ID: 955325786

View in Genome Browser
Species Human (GRCh38)
Location 3:58008584-58008606
Sequence ATCTAGCTGAGGACGCGCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955325779_955325786 7 Left 955325779 3:58008554-58008576 CCGCCACCAGGATGCCGGTAACC 0: 1
1: 0
2: 2
3: 3
4: 75
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
955325777_955325786 9 Left 955325777 3:58008552-58008574 CCCCGCCACCAGGATGCCGGTAA 0: 1
1: 0
2: 1
3: 3
4: 49
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
955325783_955325786 -7 Left 955325783 3:58008568-58008590 CCGGTAACCGAGAAGGATCTAGC 0: 1
1: 0
2: 0
3: 1
4: 42
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
955325781_955325786 1 Left 955325781 3:58008560-58008582 CCAGGATGCCGGTAACCGAGAAG 0: 1
1: 0
2: 0
3: 4
4: 31
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
955325780_955325786 4 Left 955325780 3:58008557-58008579 CCACCAGGATGCCGGTAACCGAG 0: 1
1: 0
2: 0
3: 6
4: 44
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
955325778_955325786 8 Left 955325778 3:58008553-58008575 CCCGCCACCAGGATGCCGGTAAC 0: 1
1: 0
2: 1
3: 5
4: 66
Right 955325786 3:58008584-58008606 ATCTAGCTGAGGACGCGCCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955325786 Original CRISPR ATCTAGCTGAGGACGCGCCT TGG Exonic