:781075-781097 CGTGGTCACCTGCATCCTGGTGG - Intergenic
1078974470 11:16456399-16456421 CATGTTTACCAGCATCCTGGAGG + Intronic
1084342262 11:68513150-68513172 CCTCGTTACCGGCATCCCGGGGG + Intronic
1084752964 11:71215937-71215959 CTTGGTTATCTTCATCCTGGAGG - Intronic
1096474603 12:51900557-51900579 CTTGGTCACTGGCATCCTGGTGG - Intergenic
1102922811 12:116805294-116805316 GTCTGTTACAGGCATCCTAGAGG - Intronic
1104835156 12:131785332-131785354 CTCAGACCCCGGCATCCTGGAGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1122468076 14:101947999-101948021 CTCGGCTCCAGGTATCCTGGAGG - Intergenic
1132907042 16:2288007-2288029 CTCGGTAAGGGGCATCCCGGGGG - Exonic
1134112170 16:11522470-11522492 CTGGGTTACTGGCATCTTGTGGG - Intronic
1139542764 16:67630877-67630899 CTAGGTTGCTGGCATCCAGGTGG + Intronic
1142841274 17:2632830-2632852 CTCGGATACCAAAATCCTGGAGG + Intronic
1143367857 17:6420190-6420212 CTCTGCTCCCTGCATCCTGGTGG + Intronic
1153265291 18:3262775-3262797 CTCGGTTACCGGCATGCTAATGG - Exonic
1156501350 18:37561185-37561207 CTACTTTACCGGCAGCCTGGGGG - Intronic
1158362052 18:56685975-56685997 CTCGGTGACTGGCATCCTGAAGG + Exonic
1159471852 18:68867456-68867478 CTCTGTGGCCTGCATCCTGGGGG + Intronic
1160525026 18:79530764-79530786 CTCGGTGACCGAAATCCTGGGGG + Intergenic
1162861813 19:13511499-13511521 CACGGTTTGGGGCATCCTGGAGG - Intronic
947215248 2:227744242-227744264 CACGGACACCGACATCCTGGGGG + Intergenic
952869552 3:37886233-37886255 CTAGGTTACAGGCACCCTTGAGG - Intronic
954735644 3:52705145-52705167 CTCCGTTACCGTCAGCCAGGTGG - Intronic
955325780 3:58008557-58008579 CTCGGTTACCGGCATCCTGGTGG - Exonic
962389198 3:134957483-134957505 CTCGGATACCTTCCTCCTGGTGG - Intronic
963843580 3:150132527-150132549 CTAGGTTACGGGCATCTTGAAGG - Intergenic
971393548 4:26207855-26207877 CTCGGTTCCTGGCCTCCTGACGG - Intronic
989120960 5:38004084-38004106 CTCGGTTGCGGGCATGATGGAGG + Intergenic
998322779 5:141247630-141247652 CTCGCTTACCGTCTACCTGGTGG + Exonic
999329215 5:150661423-150661445 CTCAGGTACCAGCATCCTAGGGG + Intronic
1015914113 6:138197758-138197780 CACGGTGACTGGCATGCTGGAGG + Intronic
1017146510 6:151240242-151240264 CTCTGGTCCCGGCAGCCTGGGGG + Intronic
1018963055 6:168462389-168462411 ATCGTTTCCCGGCATCCTGCTGG + Intronic
1032394678 7:131581126-131581148 CTTTGTTGCTGGCATCCTGGGGG - Intergenic
1035268445 7:157705467-157705489 CTCAGTTCCTGGCATTCTGGGGG - Intronic
1035268543 7:157705988-157706010 CTCAGTTCCTGGCATTCTGGAGG - Intronic
1035268556 7:157706054-157706076 CTCAGTTCCCGGCATTCTAGGGG - Intronic
1035268640 7:157706510-157706532 CTCAGTTCCCGGCATTCTAGAGG - Intronic
1035268710 7:157706903-157706925 CTCAGTTCCCGGCATTCTGGAGG - Intronic
1053466974 9:38315866-38315888 CTCGTTGACTGGCAGCCTGGTGG - Intergenic
1054452307 9:65409785-65409807 CTGGGTCACAGGCATCCTGTGGG - Intergenic
1061032624 9:128095227-128095249 CTGGCTTACCGGCATCCTTTGGG + Intronic
1061498536 9:130989592-130989614 CTCGATTGCAGGAATCCTGGAGG + Intergenic
1061841571 9:133361399-133361421 CTCGCTCACTGGCATCCTGAGGG + Intergenic
1062352481 9:136145852-136145874 CTGGCTTCCCGGCACCCTGGGGG + Intergenic
1186470333 X:9816518-9816540 CCTGGTCACCGGCATCCTTGTGG + Intronic
1187202418 X:17147849-17147871 CTTGGTTACAAGCATCCTGAAGG - Exonic
1190319723 X:49172795-49172817 CTAGGTTACGGGCAGCCTGAGGG - Intronic
1192558620 X:72110047-72110069 CTCTGTTCCCGGCATCCTTGGGG - Intergenic