ID: 955336249

View in Genome Browser
Species Human (GRCh38)
Location 3:58088657-58088679
Sequence CTGGACAGGGGAGCTTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955336249_955336259 9 Left 955336249 3:58088657-58088679 CCAACAAAAGCTCCCCTGTCCAG 0: 1
1: 1
2: 1
3: 12
4: 147
Right 955336259 3:58088689-58088711 CAGGAAAGGGCAGCCCAGTGAGG 0: 1
1: 1
2: 0
3: 54
4: 487
955336249_955336252 -10 Left 955336249 3:58088657-58088679 CCAACAAAAGCTCCCCTGTCCAG 0: 1
1: 1
2: 1
3: 12
4: 147
Right 955336252 3:58088670-58088692 CCCTGTCCAGCCAGAAGACCAGG 0: 2
1: 0
2: 1
3: 20
4: 238
955336249_955336256 -4 Left 955336249 3:58088657-58088679 CCAACAAAAGCTCCCCTGTCCAG 0: 1
1: 1
2: 1
3: 12
4: 147
Right 955336256 3:58088676-58088698 CCAGCCAGAAGACCAGGAAAGGG 0: 1
1: 3
2: 18
3: 86
4: 520
955336249_955336254 -5 Left 955336249 3:58088657-58088679 CCAACAAAAGCTCCCCTGTCCAG 0: 1
1: 1
2: 1
3: 12
4: 147
Right 955336254 3:58088675-58088697 TCCAGCCAGAAGACCAGGAAAGG 0: 2
1: 4
2: 15
3: 92
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955336249 Original CRISPR CTGGACAGGGGAGCTTTTGT TGG (reversed) Intronic
900676540 1:3890707-3890729 CTGCACAGTGGAGCTGCTGTTGG + Exonic
900878568 1:5364231-5364253 CTGCAGAGGGGAGCTTGTGGAGG - Intergenic
904949745 1:34226926-34226948 CTTGACATGGGAACTTTTGAAGG + Intergenic
906950613 1:50332357-50332379 CATGACAGAGGAGGTTTTGTCGG + Intergenic
907235699 1:53044978-53045000 CTGGACAGTGGAATTTTGGTAGG - Intronic
908953145 1:69587302-69587324 CTGAACTGGGGAACTGTTGTGGG - Intronic
909496018 1:76279520-76279542 CGGGAAAGAGGAGCCTTTGTGGG + Intronic
909903915 1:81173748-81173770 CTGTACAGAATAGCTTTTGTAGG + Intergenic
913088253 1:115458705-115458727 CTGGACAGGATAGCTTCTGGGGG - Intergenic
915097806 1:153476022-153476044 ATGCACAGTGGAGTTTTTGTGGG - Intergenic
916375710 1:164151184-164151206 CTGGGGAGGGGAGCTTTATTAGG + Intergenic
919819549 1:201464507-201464529 CAGGACAGGGAAGTTTTTATTGG + Intergenic
919989594 1:202700120-202700142 CTGGAGAGGGGAGCTTTTCTTGG - Intronic
920345756 1:205304667-205304689 CTGGACTGGGGAGCTGTCCTGGG - Intronic
922010128 1:221575165-221575187 CTAGACAGGGAAGCTATTGGTGG - Intergenic
922749674 1:228064606-228064628 CTGGGCAGGGGAGCCCTGGTGGG - Intergenic
923143655 1:231182785-231182807 CTGCACACGTGAGCTTTTGAAGG + Intronic
923647835 1:235842103-235842125 CTGGAAATGGGAGTTTTGGTGGG + Intronic
1062986993 10:1778335-1778357 CAGAAAAGGGGAACTTTTGTTGG - Intergenic
1063954446 10:11253323-11253345 CTGGACACTGGAGGTTTTGGAGG - Intronic
1067768046 10:49103821-49103843 GTGGAGAGGGGAGCTTTTCTTGG - Intronic
1069888631 10:71639265-71639287 CTGCAGAGGGGCGATTTTGTTGG - Intronic
1070333949 10:75438192-75438214 CAGGAAAGGGGAGCTGTTGGTGG + Intronic
1072721077 10:97781456-97781478 CTGCACAGAGGAGCTATTCTGGG - Intergenic
1073144324 10:101270381-101270403 ATGGACAGGGAAGGCTTTGTGGG + Intergenic
1073466030 10:103694954-103694976 CTGCACAGTTGAGCTTTTGGGGG - Intronic
1073818849 10:107237068-107237090 CAGGAAAGGGGAGATGTTGTAGG + Intergenic
1075470937 10:122688639-122688661 CAGACCAGGGGAGGTTTTGTAGG + Intergenic
1076171287 10:128322310-128322332 TTGGACAGGGAAGCTTCGGTAGG - Intergenic
1076343285 10:129764553-129764575 CTGGTCAGGTGAGCTTTTAGAGG - Intronic
1076668879 10:132108308-132108330 CTGGCCAGAGGAGCTGGTGTGGG - Intronic
1084047314 11:66576724-66576746 CTCAGCAGGGGAGCTTTTGCTGG - Intergenic
1084365584 11:68695703-68695725 CTAGAGAGGGCAGCTTTTGTTGG - Intergenic
1084367507 11:68712239-68712261 CAGGACAGAGGAGCTGCTGTGGG + Intronic
1084700855 11:70785384-70785406 CTGGACAGGAGAGCTTTGGGGGG - Intronic
1085085323 11:73662738-73662760 ATTTACAGGGGAGCTTTAGTGGG - Exonic
1085889333 11:80559037-80559059 TTGGAAAGGGGAACTTTTATGGG - Intergenic
1088545469 11:110954613-110954635 CTAGACAGGGGAGCCTAGGTGGG + Intergenic
1092008937 12:5093478-5093500 AGGGACAGGGGAGCGTTTGGTGG - Intergenic
1093764502 12:22947386-22947408 CTGGTCACAGGAGCCTTTGTGGG + Intergenic
1094404453 12:30100439-30100461 CTGCACAGGGAAACTTTTGGAGG - Intergenic
1096474736 12:51901402-51901424 CTGGACAGGGCAGCTTTTGTTGG - Intergenic
1101181657 12:102225657-102225679 GTGGACAAGAGAGCTTGTGTAGG + Intergenic
1101341929 12:103849775-103849797 CTTGACAGGGAAGCTGCTGTAGG - Intergenic
1108270822 13:48757764-48757786 CTGGAGAGGTGAGCTGTGGTGGG - Intergenic
1109222407 13:59653642-59653664 CTGGACAGGGAGGCCTGTGTTGG + Intergenic
1111222854 13:85227306-85227328 CTGAACATAGGAGTTTTTGTTGG - Intergenic
1111268973 13:85854647-85854669 GTGGCCAAGGGTGCTTTTGTTGG - Intergenic
1113356414 13:109585163-109585185 CTAGAGTGGGGAGCTTATGTGGG - Intergenic
1114577429 14:23727068-23727090 CTGAGCAGGGGAGCTTGTGTCGG + Intergenic
1115248448 14:31320491-31320513 CTGGAGTGGGGAGCTGCTGTAGG + Intronic
1121455440 14:94035891-94035913 CTGGGCAGGGGTGTTTTTGGGGG - Intronic
1122870253 14:104635161-104635183 CTGGGCAGGGGAGCAGTCGTGGG + Intergenic
1123411767 15:20066669-20066691 CTGCACAGGGGAGCTCCTGCAGG + Intergenic
1123521111 15:21073788-21073810 CTGCACAGGGGAGCTCCTGCAGG + Intergenic
1124381810 15:29173393-29173415 CCGTCCAGGGGATCTTTTGTGGG - Intronic
1124914484 15:33956216-33956238 CAGGACAGGTGAGCTAATGTAGG - Intronic
1125013693 15:34908621-34908643 CTGGACAGGGTACATTTTGATGG - Intronic
1129159773 15:73740752-73740774 CTGGACAGGGGAGAGCCTGTAGG + Intronic
1131668500 15:94595341-94595363 ATGGGCAGGGGACCTTATGTAGG - Intergenic
1131736647 15:95339656-95339678 GTGGAGGGGGGAGTTTTTGTTGG - Intergenic
1133104687 16:3499915-3499937 GTGGACAGGGCCCCTTTTGTTGG - Intergenic
1141950894 16:87338722-87338744 CTGGACAGGGGAGGCTTCGAGGG - Intronic
1142251511 16:88993968-88993990 CTGGACAGGGGAGGTATGGCTGG + Intergenic
1144813296 17:18015852-18015874 CTGCACAGGGCAGGTGTTGTGGG - Intronic
1147367174 17:39966555-39966577 CATGACAGGGGAGCTCTTGGAGG + Intronic
1148075895 17:44935001-44935023 CTGGACAGGGGAGCTGAGGCCGG + Intronic
1148445034 17:47732565-47732587 CAGGGTAGGGGAGCTTTTGTGGG + Intergenic
1150221143 17:63496581-63496603 CTGTCCACTGGAGCTTTTGTGGG + Intronic
1153343718 18:4004009-4004031 CTGGACACTGTAGCTTCTGTGGG - Intronic
1158652363 18:59299420-59299442 CTGGACAGGGTAACTGCTGTGGG + Intronic
1161727258 19:5936788-5936810 ATAGACAGGCGAGCTTCTGTTGG - Intronic
1161878210 19:6928322-6928344 CTGGAAAGGAGAACTTTTGATGG - Intronic
1162162851 19:8731577-8731599 CTGCACAGGAGAGCTTCAGTAGG - Exonic
1162397095 19:10423593-10423615 CTGTAGAGTGGGGCTTTTGTTGG + Intronic
1162931776 19:13961130-13961152 CTGGGCAGGGCAGCCTCTGTTGG + Exonic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1163485603 19:17583595-17583617 CTGGCCAGTGGAGCTACTGTGGG + Intergenic
1166343495 19:42151750-42151772 CAGGTCAGGGGAGGTTTGGTGGG + Intronic
1167564452 19:50247617-50247639 CTGTGAAGGGGAGGTTTTGTTGG + Intronic
925059732 2:881592-881614 CTGGAGAGGGCAGCCTCTGTGGG - Intergenic
925360814 2:3278821-3278843 CTGCACAGGGCAGCCTCTGTGGG - Intronic
926048764 2:9729789-9729811 CTGGCCAGGGGTGCTGCTGTGGG + Intergenic
930690057 2:54352984-54353006 CAGGACAGTGGAGATTTTGTTGG - Intronic
931711927 2:64995455-64995477 CTGGAGTGGGGATCTTTTGGGGG - Intronic
932746065 2:74334476-74334498 CTGGTCAGGGAAGGTTTTCTTGG - Intronic
934118954 2:88822189-88822211 CTGGCCAGGGAAGCTTCTGATGG - Intergenic
934516104 2:94987744-94987766 CTGGCCAGGGAAGCTTCTGATGG + Intergenic
934941422 2:98505459-98505481 GAGGACGTGGGAGCTTTTGTAGG + Intronic
936106228 2:109626855-109626877 CTGGGCAGGGGAGCCCTTGTTGG + Intergenic
936162403 2:110094539-110094561 CTGGCCAGGGAAGCTTCTGATGG - Intronic
936182257 2:110276827-110276849 CTGGCCAGGGAAGCTTCTGATGG + Intergenic
937532304 2:122844160-122844182 CAGGTCAGGGAAGCTTTTGCTGG + Intergenic
938095991 2:128464505-128464527 CTGCACAGGGTAGCTCTTTTGGG + Intergenic
938779372 2:134571358-134571380 CAGAACAGGGGAGCTTCTGCTGG + Intronic
940787374 2:157996206-157996228 CTGGAGAGAAGAGCTTTTCTTGG + Intronic
941122237 2:161543930-161543952 CTGGAAAGGTGAGATTTTATGGG + Intronic
946875742 2:224127997-224128019 CTGGACAGGGCAGGATTTGATGG - Intergenic
948336703 2:237213982-237214004 GTGGGCAGGGGAGATTTTCTTGG + Intergenic
948768011 2:240233401-240233423 CTGGAGAGGGGAGGTGCTGTGGG - Intergenic
948798925 2:240421394-240421416 ATGGACAGGGGTGCTTCTGATGG - Intergenic
1169360740 20:4946663-4946685 CTGGACTCAGGAGCTTTTTTAGG - Intronic
1173467014 20:43291203-43291225 TTGGAAAGGGGAACGTTTGTAGG + Intergenic
1177157444 21:17513315-17513337 TTGCACAGGGGCGCTTTTGCTGG + Intronic
1178410515 21:32359959-32359981 CTGGCCAGGGCAGCAATTGTTGG - Intronic
1179945350 21:44670524-44670546 CTGGACTGGGGAGTCTCTGTGGG - Intronic
1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG + Intronic
1182277853 22:29201778-29201800 CAGGACAGGGTACCTCTTGTTGG - Intergenic
1184838493 22:47038342-47038364 CTGGAAAGGGGAGCTCTTGGCGG + Intronic
1184910730 22:47532245-47532267 CTGCAAAGGGGTGCTGTTGTCGG + Intergenic
954431122 3:50471359-50471381 CTGGTGAGGGGACCTTCTGTGGG + Intronic
955336249 3:58088657-58088679 CTGGACAGGGGAGCTTTTGTTGG - Intronic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
962616729 3:137133955-137133977 CTGGACTGGGGTGCTGTTTTTGG + Intergenic
963247003 3:143072922-143072944 GAGGACAAGGGAGGTTTTGTGGG - Intergenic
963513765 3:146281847-146281869 CTGGACAGGGCTGGCTTTGTGGG + Intergenic
965833818 3:172829029-172829051 CTGGAGTGGGGAGCTGCTGTGGG + Intergenic
968193541 3:196688758-196688780 CTGGACATAGGAGCATTTGTTGG - Intronic
969321050 4:6412841-6412863 AGGGGCAAGGGAGCTTTTGTAGG - Intronic
969666247 4:8558974-8558996 CTGGACAGGTGAGTTTGGGTGGG + Intronic
970869664 4:20800289-20800311 CTTTACAGAGTAGCTTTTGTAGG - Intronic
978622559 4:110648258-110648280 CAGGACAGAGGAGCTTGAGTTGG + Intergenic
981236434 4:142421365-142421387 CTGGACAGGGAGGATTTTTTAGG - Intronic
982074829 4:151728181-151728203 GTGCACATGGGAGCTTTTTTTGG - Intronic
985327045 4:188782583-188782605 CTGTCCAGGAGAGCTGTTGTGGG - Intergenic
986208889 5:5651707-5651729 CCAGAAAGGGGAGCTTTTATTGG + Intergenic
986719677 5:10552168-10552190 GTGGACAAGGGAGGTTTTGGGGG - Intergenic
990165685 5:52990376-52990398 CTGGGGTGGAGAGCTTTTGTGGG + Intronic
990353105 5:54938672-54938694 CTGGACATGGGGGCCTTTGTAGG - Intergenic
994153409 5:96475157-96475179 CTGGCCAGTGGAGGTTCTGTCGG + Intergenic
996901768 5:128551286-128551308 CTGGACAGAGGAGGTTTCATTGG - Intronic
996991537 5:129638213-129638235 CTGGACAGGTGTATTTTTGTGGG + Intronic
1001323948 5:170706113-170706135 CTGGCCATGTGAGCTTTTGCTGG - Intronic
1002916272 6:1530330-1530352 CTGGGCAGGGGAGCTGTTTGGGG - Intergenic
1007728026 6:43928589-43928611 TTGGACAGGGGTGCCTTTGATGG - Intergenic
1010413335 6:75585769-75585791 CTGGACATGGCTGTTTTTGTAGG - Intergenic
1014209738 6:118695824-118695846 CTGAACTGGGGTGCTTTTGAGGG + Intronic
1018472336 6:164107925-164107947 CTGGTCTTGGAAGCTTTTGTGGG + Intergenic
1019322240 7:421003-421025 GGGGACAGGGGAGCTGTTCTTGG - Intergenic
1024259117 7:47560660-47560682 CTGGAAAGGGGGTCATTTGTAGG - Intronic
1026892902 7:73992720-73992742 CTGGACAGGGCATCGTGTGTAGG + Intergenic
1030687779 7:112504436-112504458 CTGCACTGGGGAGCGTTTCTGGG + Intergenic
1037776808 8:21840996-21841018 GAGGACAGGGGAGCTTCTTTGGG - Intergenic
1037785794 8:21902361-21902383 CTGGACATGGGGGCTTTAGCGGG - Intergenic
1039005224 8:33028714-33028736 TTGTATAGAGGAGCTTTTGTAGG - Intergenic
1043344371 8:79282749-79282771 CTGGCCAGGGGATCTTTTTGGGG + Intergenic
1045393338 8:101736580-101736602 CTGGAAAGTGGTGTTTTTGTCGG - Intronic
1047695006 8:127394868-127394890 GTGGGAAGGGGAGCATTTGTGGG - Intergenic
1050286744 9:4110696-4110718 CTGGACAGTGGATCTGTGGTTGG - Intronic
1053202885 9:36164717-36164739 CTGGACCGGGGAGCTTTCCTGGG + Intergenic
1056022426 9:82453766-82453788 GTGTACAGTGGAGCTTTTCTTGG - Intergenic
1057471528 9:95361125-95361147 CTGGCCAGGGAAGCGTCTGTGGG + Intergenic
1060377762 9:123132877-123132899 CTAACAAGGGGAGCTTTTGTTGG - Exonic
1061322776 9:129841702-129841724 CAGGACAGGGAAGCTGTTGAAGG + Intronic
1061612753 9:131759025-131759047 CTGGACAGTGGAGCTCCTGACGG + Intergenic
1186433007 X:9520732-9520754 CTTGACAGGGAAGCTGGTGTGGG + Intronic
1188352726 X:29151879-29151901 CTGGCCAGGGGAGTTTATCTGGG + Intronic
1194781649 X:98030335-98030357 CTGGGCAGGGGAGCTTCCCTTGG + Intergenic
1195517444 X:105793559-105793581 CTGGATGAGGGAGATTTTGTGGG - Intergenic
1195923830 X:110005806-110005828 CGGGACAGGAGTGCTTTTTTAGG + Intronic
1196209889 X:112984195-112984217 CTGTACAGTGCAGCTTTTGATGG + Intergenic
1201304087 Y:12536028-12536050 CCTGACAGGGGAGCTTTCCTGGG - Intergenic