ID: 955331205

View in Genome Browser
Species Human (GRCh38)
Location 3:58049245-58049267
Sequence GGCCATCCCCGAGAAGGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955331205_955331214 23 Left 955331205 3:58049245-58049267 CCACCGCCTTCTCGGGGATGGCC 0: 1
1: 0
2: 2
3: 5
4: 100
Right 955331214 3:58049291-58049313 GGTGTTTGCAGCTGCGAGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 159
955331205_955331215 29 Left 955331205 3:58049245-58049267 CCACCGCCTTCTCGGGGATGGCC 0: 1
1: 0
2: 2
3: 5
4: 100
Right 955331215 3:58049297-58049319 TGCAGCTGCGAGAAGGGCCTTGG 0: 1
1: 0
2: 0
3: 22
4: 238
955331205_955331213 22 Left 955331205 3:58049245-58049267 CCACCGCCTTCTCGGGGATGGCC 0: 1
1: 0
2: 2
3: 5
4: 100
Right 955331213 3:58049290-58049312 TGGTGTTTGCAGCTGCGAGAAGG 0: 1
1: 0
2: 0
3: 9
4: 168
955331205_955331209 -1 Left 955331205 3:58049245-58049267 CCACCGCCTTCTCGGGGATGGCC 0: 1
1: 0
2: 2
3: 5
4: 100
Right 955331209 3:58049267-58049289 CACCATTTGTGTTTGCTGCCTGG 0: 1
1: 0
2: 0
3: 20
4: 165
955331205_955331211 2 Left 955331205 3:58049245-58049267 CCACCGCCTTCTCGGGGATGGCC 0: 1
1: 0
2: 2
3: 5
4: 100
Right 955331211 3:58049270-58049292 CATTTGTGTTTGCTGCCTGGTGG 0: 1
1: 0
2: 0
3: 21
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955331205 Original CRISPR GGCCATCCCCGAGAAGGCGG TGG (reversed) Intronic
900129888 1:1082911-1082933 GGCCTCCCCCGGGAAGGCAGCGG + Exonic
900792431 1:4689392-4689414 GCCCACCCACGAGGAGGCGGAGG + Intronic
901519874 1:9775333-9775355 GGCCATCACCGAGAGGAGGGTGG - Intronic
902579103 1:17397161-17397183 GGCCATCCCCAAGAAAGAGCTGG + Intronic
904617241 1:31756482-31756504 GCCTAGCCCCGAGGAGGCGGTGG - Exonic
905270249 1:36782944-36782966 GGCCATTCCCCACAAGGCAGGGG + Intergenic
906057645 1:42929275-42929297 GAGCATCTTCGAGAAGGCGGGGG - Exonic
912427868 1:109610550-109610572 GGCCATCTCCTGGAAGGCTGAGG - Exonic
914050774 1:144128260-144128282 GGCCCTCCTCAAGAAGGTGGAGG + Intergenic
914128407 1:144837184-144837206 GGCCCTCCTCAAGAAGGTGGAGG - Intergenic
915146662 1:153799693-153799715 GGCCATCTGCAAGAAGGCGTTGG - Intergenic
919640306 1:200039540-200039562 CGGCAGCCCCGAGGAGGCGGAGG + Intronic
920366085 1:205449106-205449128 AGCCATCCCTGACAAGGCTGTGG + Intronic
921180310 1:212626566-212626588 GGCCATCGCCGAGACAGCAGAGG + Exonic
1063212428 10:3893026-3893048 AGCCATCCCCGAGACGGCAGGGG - Intergenic
1063220159 10:3959871-3959893 GGCTGTCCCCGTGCAGGCGGAGG + Intergenic
1065482723 10:26211855-26211877 GGAGAGCCCCGAGAAGGAGGAGG + Exonic
1070052048 10:72898873-72898895 AGCCACCCCCTAGAAGGCGACGG + Exonic
1070521800 10:77260256-77260278 GGCCATCCCTGAATAGGGGGAGG + Intronic
1079128697 11:17735493-17735515 GGCCAGCCCCCAGGAGGGGGAGG - Exonic
1084032829 11:66491341-66491363 GCCCATCCTCCAGAAGGTGGTGG + Exonic
1096614129 12:52822110-52822132 GGCCATGCCAGAGAGGGCTGGGG + Intronic
1106132311 13:26950723-26950745 TGCCAGCCCCGAGAAGGCTCTGG + Intergenic
1110596575 13:77326722-77326744 GCCGAGCCCCGAGGAGGCGGCGG + Intronic
1114430134 14:22653695-22653717 GGCCATCCAAGGGAAGGCCGGGG - Intergenic
1115312675 14:31995275-31995297 GAGCATCCCAGAGAAGGAGGAGG + Intergenic
1117898053 14:60508105-60508127 GGGCATCCACGACAATGCGGGGG - Intronic
1122598807 14:102910666-102910688 TGCCAGCCCCGAGACGGCCGAGG - Exonic
1124625739 15:31306618-31306640 GGCCCTCCCGGGAAAGGCGGTGG - Intergenic
1126764717 15:52000714-52000736 GGGAATCTCCCAGAAGGCGGAGG + Intronic
1129742632 15:77997164-77997186 GGCCATCCCCAAGGAGGCCATGG + Exonic
1129842841 15:78754282-78754304 GGCCATCCCCAAGGAGGCCATGG - Intergenic
1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG + Exonic
1132549797 16:549638-549660 GGCCCTCATCGAGAAGGCGCTGG + Exonic
1132785859 16:1656702-1656724 GGCTGTCCCTGAGACGGCGGAGG - Exonic
1132865705 16:2091745-2091767 GGCCACCCCGGAGAGGGCAGGGG + Intronic
1136449257 16:30343401-30343423 GGGCTTCGCGGAGAAGGCGGAGG + Intergenic
1136684746 16:31987512-31987534 GGCCATCCAAAAGAAGGCTGTGG + Intergenic
1136785362 16:32931047-32931069 GGCCATCCAAAAGAAGGCTGTGG + Intergenic
1143114802 17:4576430-4576452 GGGCTTCCCGGAGAAGGGGGTGG + Intergenic
1148698828 17:49576368-49576390 CGCCATCCCCGGGATGTCGGGGG - Intronic
1151576096 17:74953288-74953310 GGCCAGCTCAGATAAGGCGGAGG + Intronic
1158601995 18:58863732-58863754 GGCCAACCCCGGGAAGGGGGTGG + Intronic
1160518826 18:79493044-79493066 GGCCATGCTCGAGAAGTCTGAGG - Intronic
1160765668 19:806448-806470 GGCCATCCCCTCGGCGGCGGCGG + Exonic
1161478621 19:4499667-4499689 GGCCCCCCAGGAGAAGGCGGAGG + Exonic
1162565849 19:11445616-11445638 GGCCATCCACGAGTAAGAGGCGG - Intronic
1162916627 19:13877735-13877757 GGCCACCGCCGAGGAGGAGGAGG + Exonic
1163665839 19:18603861-18603883 GGCCAGAGCCGAGGAGGCGGGGG + Intronic
1165420536 19:35719993-35720015 GGCCGTCCCCGAGACCGCCGGGG - Exonic
1165754762 19:38286412-38286434 GGCCAGGCCCGAGGATGCGGAGG + Intronic
1166073387 19:40399236-40399258 GGATGTCCCTGAGAAGGCGGTGG - Intronic
1202690182 1_KI270712v1_random:80899-80921 GGCCCTCCTCAAGAAGGTGGAGG + Intergenic
926292357 2:11541171-11541193 GGCCATCTCCCAGAAGGAGATGG + Intronic
927181150 2:20447471-20447493 GGCCATCCGCAAGAAGCTGGTGG + Exonic
927602290 2:24454621-24454643 GGCCAGTCCCCAGAAGGCTGAGG + Intergenic
934560702 2:95311854-95311876 CCCCATCCCCGAGAAGTTGGGGG - Intronic
946159649 2:217828357-217828379 GGCCATCCCCGCTTAGGGGGTGG + Intronic
1171168996 20:22998865-22998887 GCCCATTCCCGAGAAGCCGTGGG + Intergenic
1174780772 20:53386739-53386761 GGCCTGCTCCCAGAAGGCGGCGG + Intronic
1175199162 20:57266293-57266315 GGCCAGCACCGAGCAGGGGGCGG - Exonic
1176146167 20:63566503-63566525 GGCCACCCCCGACAAGGAGAGGG + Intronic
1176146187 20:63566572-63566594 GGCCACCCCCGACAAGGAGAGGG + Intronic
1176146206 20:63566641-63566663 GGCCACCCCCGACAAGGAGACGG + Intronic
1179461453 21:41538210-41538232 AGCCATCCCCGAGCAGACAGGGG + Intergenic
1179912375 21:44456958-44456980 GGCCAGGCCCGCGAAGGTGGCGG - Exonic
1180961694 22:19765276-19765298 GGCCAGCCTCGAGAGGGAGGGGG - Intronic
954437443 3:50503534-50503556 GCCCCTCGCGGAGAAGGCGGCGG - Intronic
954801425 3:53189231-53189253 GGACATCCTGGAGAAGGTGGAGG + Exonic
955239332 3:57165340-57165362 GGCCAGCCCCGAGTGGGCGGTGG + Exonic
955331205 3:58049245-58049267 GGCCATCCCCGAGAAGGCGGTGG - Intronic
955368813 3:58333210-58333232 GGCCCTGGCCGAGAAGGCTGTGG + Intronic
956410512 3:68973845-68973867 GGCCATCCCAGAGAGGGGTGGGG - Intergenic
959449956 3:106486866-106486888 GGCCACCTCCAAGATGGCGGTGG + Intergenic
962881933 3:139586543-139586565 TGCCATCCCCTTGAAGGAGGGGG - Intronic
963222493 3:142827182-142827204 GGTCATCTCTGAGATGGCGGAGG + Intronic
968334395 3:197900852-197900874 GGCCCTCCCCTACAAGGCAGTGG - Intronic
968573205 4:1353263-1353285 GGCCACCCCAGAGCGGGCGGCGG + Exonic
968810786 4:2798870-2798892 GCCCTGCCCAGAGAAGGCGGAGG - Intronic
969568163 4:7992448-7992470 GGGCATCCCCGAGAAGGAGGTGG + Intronic
985087611 4:186329524-186329546 GGCCATCTCCAAGATGGCGGTGG - Intergenic
992591101 5:78295903-78295925 GGCCGCCCCAGGGAAGGCGGTGG + Intergenic
999326935 5:150649592-150649614 GGCCAGCCCCGCGGCGGCGGAGG + Exonic
1006271612 6:32970354-32970376 GGCAAACCCCGGGAGGGCGGGGG - Intronic
1007089424 6:39172924-39172946 GGCCAGGCCCTAGAAGGCAGGGG + Intergenic
1012399825 6:98834291-98834313 GCCCATCCGAGAGAGGGCGGAGG + Intergenic
1016386055 6:143531888-143531910 GGTCATGCTAGAGAAGGCGGGGG + Intergenic
1026403918 7:70044426-70044448 GGCCATCCCAAAAAAGGCAGAGG - Intronic
1027228880 7:76260968-76260990 GGCCATCCCCCAGAGGCCGGAGG + Intronic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1035758421 8:2051362-2051384 GGCCATCCCCGAGAAGCTTCCGG - Intronic
1037809998 8:22081467-22081489 GGCCGTCCCGGAGCAGGTGGGGG - Exonic
1041648775 8:60281093-60281115 CGCCTTCCCCGAGAAGGAAGAGG - Exonic
1047572109 8:126110380-126110402 GCCCTTCCCAGAGAAGGGGGTGG - Intergenic
1049000392 8:139822332-139822354 GGCCATGCCTTAGAAGGCTGTGG - Intronic
1049690533 8:143957030-143957052 GGCAACCCCCAAGAAGGTGGAGG + Intronic
1049726425 8:144148458-144148480 GGCCCTCCCCGGGAGCGCGGTGG + Intronic
1055187775 9:73475798-73475820 GCCCATCCTCCAGAAGGTGGTGG - Intergenic
1055945521 9:81688699-81688721 GGCTTTCCCCGAGGCGGCGGCGG + Exonic
1057997078 9:99828480-99828502 GGCCTTCCCCCCGCAGGCGGGGG + Exonic
1061347862 9:130042100-130042122 GGCCGTCCCCGGAAAGGCGAGGG - Intronic
1203783846 EBV:116217-116239 GGCCTCCTCCGAGAAGGTGGTGG - Intergenic
1185560987 X:1060462-1060484 GGCCACTCCCAAGATGGCGGCGG - Intergenic
1185735104 X:2490185-2490207 GGCCATCCCTGAGAAGTACGGGG - Exonic
1191588168 X:62851423-62851445 GGACATCCCCAAAAAGGAGGTGG - Intergenic
1192657089 X:73003384-73003406 GGCCACCCCGGGGGAGGCGGAGG + Intergenic
1192665031 X:73079617-73079639 GGCCACCCCGGGGGAGGCGGAGG - Intergenic
1202195894 Y:22298002-22298024 GCCCGTCCCGGAGAAGGCCGGGG - Intergenic