ID: 955325780

View in Genome Browser
Species Human (GRCh38)
Location 3:58008557-58008579
Sequence CTCGGTTACCGGCATCCTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955325780_955325784 -7 Left 955325780 3:58008557-58008579 CCACCAGGATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325780_955325786 4 Left 955325780 3:58008557-58008579 CCACCAGGATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955325780 Original CRISPR CTCGGTTACCGGCATCCTGG TGG (reversed) Exonic