ID: 955331582

View in Genome Browser
Species Human (GRCh38)
Location 3:58051696-58051718
Sequence AAGCTTTTTGATGTGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 4, 3: 122, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955331582 Original CRISPR AAGCTTTTTGATGTGTAGCC AGG Intronic
900729624 1:4246754-4246776 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
902913426 1:19619349-19619371 AAGCTTTATGATCTGTGGCATGG + Intronic
906198176 1:43942541-43942563 AAGCATTTTGAAGTGTAACAGGG - Intergenic
906267572 1:44444825-44444847 AAACATTTTTATGTGTATCCTGG + Intronic
906697760 1:47836162-47836184 CAGCTTTTTCATGTGAACCCAGG - Intronic
909173729 1:72327283-72327305 TAGCTTTTTGATGTGCTGCTGGG + Intergenic
910196518 1:84646206-84646228 AAGCTTTTTGATGAAAATCCTGG + Exonic
910644571 1:89499567-89499589 AAGCTGTTGGATCTGTACCCCGG + Intergenic
911359104 1:96855578-96855600 AAGCTTTTTGATGTGCTTGCTGG + Intergenic
911631535 1:100189092-100189114 AAGCTTTGTGAGGTGGAGGCGGG + Exonic
912886053 1:113475601-113475623 AAGCTTTTTCATGTGCTGCTGGG + Intronic
914967323 1:152271673-152271695 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
914969045 1:152290440-152290462 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
915003524 1:152615219-152615241 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
915011846 1:152694642-152694664 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
915852957 1:159347527-159347549 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
916905238 1:169276055-169276077 AAGCTTTTTGATGTGCTTGCTGG + Intronic
917009396 1:170454110-170454132 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
917503286 1:175605122-175605144 AATCTTTATGATGTGCAGCCTGG - Intronic
917634572 1:176922424-176922446 AAGCTTTTTGATAAGCAGCCTGG - Intronic
917793819 1:178517548-178517570 AATCGTTATGAGGTGTAGCCTGG - Intronic
918353420 1:183681544-183681566 AAGCTTTTTGATGTGCTGCTAGG + Intronic
918483557 1:185005165-185005187 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
918967893 1:191375156-191375178 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
919511958 1:198476137-198476159 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
920138614 1:203790959-203790981 AAAATTTTAGATGTGTGGCCAGG - Intergenic
921104611 1:211963608-211963630 AAGCTTTTTGATTTGTTGCTGGG - Intronic
921423686 1:214977875-214977897 AATTTTTTTCCTGTGTAGCCTGG - Intergenic
922981899 1:229834171-229834193 AAACTTTTAAGTGTGTAGCCAGG + Intergenic
924751863 1:246901146-246901168 GAGGTTTTTGCTGTGTTGCCTGG - Intronic
1063540280 10:6926608-6926630 AAGCCCTTTGCTGTGAAGCCAGG - Intergenic
1064170905 10:13032113-13032135 AAGCTTTTTGATGTGCTGCTGGG - Intronic
1064829189 10:19442688-19442710 AAGCTTTTTGATGTGCCGCTGGG + Intronic
1065814204 10:29469955-29469977 CAGCTTTTGGATGAGAAGCCTGG - Intronic
1066044419 10:31583367-31583389 AAGCTGTTGGATGTTTTGCCCGG - Intergenic
1068088723 10:52406875-52406897 TAGCTTTTTGATGTGTTGTTAGG + Intergenic
1068126485 10:52847631-52847653 AAGCTTCTTGATGTGCTGCTGGG + Intergenic
1070968689 10:80545831-80545853 AGGATTTTTGATGTGTAGTGGGG - Intronic
1072010594 10:91299660-91299682 GTGATTTTTAATGTGTAGCCAGG + Intergenic
1078787686 11:14511434-14511456 AATTTTTTTAATGTGTTGCCAGG - Intronic
1079585449 11:22121382-22121404 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1080018888 11:27537779-27537801 TAGCTTTTTGATGTGTTGCTGGG + Intergenic
1081710339 11:45212085-45212107 AAGCGGTTCGATGTGTAGACAGG + Intronic
1082634585 11:55580923-55580945 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1086753328 11:90527337-90527359 GAGTTTTTTGATGTGTAAGCAGG - Intergenic
1087047767 11:93857656-93857678 AATGATTTTGATGTGCAGCCAGG + Intergenic
1088791120 11:113227705-113227727 AAGCTTTTTGATGTGTTTGCTGG - Intronic
1089570312 11:119403626-119403648 ATGCTTTTGGATCTGAAGCCTGG + Intergenic
1091707204 12:2703261-2703283 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1093389778 12:18603892-18603914 ATTCTTTTTGATGTGTTTCCAGG - Intronic
1093408233 12:18832659-18832681 AAGCTTTTTGATGTGTTACTGGG - Intergenic
1096284010 12:50282811-50282833 AAGCTTTAGTATGTGTAGCCAGG + Intronic
1097763010 12:63490473-63490495 AAGCTTTTTGATGTGCTGCTTGG + Intergenic
1098667670 12:73184052-73184074 AAGCTTTTCGATGTGCTGCTTGG + Intergenic
1098770252 12:74542126-74542148 AAGCTTATAGATGTGTAACATGG + Exonic
1098861845 12:75719329-75719351 AAGCTTTTTAATGTGTAATTTGG - Intergenic
1099253384 12:80286242-80286264 AAGCTTTTTGATATGCTGCTGGG + Intronic
1099723373 12:86393371-86393393 AAGCTTTTTTATTTCTAGCTTGG + Intronic
1100555576 12:95689908-95689930 AAGCTCTTTGAAGTGGAGCATGG + Intronic
1101292843 12:103388936-103388958 AAGCTTGCTTATGTGGAGCCTGG - Intronic
1103921917 12:124403611-124403633 AAGCCTTTTAATGTGTACCAGGG + Intronic
1107091732 13:36488569-36488591 AAGCTTTTTGATGTACTGCTGGG + Intergenic
1107541094 13:41389782-41389804 ATGCTTTTTGAGGTTTAGTCTGG - Intergenic
1109317056 13:60762310-60762332 TAGCTTTTTGATGTGCTGCTGGG + Intergenic
1109489191 13:63073256-63073278 AAGCTATTTAATCTGTAGCATGG + Intergenic
1111145289 13:84170730-84170752 AAGCTCTCTGATGGGTAGGCAGG + Intergenic
1112069149 13:95828941-95828963 AAGCTTTTTGATGTGCTTCTGGG - Intronic
1113987187 13:114327592-114327614 AAGCATTCTGATGTGTAGCCAGG + Intergenic
1114141273 14:19913765-19913787 AAGCTTTTTGATGTGCTGCTAGG - Intergenic
1114158113 14:20130253-20130275 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1114631845 14:24164293-24164315 AAGCTTTTTGGAGTCTGGCCAGG - Intronic
1114686774 14:24540011-24540033 TAGTTTTTTGATGTGTTGCTAGG - Intergenic
1114964603 14:27941651-27941673 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1115752393 14:36505704-36505726 AAGCGTCTTGATGTGCACCCCGG + Intronic
1115838943 14:37444697-37444719 AAGCTTTTTGATGTGCTGCTGGG - Intronic
1116772770 14:49146348-49146370 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1119141968 14:72275492-72275514 AAGCTTTTGAATCTGTAGCCTGG - Intronic
1120137623 14:80888402-80888424 AAGCATTTTGATGTGCTGCTGGG - Intronic
1120842804 14:89101146-89101168 AAGCTTTGTGATGTGCTGCTGGG + Intergenic
1124035614 15:26051322-26051344 CTGCTTTTTGCTGGGTAGCCAGG - Intergenic
1124046194 15:26152384-26152406 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1129369670 15:75082954-75082976 TAGCTTTTTGAGGAGTTGCCAGG - Intronic
1129568941 15:76657689-76657711 TAGTTTTTTGATGTGTTGCTGGG - Intronic
1130971974 15:88740701-88740723 AAGCTGTTTGCTGAGTAGGCTGG - Intergenic
1132729431 16:1354039-1354061 AAGTTTTTTGTTGTGTGGCTGGG + Intronic
1133421772 16:5652630-5652652 AAGCTTCTGAATGTGAAGCCGGG - Intergenic
1133532032 16:6664204-6664226 AAGCTTTTTGCTGTGTCGCTTGG + Intronic
1134634459 16:15781659-15781681 AAACTTTTTGCTTTGGAGCCTGG + Intronic
1134915771 16:18069714-18069736 AACCATTCTAATGTGTAGCCAGG - Intergenic
1137830393 16:51538388-51538410 AAGCTGCTTGAGGTGTATCCTGG + Intergenic
1138837477 16:60456358-60456380 AAGCTTTTTGATATGCTGCTGGG + Intergenic
1139836517 16:69843140-69843162 AAGCATTTCTATGTGTATCCTGG - Intronic
1140772602 16:78218650-78218672 TAGATTTATGATGTGTAGCGTGG + Intronic
1141026115 16:80550243-80550265 AAGTGATTGGATGTGTAGCCAGG - Intronic
1141211048 16:81980045-81980067 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1141738756 16:85874945-85874967 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1144197346 17:12907274-12907296 GAGCTCTTTGATATTTAGCCTGG + Intronic
1146557239 17:33836476-33836498 AAGCTTTATGAAGAGTAGGCTGG - Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1151154211 17:72113493-72113515 AAGCATTTTGATATTTAGTCAGG - Intergenic
1152388387 17:79988804-79988826 AAGCATGGTGCTGTGTAGCCCGG + Intronic
1152467278 17:80473521-80473543 AAGCTCTGTGATGCGTGGCCAGG + Intronic
1153090670 18:1338971-1338993 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1153114932 18:1643552-1643574 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1153418965 18:4882886-4882908 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1154022237 18:10674431-10674453 AAGGTGTGTGATGTGGAGCCCGG + Intronic
1155120186 18:22810999-22811021 AAGCTTTTTGATGTGCTGCTGGG + Intronic
1155779678 18:29815195-29815217 TAGCTTTTTGATGTGCCGCTGGG - Intergenic
1156610878 18:38722711-38722733 GAGTTTGTTGATGGGTAGCCTGG + Intergenic
1156917662 18:42480665-42480687 CAGCTTTTTGATGTGGACACTGG + Intergenic
1157055725 18:44226235-44226257 AAGCTTTCTGATGTGCTGCTGGG + Intergenic
1157483091 18:48068460-48068482 GAGGTGTCTGATGTGTAGCCTGG - Intronic
1158235870 18:55313266-55313288 AAACATTTTGTTGTGAAGCCGGG + Intronic
1159041081 18:63323169-63323191 AAGCTTTTTGTTTGGTGGCCTGG - Intergenic
1160847476 19:1172970-1172992 AATCTCTTAAATGTGTAGCCGGG - Intronic
1164152531 19:22567453-22567475 AAGCTTAGTGATTTGTAGCATGG + Intergenic
1164360518 19:27503171-27503193 AATCTTTTTGATGTGTTGCTGGG - Intergenic
1164688979 19:30193590-30193612 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
927127821 2:20028964-20028986 TGGCTTTTTGATGTGTTGCTGGG - Intergenic
928702714 2:33915532-33915554 CAGCTTTTTGATCTGTCCCCAGG + Intergenic
929646794 2:43636718-43636740 GAGCTTTTTGAAGTGGAGACAGG + Intergenic
931860484 2:66349252-66349274 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
932013889 2:68004602-68004624 AAGTTTTTTGATGTGCTGCTGGG - Intergenic
932031145 2:68186118-68186140 AGGCTTTTTGATGTGTTACAAGG - Intronic
932596307 2:73095821-73095843 AGGGTCTGTGATGTGTAGCCAGG - Intronic
935472122 2:103473052-103473074 AAGCTTTTTGATGTGCTAGCTGG + Intergenic
935985110 2:108664996-108665018 ATCCTTTTTGATGGGTATCCTGG - Intronic
936036190 2:109114004-109114026 AAACTTTTTGATGTGCTGCTGGG + Intergenic
936137545 2:109908640-109908662 ATCCTTTTTGATGGGTATCCTGG - Intergenic
936207152 2:110462845-110462867 ATCCTTTTTGATGGGTATCCTGG + Intronic
936350023 2:111705534-111705556 TTGCTTTTGTATGTGTAGCCAGG - Intergenic
936808089 2:116361626-116361648 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
936831494 2:116653494-116653516 AAGCTTTGAGCTGTGCAGCCTGG - Intergenic
936910250 2:117583454-117583476 AAGCTTTTTGATGTGCTCCTGGG - Intergenic
937540907 2:122951850-122951872 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
937595019 2:123661865-123661887 AAGCTTTTTGTTGTCTGACCTGG - Intergenic
937679673 2:124630345-124630367 AAGCTATTTGATGTGCTGCTGGG - Intronic
939288257 2:140160536-140160558 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
940935170 2:159485250-159485272 AAGATTTTTCATTTGTTGCCTGG - Intronic
941973645 2:171380022-171380044 AAGCTTTTTGATGTGCTGCTGGG - Intronic
942581761 2:177426736-177426758 AAGCTTTTTGATGTATTGCTGGG + Intronic
943980424 2:194542578-194542600 AAGCTTTTTAATGTGCTGCTGGG - Intergenic
944956052 2:204810677-204810699 TAGCTTTTTGATGTGTTGCTGGG + Intronic
945016002 2:205517134-205517156 AAGCTTTTTGATGTGCTGCTGGG + Intronic
945847508 2:214964008-214964030 AAGCTTTTTGATGTGCAAACTGG - Intronic
945870774 2:215223941-215223963 AAGCTTCTTGATGTGCTGCTGGG - Intergenic
945873863 2:215256729-215256751 AAGCTTCTTGATGTGCTGCTGGG - Intergenic
947975280 2:234360573-234360595 TAGCTTTTTGATGTGCTGCTTGG + Intergenic
1169691869 20:8341107-8341129 AAGCTTTGTGATGTGTATATGGG - Intronic
1170265628 20:14463903-14463925 AAGCTTTTTGATGTGTCACTGGG + Intronic
1171397522 20:24846794-24846816 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1171509201 20:25667036-25667058 TATCTTTTTGATGTGTTGCTAGG + Intergenic
1171514269 20:25716023-25716045 AAGCTTTTTAATGTGCTGCTGGG + Intergenic
1171515345 20:25727745-25727767 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1171822822 20:29870278-29870300 TAGCCTTTTGATGTGTTGCTAGG - Intergenic
1178888734 21:36502876-36502898 AAGTGTTCTAATGTGTAGCCTGG - Intronic
1182256364 22:29041684-29041706 GTGGCTTTTGATGTGTAGCCAGG + Intronic
1184247641 22:43243738-43243760 CAGCTTCTGGATGTGTAGCATGG + Intronic
951747472 3:25995491-25995513 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
952000579 3:28781362-28781384 TTGCTTTTTGATGTGTAGCTTGG + Intergenic
952612648 3:35229570-35229592 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
952808141 3:37376792-37376814 TAGCTTTGGGATCTGTAGCCTGG - Intergenic
953287000 3:41620388-41620410 AAGCTTTTTGATGTGCTGCTGGG - Intronic
953891589 3:46755454-46755476 AAGCTTTTTGAAGTGGAAGCTGG - Intronic
955094943 3:55787933-55787955 GAGATTTTTGATGTGTACCCAGG + Intronic
955331582 3:58051696-58051718 AAGCTTTTTGATGTGTAGCCAGG + Intronic
958447918 3:94237696-94237718 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
959097081 3:101967760-101967782 AAGCTTTTGGATGTGCTGCTGGG + Intergenic
959114189 3:102156549-102156571 CAGCTTGTTGAGGTGTATCCAGG + Intronic
960407889 3:117284333-117284355 CAGCTTTTTGAATGGTAGCCTGG + Intergenic
960572584 3:119199635-119199657 TGGCGTTTTAATGTGTAGCCAGG - Intronic
962138473 3:132763011-132763033 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
962513825 3:136129786-136129808 AAGCTTTTTGATGTACTGCTGGG - Intronic
963050386 3:141137704-141137726 AAGCTTTTTGATGTTTTGCTGGG + Intronic
963413477 3:144962515-144962537 TAGCTTATTGATGTGTATCTTGG - Intergenic
964574220 3:158146498-158146520 AAGCTTTTTGATGTGCTGCTGGG + Intronic
965023288 3:163263720-163263742 TAGCTTTTTGATGTGCTGCAGGG + Intergenic
965413435 3:168362015-168362037 AAGCATTTTGATGTCTAGTATGG + Intergenic
966251410 3:177869397-177869419 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
966361951 3:179139330-179139352 TAGCTTTTTGATGTGCTGCTAGG - Intergenic
966561114 3:181321615-181321637 AAGCTTTTTGATGTGCTCCTGGG + Intergenic
967181140 3:186905881-186905903 AAGCTTTTTGATGTGCTGTTGGG + Intergenic
969126862 4:4956259-4956281 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
970107305 4:12599231-12599253 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
971107647 4:23544142-23544164 AAGCTTTTTGAGGTGTTAGCTGG - Intergenic
972317496 4:37940893-37940915 AAGCTTTTTGATGTGCGGCTGGG + Intronic
973284452 4:48399872-48399894 AAGCTTTTTGATGTGCTGCTGGG + Intronic
973544768 4:51969938-51969960 ACGCTTTTTGATGTGCTGCTGGG + Intergenic
973654656 4:53034085-53034107 AAGCTTTTTGATGTGCTGCTGGG - Intronic
974176977 4:58337083-58337105 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
974254448 4:59430995-59431017 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
974504161 4:62746625-62746647 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
974533626 4:63145881-63145903 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
974768407 4:66379070-66379092 AAGCTTTTTGATGTGCTTCTGGG - Intergenic
975402890 4:73957892-73957914 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
975490196 4:74979738-74979760 AAACTTTTTGATGTGCAGATGGG - Intronic
975860739 4:78673990-78674012 AATCTTTGTAATGTGTACCCCGG + Intergenic
975952668 4:79792796-79792818 AAGTTTTTTGATGTGATGCTGGG - Intergenic
976075087 4:81288933-81288955 AAGCTTAGTGATTTGTAGCATGG + Intergenic
976169794 4:82291473-82291495 TAGCTTTGTGAAGTGTAGCAAGG + Intergenic
977629782 4:99229495-99229517 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
978013081 4:103711264-103711286 AAGCTTTTTGATGTGCTGCTGGG - Intronic
978476922 4:109141302-109141324 AAGCTTTTTGATGTGCTGCTGGG + Intronic
979373610 4:119918248-119918270 AAACTTTTTGATGTGCTGCTGGG - Intergenic
983371494 4:166865055-166865077 AAGCTTTTTGATGTGCTGCTGGG - Intronic
985044506 4:185926755-185926777 AAGCTTTTTGATGTGGCACAAGG + Intronic
986896801 5:12381090-12381112 ATGCTTTTTGATGTGCTGCTGGG + Intergenic
986906902 5:12505517-12505539 AAGCTTTTTGATGTGCTGTTAGG + Intergenic
988332389 5:29858804-29858826 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
988432357 5:31134257-31134279 AGCCTTTTTGATGTGTACTCAGG + Intergenic
988867369 5:35350367-35350389 AAGCTTTGTGATGTGCTGCTGGG + Intergenic
989035652 5:37168984-37169006 AAACTATTTGATGTTAAGCCAGG - Exonic
989092407 5:37747042-37747064 AAGTTTTTTGATGTGCTGCTGGG - Intronic
989674898 5:43962315-43962337 ACGCTTTTTGATGTGCTGCTGGG + Intergenic
989676366 5:43978221-43978243 AAGCTTTTTGATGTGCCACTGGG + Intergenic
990369493 5:55102864-55102886 AAGCCTTATAATGTTTAGCCAGG + Intronic
990482492 5:56225105-56225127 AAGCTTTTTGATGTGCTGCTGGG - Intronic
990706763 5:58538524-58538546 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
990770306 5:59236504-59236526 TAGCTATTTGATGTGTTGTCAGG + Intronic
991346819 5:65677613-65677635 AAGCTTTTTGATGTGCTGCTTGG - Intronic
991651250 5:68856582-68856604 TAGCTTTTTGATGTGCTGCTGGG + Intergenic
993494321 5:88590379-88590401 AAGCTTTTTGAGGTGCTGCTGGG - Intergenic
993874980 5:93295873-93295895 AGTCTTATTGCTGTGTAGCCTGG - Intergenic
993911896 5:93693813-93693835 AAGCTTTTTGATGTGCTGCTGGG - Intronic
994378427 5:99041392-99041414 AAGTTTTTTGATGTGCTGCCAGG - Intergenic
995574012 5:113511067-113511089 AAGCTGATTAATGTGTAGACAGG + Intergenic
996076534 5:119201436-119201458 TAGCTTTTTGATGTGCTGCTGGG + Intronic
996462861 5:123767122-123767144 AATCTTTTTGATGTGCAAACTGG + Intergenic
997162349 5:131622345-131622367 AAGATTTTTGTCGTGTAGTCAGG - Intronic
997241269 5:132309813-132309835 AGGCTGTTAGATGTGGAGCCAGG - Intronic
999509220 5:152230508-152230530 AAGCTTTTTGAGGTTTGCCCTGG + Intergenic
999548342 5:152656336-152656358 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1000377436 5:160596164-160596186 AAGTTTTTTGATGTGCTGCTGGG - Intronic
1000669231 5:164039921-164039943 GAGGATTTTCATGTGTAGCCAGG + Intergenic
1003416538 6:5914224-5914246 AAGCTTTTTGATGTGCTGTTAGG + Intergenic
1004690915 6:17991338-17991360 AAGCATTTGGATTTGGAGCCAGG + Intergenic
1004991457 6:21142880-21142902 AAGATTGTTTATGTGTAGCAGGG + Intronic
1005982491 6:30847099-30847121 AAGCTCTTTGATGAAAAGCCAGG + Intergenic
1008854805 6:56070798-56070820 AATGTTTTTGATGTGTTGACAGG - Exonic
1008962955 6:57285394-57285416 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1010459282 6:76095579-76095601 TAACTTTTTGATGTGCTGCCAGG - Intergenic
1010997032 6:82545372-82545394 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1011283149 6:85697154-85697176 TAGCTTTTTGATGTGGTGCTGGG + Intergenic
1012017946 6:93876430-93876452 AAGTTTTTTTATGTGGAGGCTGG + Intergenic
1012253365 6:97004843-97004865 TAGCTTTTTGATGTGCTGCTGGG + Intronic
1012687154 6:102266346-102266368 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1012740169 6:103006643-103006665 AAGCTATTTGATGTGCTGCTGGG - Intergenic
1014013622 6:116504653-116504675 AAGCTTTTTGATGTGCTGCTGGG - Intronic
1014765351 6:125399852-125399874 AAGCTTTTTGATGTGCTGCTTGG - Intergenic
1016817450 6:148316376-148316398 AAGCTGTTTTCTGTGTAGACAGG + Intronic
1016985709 6:149894071-149894093 AAGCTTTTTGATGTAATGCTGGG + Intronic
1017086339 6:150716534-150716556 CAGCTTTTTGAGCTGTTGCCTGG + Intronic
1017197076 6:151713207-151713229 AAGCTTTTTGATGTGCTGCTGGG + Intronic
1017783752 6:157737020-157737042 AAGCTTTTTGATGTGCTGCTGGG + Intronic
1017968328 6:159286874-159286896 AAGCTTTTTGATGTGGTTGCTGG + Intergenic
1018464846 6:164034439-164034461 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1018570071 6:165200400-165200422 TAGCTTTTTGATGTGCTGCTGGG - Intergenic
1019753264 7:2747292-2747314 AAGCTTTTTGATGTGCTGCTGGG - Intronic
1021871476 7:25011250-25011272 AATTATTTTGATGTGAAGCCAGG - Intergenic
1024474648 7:49797852-49797874 TAGAATTTAGATGTGTAGCCTGG - Intronic
1024539326 7:50463264-50463286 CAGCTCTTTGATGTGTTCCCAGG + Exonic
1025114895 7:56249178-56249200 CAGCTTGTTGATGTGGAGCTGGG - Intergenic
1028395701 7:90366133-90366155 AAGCTTTTTGATGTGCTGCTGGG + Intronic
1028513211 7:91647997-91648019 AAGCTTTTTGATGTTCTGCTGGG - Intergenic
1029817382 7:103110356-103110378 AAGCTTTATGATGTGCTGCTGGG - Intronic
1030702664 7:112658610-112658632 AAGCTTTTTGATGTACTGCTGGG + Intergenic
1032726906 7:134598438-134598460 AAGCTTTTTGATGTGTTGCTGGG + Intergenic
1033271444 7:139936401-139936423 AGGCATTTTGATGTGTCACCTGG - Intronic
1036628549 8:10493707-10493729 AAGCTTTTTGATGTGTTGCTGGG + Intergenic
1037999168 8:23376308-23376330 AAGCTTTTTGATGTGCTGCTGGG + Intronic
1038091373 8:24256926-24256948 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1039348028 8:36729529-36729551 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1041741650 8:61163586-61163608 AAGCCTTTTGCTCTGTAACCTGG + Intronic
1042631067 8:70816744-70816766 TAACTTTTTGATGTGCTGCCGGG - Intergenic
1042798067 8:72686252-72686274 GAGCTTGTTGGAGTGTAGCCTGG + Intronic
1043308851 8:78832617-78832639 AAGTTTTATGATGTATAGCAAGG - Intergenic
1044801673 8:95963595-95963617 AAGCTTTTTGCTGTGTAAACAGG - Intergenic
1046162752 8:110388557-110388579 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1048118111 8:131547809-131547831 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1048686378 8:136909402-136909424 CAGCTTCTTGATCTGTCGCCAGG + Intergenic
1049056114 8:140238909-140238931 AAGCTTTTTGTTGCTTTGCCTGG - Intronic
1049579926 8:143406612-143406634 AAGCTTTTGGATGCGGACCCAGG - Intergenic
1050603826 9:7280054-7280076 AAGCTTTTTGATGTGCTGCTAGG + Intergenic
1051027927 9:12636283-12636305 AAGCGTCTTGATATGTTGCCAGG - Intergenic
1051045410 9:12867185-12867207 AAGCTTTCTGATGTGCTGCTGGG + Intergenic
1052386933 9:27833791-27833813 AAGCTTTATGATGTGCTGGCTGG + Intergenic
1052767278 9:32654158-32654180 TAGCTTTTTGATGTGTTTCTGGG - Intergenic
1053521351 9:38783124-38783146 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1054193516 9:62007117-62007139 AAGCTTTTTGATGCGCTGCTGGG - Intergenic
1054644892 9:67581574-67581596 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1055378242 9:75674820-75674842 AATCTTTTTGATGTGTTGTTGGG + Intergenic
1056016008 9:82388535-82388557 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1058313734 9:103537810-103537832 TAGCTTTTTGATGTGCTGCTTGG - Intergenic
1058492699 9:105519423-105519445 TAGCTTTTTGATGTGCTGCTGGG - Intronic
1058636468 9:107043139-107043161 ACACTTTTAGATGTGTGGCCAGG - Intergenic
1186523534 X:10227174-10227196 AAGCCTTTTGATATGCTGCCGGG - Intronic
1187596144 X:20774936-20774958 AAGCTTTTTGATGTGCTGTTGGG - Intergenic
1187644578 X:21333161-21333183 TAGCTTTTTGATTTGTTGCTGGG - Intergenic
1189081584 X:37978497-37978519 AAGCATTATGATGTGTGACCAGG - Intronic
1190599399 X:52074207-52074229 TAGCTTTTTGATGTGCAGCTAGG + Intergenic
1190604120 X:52122921-52122943 AAACTTTTTGATGTGCTGCTGGG - Intergenic
1190609425 X:52179866-52179888 TAGCTTTTTGATGTGCAGCTAGG - Intergenic
1190975885 X:55400294-55400316 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1191585606 X:62823355-62823377 AAGCTTTTAGATGTGCTGCTGGG - Intergenic
1191588625 X:62856557-62856579 AAGCTTATTGATGTGCTGCTGGG - Intergenic
1192242170 X:69341133-69341155 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1192974022 X:76264104-76264126 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1193004398 X:76599457-76599479 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1193171708 X:78344907-78344929 AAGCTTTCTGATGTGCTGCTGGG - Intergenic
1193225369 X:78976337-78976359 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1193327106 X:80191219-80191241 AAGCTTTTTGATGTGCTACTGGG - Intergenic
1193341601 X:80355206-80355228 AAGCACTTTGATGGGTAGCTGGG + Intronic
1193400592 X:81037326-81037348 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1193403013 X:81068280-81068302 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1193476278 X:81970454-81970476 AAGCTTTTGGATGTGGTGCTCGG + Intergenic
1193477573 X:81985363-81985385 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1193494999 X:82200227-82200249 AAGCTTTTTGATGTGTTGCTGGG + Intergenic
1193874774 X:86849090-86849112 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1193890222 X:87034928-87034950 AAGCTTTTTCATGTGCTGCTGGG + Intergenic
1194024251 X:88732022-88732044 ATACTTTTTGATGTGCTGCCGGG + Intergenic
1194358570 X:92918781-92918803 AAGCTGTTAGATGTGCAGCCTGG + Intergenic
1194406361 X:93500769-93500791 TAGCTTTTTGATGTGCTGCTCGG - Intergenic
1194789418 X:98128029-98128051 AAGCTTTTTGATGTGGTGCTGGG + Intergenic
1195125773 X:101808329-101808351 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1195313577 X:103656752-103656774 GAGCTTTTTTATGTGTCACCAGG + Intergenic
1196240398 X:113337320-113337342 TAGCTTTTTGATGTGCTGCTGGG + Intergenic
1196472063 X:116039756-116039778 CAGCTTCTTGATCTGTCGCCAGG - Intergenic
1196625867 X:117876368-117876390 AAGCTTTTTGATGTGCTGCTGGG + Intergenic
1196638828 X:118035364-118035386 AAGCTTTTTGATGTGCTGCTGGG - Intronic
1199479045 X:148277487-148277509 AAGCTTTTTGATGTACTGCTGGG - Intergenic
1199761600 X:150908519-150908541 CAGCTTTTTCATCTGTAGACTGG - Intergenic
1200156551 X:153979524-153979546 ATGCTTTTTGATGTATAACAGGG + Intronic
1200388141 X:155914731-155914753 AAGCTTTTTGATGTGCTGATGGG + Intronic
1200666748 Y:6034471-6034493 GAGCTGTTAGATGTGCAGCCTGG + Intergenic
1200858308 Y:7962823-7962845 AAGATTTTTGATGTATTGCAGGG - Intergenic
1201244620 Y:11990987-11991009 AAGCTTATTGATGTGCTGCTGGG + Intergenic
1201506330 Y:14704529-14704551 AAGCTTTTTGATGTGCTGCTGGG + Intronic
1201932218 Y:19363091-19363113 AAGCTTTTTGATGTGCTGCTGGG - Intergenic
1201991754 Y:20034709-20034731 AAGCTTTTTGATGTGCTGCTGGG - Intergenic