ID: 955335757

View in Genome Browser
Species Human (GRCh38)
Location 3:58084397-58084419
Sequence CACATTAACAACAGGGAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955335757_955335763 29 Left 955335757 3:58084397-58084419 CCGGCTTCCCTGTTGTTAATGTG 0: 1
1: 0
2: 3
3: 25
4: 196
Right 955335763 3:58084449-58084471 TAGAAAATGATCACTTGTTATGG 0: 1
1: 0
2: 1
3: 17
4: 237
955335757_955335761 -4 Left 955335757 3:58084397-58084419 CCGGCTTCCCTGTTGTTAATGTG 0: 1
1: 0
2: 3
3: 25
4: 196
Right 955335761 3:58084416-58084438 TGTGAGACGGTTTCCTTTCACGG 0: 1
1: 0
2: 1
3: 8
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955335757 Original CRISPR CACATTAACAACAGGGAAGC CGG (reversed) Intronic
900699010 1:4032420-4032442 CAAAATAAGAACACGGAAGCAGG - Intergenic
902799779 1:18821959-18821981 TGCATTAACAAAAGGGAGGCAGG - Intergenic
903225003 1:21889726-21889748 CACATTGACAATAGGTAATCAGG - Intronic
904204323 1:28843099-28843121 GAAATTACCAACAAGGAAGCAGG + Intronic
904390633 1:30183326-30183348 CAGATAATCAACAGAGAAGCAGG - Intergenic
904725149 1:32540986-32541008 ATCATTATCAACAGCGAAGCTGG - Intronic
907103052 1:51854621-51854643 AACAGTAACAACAGCCAAGCTGG + Intronic
907242170 1:53086838-53086860 CTCAATAACCACAGGGCAGCTGG - Intergenic
908391696 1:63689097-63689119 CACCTTACCATCTGGGAAGCTGG + Intergenic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
908833699 1:68207745-68207767 CACTTTTACAAAAGGGAAACTGG - Intronic
909141121 1:71866932-71866954 CACAATAACAAAAAGGAAGTAGG - Intronic
910532977 1:88261879-88261901 CACATATACAGCAGGGATGCTGG + Intergenic
911819392 1:102398069-102398091 CACATTAAAAAAAGGCAAGTAGG - Intergenic
912152993 1:106882289-106882311 CACCTTCTCCACAGGGAAGCAGG + Intergenic
912610303 1:111035551-111035573 TACACCAACAACAGGCAAGCAGG + Intergenic
917766586 1:178226415-178226437 CACAATAAAAACAGGGAAAATGG - Intronic
918297028 1:183166770-183166792 CACATCCAGAACAGAGAAGCTGG - Intergenic
920944146 1:210512344-210512366 CACACTAGCCAAAGGGAAGCAGG - Intronic
920977095 1:210796604-210796626 CACATGGATAACAGGGAAGCTGG - Intronic
921393041 1:214636435-214636457 CAGTTTAGCAGCAGGGAAGCAGG + Intronic
922151568 1:223009781-223009803 AACCTTAAGAACAGGCAAGCTGG - Intergenic
922174333 1:223184488-223184510 AACATTAATTACAAGGAAGCAGG + Intergenic
922515298 1:226203507-226203529 CACATCACCCACAGAGAAGCTGG - Intergenic
924260694 1:242227662-242227684 CACATAAAGAACAGTGAAGAGGG - Intronic
924542973 1:244998664-244998686 CACAAAATCAACAGGGAAGCTGG + Intronic
924636634 1:245793889-245793911 CACATTAATCAGAGGAAAGCTGG - Intronic
1064184578 10:13150427-13150449 CAGATTAATAAAAGGCAAGCCGG + Intergenic
1064573572 10:16721306-16721328 CACAATGCAAACAGGGAAGCAGG + Intronic
1068995566 10:63198838-63198860 TACATTAAAAACAGGAAAACAGG + Intronic
1070455044 10:76604930-76604952 CACATCAGCAACTGGGAAGGTGG - Intergenic
1071241552 10:83711398-83711420 CCCGTTAAAAACAGGTAAGCAGG + Intergenic
1072256162 10:93622389-93622411 GATATTAATAACAGGGAAACTGG - Intronic
1074500698 10:114021384-114021406 CACAATACCAACTGGCAAGCAGG + Intergenic
1074591392 10:114817059-114817081 CACAGAAACAAAAGGGAAGCTGG - Intergenic
1075443193 10:122495206-122495228 CACAGAAACAAGAGGGGAGCTGG - Intronic
1076323217 10:129599313-129599335 CACATTCAAAACATGGAAGGAGG + Intronic
1076807910 10:132868284-132868306 CAAATGAACAGCAGGGAACCAGG + Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1080185779 11:29483706-29483728 CATAATAACAAAAGGGAAGAAGG - Intergenic
1080347308 11:31339326-31339348 CACATTATCAATAAGGAAGCAGG + Intronic
1081673168 11:44953049-44953071 CTCCTTATCAACGGGGAAGCTGG + Intergenic
1083150523 11:60789119-60789141 CACATTTTCCACAGGGATGCAGG - Intronic
1086318353 11:85617010-85617032 CACCTTAACCCCAGGGAAGTGGG + Intronic
1087641038 11:100753791-100753813 CACATTACCACCGGGAAAGCTGG - Intronic
1088296873 11:108307824-108307846 CACATAAACAAGAAGGAAGAAGG + Intronic
1088620559 11:111678069-111678091 CACATAAAGAACAGGGAAGGAGG - Intronic
1089668509 11:120035491-120035513 CTCATAAACAAGAGGGGAGCAGG + Intergenic
1090206752 11:124888700-124888722 AACTTTCACAACAGAGAAGCTGG + Intronic
1090919368 11:131194535-131194557 CATTTTAACAAGAGAGAAGCGGG - Intergenic
1095276643 12:40292315-40292337 CACATAAACAACAAGAAAACTGG - Intronic
1096674360 12:53218643-53218665 AAATTTAACAACTGGGAAGCTGG - Intronic
1097581353 12:61460697-61460719 CATATTACCAAGAGGGAAACCGG + Intergenic
1097713428 12:62939136-62939158 GACATTAACATTAGGAAAGCTGG + Intergenic
1098202986 12:68076962-68076984 CACATTCAAAACAAGGAAGATGG + Intergenic
1100356771 12:93838420-93838442 CACATTAGCTACAGAGAAACTGG + Intronic
1100837700 12:98582835-98582857 AATGTTAACATCAGGGAAGCTGG + Intergenic
1101322800 12:103688012-103688034 CACATCAGCATCAGGGAGGCAGG + Intronic
1101644559 12:106618246-106618268 TAGATTAACAACAGTGAAGTTGG + Intronic
1104241490 12:126994247-126994269 CACCTTAAAAATAGGGAAGCCGG + Intergenic
1104994883 12:132648075-132648097 CACATTAACAACGGGGAGTTCGG + Intronic
1106820866 13:33463217-33463239 CACAGCAACAACAGGGATACTGG + Intergenic
1107014347 13:35696487-35696509 CACATTAAAAACATGGGAGTGGG - Intergenic
1107479511 13:40773778-40773800 TAGATTAAGAACAGGGTAGCTGG - Intergenic
1107773436 13:43812462-43812484 CACATAAAGCACAGGGAAGAAGG - Intergenic
1112102595 13:96206158-96206180 AACACCAACAACAGGCAAGCAGG + Intronic
1113802448 13:113093687-113093709 CACATGCACACCAGGGAAACAGG - Intronic
1116954973 14:50914000-50914022 CACTTTAATACCAGTGAAGCTGG - Intronic
1117172129 14:53111441-53111463 CACGTTAACTACAGGGAAGAAGG - Intronic
1121313322 14:92946747-92946769 CACATTACACACAGGGAAACCGG + Intronic
1124521236 15:30407965-30407987 CACATTAAAGAAAGAGAAGCAGG - Exonic
1125013023 15:34900666-34900688 AACATTATGACCAGGGAAGCTGG + Exonic
1125533835 15:40431282-40431304 CACATTAATAATAGTGGAGCCGG - Intronic
1126066018 15:44827046-44827068 CCCATTAACATCAGGGATTCTGG + Intergenic
1126093817 15:45073518-45073540 CCCATTAACATCAGGGATTCTGG - Exonic
1127491856 15:59472521-59472543 CACATAATCAACAGGGAAGCTGG - Intronic
1129012593 15:72435879-72435901 TACATTAACAATGAGGAAGCTGG - Intergenic
1130354688 15:83118549-83118571 CAAATTAAAATCAGAGAAGCAGG - Intronic
1130427058 15:83811976-83811998 CAGATTATCAACACTGAAGCTGG - Intronic
1131103362 15:89712259-89712281 AACATTAATATTAGGGAAGCTGG - Intronic
1134837958 16:17377570-17377592 CACATTCCCATCAGGAAAGCTGG + Intronic
1135389975 16:22083874-22083896 CACATTAACAACATAGAACATGG - Exonic
1141061870 16:80880887-80880909 CTCATTCACAATAGGGAAGGAGG + Intergenic
1141872007 16:86793534-86793556 CACATTTGCAAGAGGGAAGCAGG - Intergenic
1143459686 17:7094239-7094261 CCCATTAGGAACAGGGGAGCTGG - Intergenic
1145802863 17:27701251-27701273 CCCATTACCAACAGAAAAGCAGG - Intergenic
1146088755 17:29854996-29855018 AACAGTAACAACAGGGCAACAGG - Intronic
1146093377 17:29904847-29904869 TACACCAACAACAGGCAAGCAGG + Intronic
1146719521 17:35113970-35113992 CACATTAAAATCAGGGGAGTTGG + Intronic
1147278708 17:39339493-39339515 CACAGCTTCAACAGGGAAGCAGG - Intronic
1148906051 17:50912851-50912873 CACATTTAAAACAAGGAAACAGG + Intergenic
1156050095 18:32922253-32922275 CACATTAAAATCAGAGAGGCAGG + Intergenic
1157251158 18:46097545-46097567 CACTGTGACAACAGTGAAGCTGG - Intronic
1158336940 18:56422310-56422332 CACATTGACAACAAGGGAACAGG + Intergenic
1159735709 18:72094897-72094919 GACAGTAACAATAGGGAAACTGG - Intergenic
1159922177 18:74236492-74236514 CACACACACAGCAGGGAAGCAGG + Intergenic
1160044487 18:75373953-75373975 CACATTCACGACATGGAAGCAGG - Intergenic
1160966822 19:1750355-1750377 GTCAATAACAACAGGGAAGGTGG + Intergenic
1162215023 19:9126940-9126962 CTCATCAACAACATGAAAGCAGG - Exonic
1165279313 19:34783052-34783074 CACATTGACAACAGGCAGGCAGG + Intergenic
1165298851 19:34954377-34954399 CACATGCAAAACAGTGAAGCTGG + Intergenic
1166304853 19:41931885-41931907 CACAGGAACAAAAGGGAAGGTGG + Intergenic
1166350397 19:42195229-42195251 AACGTTAACAGCAGGGACGCTGG - Intronic
1166789925 19:45392615-45392637 CACATTACCGAAAGGGAATCTGG + Intronic
1167852346 19:52211728-52211750 CACATTAACCAGTGGGAAGGAGG - Intronic
1168010403 19:53526429-53526451 CACACTAACAACAGGTAAGGAGG - Intronic
925715703 2:6782522-6782544 CACATTTAGGACTGGGAAGCAGG + Intergenic
926161524 2:10493477-10493499 CCCTTTAACCACAAGGAAGCAGG + Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926894876 2:17674831-17674853 AACATTAGCCAAAGGGAAGCTGG - Intronic
927434859 2:23058255-23058277 CACTTTGACAACAGGTGAGCGGG + Intergenic
932748591 2:74356260-74356282 AACAATAACCACAGAGAAGCAGG + Intronic
934778490 2:96954031-96954053 CACATCAAGAACACGGATGCTGG + Intronic
935722356 2:105990623-105990645 CACATTGACCACATGGAAACTGG - Intergenic
939216840 2:139249500-139249522 TACACCAACAACAGGTAAGCAGG - Intergenic
940190164 2:151032298-151032320 CACAATAACAACAGAGGAGCCGG + Intronic
940241343 2:151566469-151566491 ATCATTAACAAAAGGGAACCTGG - Intronic
941295971 2:163737744-163737766 CAAATCTACAACAGAGAAGCTGG - Intergenic
942309149 2:174637948-174637970 CAAATTAATAACAGGTAAGGAGG - Intronic
942459283 2:176158478-176158500 CACAGCAACAAGAGGGAAGGAGG - Intronic
943274617 2:185851032-185851054 AACATAAAAAACAGGGATGCAGG + Intergenic
943281635 2:185942166-185942188 AATATTAAGACCAGGGAAGCAGG + Intergenic
943322790 2:186466201-186466223 AACATTTACAACATGGAAGCAGG - Intergenic
943663473 2:190584250-190584272 CACATTCACAATAGGGAATATGG + Intergenic
944507918 2:200432677-200432699 CCCATTAACAACACAGAAGTTGG + Intronic
948172538 2:235916618-235916640 CATTTTAAAAACAAGGAAGCTGG - Intronic
948627372 2:239277355-239277377 CTCATTACCAGAAGGGAAGCTGG + Intronic
1168890942 20:1295102-1295124 CACATTAACAGCAGGGACTGAGG - Intronic
1169046946 20:2540816-2540838 CACACTAGCAACATGGAAGAAGG - Intronic
1172292816 20:33788532-33788554 CTGATGAACAACAGGGAGGCTGG - Intronic
1176303405 21:5110628-5110650 CACATTAATCACAAGAAAGCTGG + Intergenic
1179824849 21:43957893-43957915 CACAGTTTCAGCAGGGAAGCCGG - Intronic
1179853628 21:44151322-44151344 CACATTAATCACAAGAAAGCTGG - Intergenic
1180247618 21:46558448-46558470 CACATTAACAACTGGGAAACTGG - Intronic
1181142979 22:20821066-20821088 TACATTAACATCTGGGATGCTGG + Intronic
1182744895 22:32597960-32597982 CACATGAACAACATGAAAGGGGG - Intronic
949773032 3:7599490-7599512 CACATTAACACCTGGGATGTGGG + Intronic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
950467514 3:13163869-13163891 CACTCTAAACACAGGGAAGCTGG + Intergenic
951107425 3:18761453-18761475 CACATCAGTAACAGGGAAGAAGG + Intergenic
951443834 3:22753826-22753848 AATATTAACAATAGGGAAACTGG + Intergenic
953576680 3:44118241-44118263 CTCCTTCACAACAGGGAAGTTGG + Intergenic
955335757 3:58084397-58084419 CACATTAACAACAGGGAAGCCGG - Intronic
956161078 3:66353115-66353137 CACCTTAAAACCAGGGAAGCAGG + Intronic
956963811 3:74434997-74435019 GAGAATAACAACAGGGAAGTTGG - Intronic
958542419 3:95495893-95495915 CACCTTAAGAACAGTGAAGGTGG - Intergenic
960027064 3:113021374-113021396 CACAGTAACAAAAAAGAAGCAGG + Intergenic
960424335 3:117487721-117487743 CACATAAATAACAAGGAAGGGGG - Intergenic
962849155 3:139295006-139295028 GACAGTAAACACAGGGAAGCCGG - Intronic
962853656 3:139326054-139326076 CACATTGACAACAGTGGAGGGGG + Intronic
963260455 3:143186813-143186835 CACATCATCAACAGAGAAGGAGG + Intergenic
964668522 3:159200279-159200301 CACTTTGTCAACAGGGAAACAGG - Intronic
965542704 3:169886188-169886210 AACATTTACAAAAGAGAAGCAGG + Intergenic
967620015 3:191621430-191621452 CAAAGTAACAACTGAGAAGCTGG + Intergenic
968709111 4:2099743-2099765 AACATTCATAACAGGGAAGCAGG + Intronic
968737295 4:2304034-2304056 AACATCAGAAACAGGGAAGCGGG + Intronic
970066904 4:12105477-12105499 CACATTAACAACAGTAATGGTGG + Intergenic
972016767 4:34256496-34256518 CACATTATAAAGAGGGAAGATGG + Intergenic
976941799 4:90711125-90711147 TATACTAACAACAGGCAAGCAGG - Intronic
978838313 4:113180203-113180225 CACATTAACAATGTGGATGCTGG + Intronic
981179798 4:141727251-141727273 GATATTAACAATAGGGAAACTGG + Intronic
981890224 4:149727680-149727702 CACATAAACAACCAGGAAGGGGG - Intergenic
982599413 4:157427428-157427450 CATGTTAATAACAGGGAAACTGG - Intergenic
985174589 4:187187784-187187806 CACATGTACAACTGGGGAGCTGG + Intergenic
986290685 5:6396829-6396851 CACATCAGCAGCAGGCAAGCAGG + Intergenic
986412554 5:7494936-7494958 CACATCCACAACATGGCAGCTGG - Intronic
987282768 5:16427271-16427293 ACCATTAAAAACAAGGAAGCTGG + Intergenic
990402638 5:55454619-55454641 GACATTAAGAACAGGGAAGCTGG + Intronic
990581724 5:57172954-57172976 CACTTTAACACCTGGGAAGTTGG - Intergenic
992916457 5:81458456-81458478 GACATTAACAATTGGGAATCTGG + Intronic
993869143 5:93230307-93230329 AACATTAACCAAAGGAAAGCAGG + Intergenic
994521596 5:100844698-100844720 CACATTCACCAGAGGCAAGCTGG - Intronic
999701556 5:154233222-154233244 CCCATTACCAACAGCCAAGCAGG - Intronic
1001797764 5:174516184-174516206 TACATATACAACAGGGAAGGGGG - Intergenic
1003544809 6:7051100-7051122 CGGATTGGCAACAGGGAAGCAGG - Intergenic
1004813383 6:19285540-19285562 GACACTAACAACAGGGTGGCAGG + Intergenic
1006502628 6:34468096-34468118 CAGGTCAACATCAGGGAAGCTGG + Intronic
1006704041 6:36001784-36001806 CATATTCACAACATGGCAGCTGG - Intronic
1008944360 6:57081211-57081233 AACAGTAACAACAAGAAAGCTGG - Intergenic
1010946738 6:81983342-81983364 CACATTAAGTAGAGGGCAGCTGG - Intergenic
1011519988 6:88194583-88194605 CACAATGACAGCAGGGAAGCTGG + Intergenic
1012181496 6:96159291-96159313 CCCATCAACAACAGGGATGCAGG + Intronic
1014301919 6:119692534-119692556 TACACCAACAACAGGCAAGCAGG - Intergenic
1014943397 6:127469802-127469824 CACAGGCACAACCGGGAAGCTGG + Intronic
1016218265 6:141630282-141630304 CACATTAACAAAATGAAAGATGG + Intergenic
1017118655 6:151003229-151003251 CACATTAAAAACAGAAAAGTTGG + Intronic
1019363382 7:617559-617581 CACACTAACATCAGGCCAGCTGG + Intronic
1021367286 7:19795512-19795534 CACATTAACAAAATGAAAGGGGG + Intergenic
1023236693 7:38097923-38097945 CACATCAAAAACAGGGAAAGAGG - Intergenic
1024706124 7:51962091-51962113 CCAATTAAAAACATGGAAGCAGG - Intergenic
1028671207 7:93402150-93402172 CTCATTAACAACTAGGAAGTGGG - Intergenic
1028951870 7:96645370-96645392 AACATTAGAAACAGGAAAGCGGG + Intronic
1030939816 7:115632073-115632095 CACATTAACCAATGGGGAGCAGG - Intergenic
1032626887 7:133601070-133601092 CATATAAACAAAGGGGAAGCTGG - Intronic
1032776599 7:135120511-135120533 CACATTACCCACAGGAAGGCAGG + Intronic
1033267174 7:139896338-139896360 CAAACTAACAAGAGGGCAGCCGG + Intronic
1033356880 7:140607352-140607374 CAAATGAACAAGAGGGAGGCTGG + Intronic
1038162511 8:25053383-25053405 CATATGATAAACAGGGAAGCGGG + Intergenic
1038932779 8:32213791-32213813 CAGCTTAACAAGAGAGAAGCAGG + Intronic
1041398719 8:57418962-57418984 CAGATTAAAAACAGGGAATCTGG - Intergenic
1042746067 8:72107361-72107383 CAGATAAGCAACAGAGAAGCAGG - Intronic
1042840017 8:73114164-73114186 CACATTCACCACCTGGAAGCTGG - Intronic
1045480135 8:102585237-102585259 CACAGTAACAGCAGAGAGGCTGG + Intergenic
1046093117 8:109526562-109526584 TAACTGAACAACAGGGAAGCTGG - Intronic
1046518902 8:115299727-115299749 CATATTATAAACAGGGAAGTAGG - Intergenic
1046729946 8:117713938-117713960 CAAATTAACAACATGGAAGAAGG + Intergenic
1048237112 8:132701656-132701678 CACTTTATCCAAAGGGAAGCAGG - Intronic
1050251816 9:3752826-3752848 CAGACTGACAACAGGGATGCTGG - Intergenic
1050735524 9:8758119-8758141 CACATTAAAATCAGAGATGCAGG + Intronic
1050809398 9:9725008-9725030 CACATTATCAAGAGGGAAACAGG + Intronic
1051857998 9:21591743-21591765 CACTTGCACAACAGGGAAACAGG - Intergenic
1051989416 9:23133566-23133588 CACATACACAACAGGCAAACTGG + Intergenic
1052345266 9:27403018-27403040 AACCTTCCCAACAGGGAAGCAGG + Intronic
1058512769 9:105737892-105737914 CACAGAAACAACTGGGATGCAGG + Intronic
1058642970 9:107105148-107105170 CACATTAACCAGGGGGAACCTGG + Intergenic
1059871570 9:118584120-118584142 TTCATTATCAACAGAGAAGCTGG - Intergenic
1059888498 9:118773869-118773891 CACATTATCAGCAAGTAAGCTGG + Intergenic
1059969746 9:119653406-119653428 AAGATGAACAACAGGAAAGCTGG + Intergenic
1186442439 X:9597812-9597834 CTCATTAACAACACTGGAGCTGG - Intronic
1188886310 X:35554544-35554566 TACATCAACAACAGGCAAGCTGG + Intergenic
1192546402 X:72018352-72018374 CACCTTAACAAGAGGGAAACTGG - Intergenic
1193508909 X:82375392-82375414 CACATTAACAGCGAGGAAGCAGG + Intergenic
1195584288 X:106546329-106546351 CTACTTAACAACAGGGAAACTGG - Intergenic
1196559588 X:117129300-117129322 TACATCAACAACAGACAAGCAGG + Intergenic
1197542348 X:127780102-127780124 TACACTAACAACAGTCAAGCTGG + Intergenic