ID: 955325784

View in Genome Browser
Species Human (GRCh38)
Location 3:58008573-58008595
Sequence AACCGAGAAGGATCTAGCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955325774_955325784 25 Left 955325774 3:58008525-58008547 CCGGCAGCTCGTTGCGCATTGCG 0: 1
1: 0
2: 0
3: 1
4: 18
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325780_955325784 -7 Left 955325780 3:58008557-58008579 CCACCAGGATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325773_955325784 26 Left 955325773 3:58008524-58008546 CCCGGCAGCTCGTTGCGCATTGC 0: 1
1: 1
2: 0
3: 1
4: 25
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325781_955325784 -10 Left 955325781 3:58008560-58008582 CCAGGATGCCGGTAACCGAGAAG 0: 1
1: 0
2: 0
3: 4
4: 31
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325778_955325784 -3 Left 955325778 3:58008553-58008575 CCCGCCACCAGGATGCCGGTAAC 0: 1
1: 0
2: 1
3: 5
4: 66
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325779_955325784 -4 Left 955325779 3:58008554-58008576 CCGCCACCAGGATGCCGGTAACC 0: 1
1: 0
2: 2
3: 3
4: 75
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325772_955325784 27 Left 955325772 3:58008523-58008545 CCCCGGCAGCTCGTTGCGCATTG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74
955325777_955325784 -2 Left 955325777 3:58008552-58008574 CCCCGCCACCAGGATGCCGGTAA 0: 1
1: 0
2: 1
3: 3
4: 49
Right 955325784 3:58008573-58008595 AACCGAGAAGGATCTAGCTGAGG 0: 1
1: 0
2: 1
3: 2
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955325784 Original CRISPR AACCGAGAAGGATCTAGCTG AGG Exonic