ID: 955338878

View in Genome Browser
Species Human (GRCh38)
Location 3:58109432-58109454
Sequence TGGTGGGCCTTGAATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955338865_955338878 21 Left 955338865 3:58109388-58109410 CCATGCCTGACAGCCAAGGCAGA 0: 1
1: 56
2: 110
3: 90
4: 273
Right 955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG 0: 1
1: 0
2: 0
3: 19
4: 190
955338869_955338878 8 Left 955338869 3:58109401-58109423 CCAAGGCAGACATATGGAAGGAA 0: 1
1: 0
2: 4
3: 32
4: 282
Right 955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG 0: 1
1: 0
2: 0
3: 19
4: 190
955338866_955338878 16 Left 955338866 3:58109393-58109415 CCTGACAGCCAAGGCAGACATAT 0: 1
1: 0
2: 0
3: 16
4: 229
Right 955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG 0: 1
1: 0
2: 0
3: 19
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955338878 Original CRISPR TGGTGGGCCTTGAATGATGG AGG Intronic
900885026 1:5408926-5408948 TGGAGGTCATTGAATCATGGGGG + Intergenic
900897988 1:5497237-5497259 TTGTGGCCCTTGAAGGATGAGGG - Intergenic
901014814 1:6222632-6222654 TGGTGGGCCTGGTGTGAAGGTGG + Exonic
902889130 1:19428898-19428920 TGCTGGGCGTTGAATGTAGGAGG - Intronic
905127653 1:35726811-35726833 TGATTGGCCTTCAGTGATGGTGG + Intronic
906290887 1:44618604-44618626 TGGAGGGCCTTCAATGCTGGAGG + Intronic
906347641 1:45029155-45029177 TGGTGGAACTTGAATGAGGTCGG - Intronic
906545653 1:46617588-46617610 CGGTGTGCATTGAATGCTGGTGG - Intergenic
906672734 1:47668518-47668540 AGGTGGGCTTTGAAGGATGTAGG - Intergenic
907472842 1:54685570-54685592 TGGTGGGCCAAGTATGAGGGTGG + Intronic
908637439 1:66183899-66183921 CAGTGGGTCTTGAATGAAGGGGG + Intronic
911335119 1:96573133-96573155 GGGTGGGCCTTGAACAGTGGAGG + Intergenic
913380208 1:118202376-118202398 TGGTGGGAGCTGAATTATGGGGG - Intergenic
915364774 1:155308981-155309003 TGCTGGGCCTTGGAGGAAGGGGG + Exonic
917657523 1:177141314-177141336 TGGCGTGCAATGAATGATGGGGG + Intronic
921258918 1:213368262-213368284 TGAAGGGGCTTTAATGATGGGGG + Intergenic
921318828 1:213917708-213917730 TGGAGGTTATTGAATGATGGGGG + Intergenic
922077042 1:222254893-222254915 TGGGGGGGGTGGAATGATGGAGG + Intergenic
922776236 1:228215341-228215363 TGGTGGGGCTTGTAGGATGCTGG + Intronic
1063292211 10:4761190-4761212 GTGTGGCCCTTGGATGATGGTGG + Intergenic
1064625344 10:17255618-17255640 AGGTGGCCATTGAATCATGGGGG + Intergenic
1066992966 10:42534031-42534053 TGCTGGGACATGGATGATGGTGG - Intergenic
1069724291 10:70567362-70567384 TGGTGGGGCTGGCAGGATGGTGG + Exonic
1073926115 10:108518771-108518793 TGGAGGTAATTGAATGATGGAGG + Intergenic
1075441381 10:122481737-122481759 TGGTGGTAATTGAATCATGGGGG + Intronic
1076325358 10:129616511-129616533 TGGGGGGCCTGGGAGGATGGCGG - Intronic
1077676092 11:4193993-4194015 TGCTGGGCCCTGAATCAGGGAGG - Intergenic
1078715871 11:13838482-13838504 TGGTGGGCCTCAAAGGATGTTGG - Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1083645176 11:64167956-64167978 TGGTGGTCCTGGAATGCTGGGGG - Intergenic
1083791137 11:64986820-64986842 TGGTGGGCTTTGAATAAAGCAGG + Intergenic
1084620579 11:70267725-70267747 AGCTGGGTCTTGAATGATGTGGG - Intergenic
1085017293 11:73183145-73183167 AGCTGGGCTTTGAAGGATGGAGG - Intergenic
1088061301 11:105654206-105654228 TGGTGGGGCTGGAAAGATGTTGG + Intronic
1088202538 11:107354931-107354953 TGGAGGGGCTTGCAAGATGGAGG - Intronic
1088507712 11:110542364-110542386 TGGTGAGCCTTGGAGGATGGGGG - Intergenic
1089553328 11:119298932-119298954 TGTTGGGCCTTGACTACTGGAGG + Intronic
1089718264 11:120385237-120385259 TGTTGGGCTTCGAATGATGATGG + Intronic
1095332654 12:40987029-40987051 TAATGGGCTTTGAAAGATGGTGG + Intronic
1095382667 12:41614467-41614489 TGGTGGGAGTTGAATCATGGGGG + Intergenic
1095650681 12:44605079-44605101 TGGTGAGGCATGAATCATGGAGG + Intronic
1099591335 12:84594691-84594713 TGGTAGGACTTCAATGATGGAGG - Intergenic
1101874317 12:108588778-108588800 TGGTGGGGGATGAATGAAGGAGG - Intergenic
1103936030 12:124477195-124477217 TGGAGGTCATTGAATCATGGTGG + Intronic
1104757692 12:131279263-131279285 AGAGGGGCCTTGAGTGATGGGGG + Intergenic
1105242859 13:18622949-18622971 TGGGGGTCCTAGAATGTTGGTGG + Intergenic
1107510113 13:41075092-41075114 TGGTTTGCCTTGAATGATTTTGG + Intronic
1107579420 13:41766418-41766440 TGTTGGGACTTGAATGCTGAAGG + Intronic
1112991441 13:105518436-105518458 TGGTGGGAATTGAATCATGGGGG - Intergenic
1114688892 14:24562076-24562098 TGGTGGGACCTGGATGAAGGAGG + Intergenic
1116353878 14:43902725-43902747 TGGTGAGTCTTGATTGATTGGGG + Intergenic
1116425210 14:44782444-44782466 TAGTAGGCATTGAGTGATGGGGG - Intergenic
1121102776 14:91261490-91261512 GGCAGGGCCTTGAAGGATGGAGG + Intergenic
1121695688 14:95909972-95909994 TGGTGGGACTGGAATGTGGGGGG + Intergenic
1121957318 14:98226351-98226373 TTGGGGGCCATGAAGGATGGTGG - Intergenic
1122645456 14:103190272-103190294 TGGAGGTCATTGAATCATGGGGG + Intergenic
1122829698 14:104389740-104389762 TGGTGGGCCTCGCATCCTGGAGG - Intergenic
1123544934 15:21330728-21330750 TGGGGGTCCTAGAATGTTGGTGG - Intergenic
1124614828 15:31234088-31234110 TGGTGGGATTGGAAGGATGGAGG + Intergenic
1126657013 15:50989576-50989598 TTGTGGGCATTTGATGATGGAGG + Intronic
1127390881 15:58504174-58504196 TGGTGGGCCTAGAATCTTGAGGG - Intronic
1127984784 15:64061055-64061077 TGGTGGGCCGTCACTGCTGGGGG - Intronic
1129047569 15:72749950-72749972 TGGTGAGTATTGAATGATGTTGG - Intergenic
1129661852 15:77557202-77557224 TGCTGGGCCATGAGGGATGGGGG + Intergenic
1130120762 15:81045678-81045700 TGGAGGTAATTGAATGATGGAGG + Intronic
1202953284 15_KI270727v1_random:57999-58021 TGGGGGCCCTAGAATGTTGGTGG - Intergenic
1132732896 16:1371625-1371647 GGGTGGGCTGTGGATGATGGGGG - Intronic
1134751905 16:16631765-16631787 TGGAGGTCATTGAATCATGGGGG + Intergenic
1134993567 16:18721938-18721960 TGGAGGTCATTGAATCATGGGGG - Intergenic
1136029444 16:27492152-27492174 TGGCGGGCCTTGAATGGGTGGGG - Intronic
1140759238 16:78096499-78096521 TGGTGGTCCTGGGATGCTGGTGG - Intergenic
1142503361 17:346561-346583 TGGAGGTCATTGAATCATGGGGG - Intronic
1142642222 17:1290823-1290845 TGGAGGTCATTGAATCATGGGGG + Intronic
1145866262 17:28243747-28243769 TGGAGGTCATTGAATCATGGGGG + Intergenic
1145899119 17:28478524-28478546 AGTTGGGCCTTGAAGGTTGGTGG + Intronic
1146186450 17:30727528-30727550 TGGAGGGCCTGGAAGGATGGTGG + Intergenic
1146579116 17:34021290-34021312 TGCAGGGCCCTGAGTGATGGTGG - Intronic
1146691289 17:34877952-34877974 TGGTGGGCCCTGGATCCTGGAGG - Intergenic
1147713204 17:42485177-42485199 TGGTGGGTCATATATGATGGAGG - Intronic
1147925821 17:43945102-43945124 TGGAGGTCATTGAATCATGGGGG - Intergenic
1147936464 17:44014263-44014285 TGGTGGGCGATGAATGGTGCTGG - Intronic
1154446075 18:14436928-14436950 TGGGGGTCCTAGAATGTTGGTGG - Intergenic
1155054328 18:22171142-22171164 TGGATGGCCTTGACTGACGGCGG + Exonic
1155306217 18:24481455-24481477 TGGTGGTGATTGGATGATGGGGG - Intergenic
1157144862 18:45151693-45151715 AGGTGGTCCTTGCAGGATGGTGG + Intergenic
1157240966 18:46009025-46009047 TGATGTGCCTTACATGATGGGGG - Intronic
1160236256 18:77088439-77088461 TGGTGTGCCCTGAAGGTTGGTGG - Intronic
1160353797 18:78209088-78209110 TGGAGGTCATTGAATCATGGGGG + Intergenic
1162972394 19:14188527-14188549 TGGAGGGCCTGGGAGGATGGTGG - Intronic
1163702686 19:18794079-18794101 AGCTGGACCTTGAAGGATGGAGG - Intergenic
1163784715 19:19269152-19269174 TGGTGGAGCTTGAATGAGGATGG - Intronic
1167611142 19:50508208-50508230 AGGTGGGCCTTGAAGGACAGAGG - Intronic
1168588648 19:57614775-57614797 TGGCGGGTTTTGAATGGTGGAGG + Intronic
925653476 2:6117928-6117950 TGGAGGGAATTGAATTATGGGGG - Intergenic
925794951 2:7531206-7531228 TGTTGGGCCTTGCATGGTGTGGG - Intergenic
926967528 2:18431361-18431383 TGGTTGTGCTTGAATGATAGAGG - Intergenic
929247592 2:39719798-39719820 TGGTAGTCCTTGAAAGATGAGGG - Intergenic
929380883 2:41351986-41352008 TTGTGGGCATTGAGTGATGTAGG - Intergenic
929762008 2:44814674-44814696 TGGTGGGACCTGACTGATGTGGG + Intergenic
931205309 2:60140723-60140745 AGCTGGGCTTTGAATGAGGGTGG - Intergenic
932505174 2:72222335-72222357 AGGTGGGCCTTAAAGTATGGGGG + Intronic
940691742 2:156927156-156927178 TGGAGGTCATTGAATCATGGTGG + Intergenic
942199615 2:173558118-173558140 TGGTGGGCATTGAATGATAAAGG + Intergenic
944656950 2:201885006-201885028 GAGTGGGCCTTGAAAGATGATGG + Intronic
945657112 2:212638128-212638150 TGGTGTGCTTTGGATGATAGAGG - Intergenic
946658838 2:221977802-221977824 TGTTGGTCCTTTAATGTTGGTGG - Intergenic
948022343 2:234745347-234745369 GGGTGGGGCTTACATGATGGTGG - Intergenic
948060181 2:235037293-235037315 TGGTGGCAGTTGACTGATGGAGG + Intronic
948258331 2:236584481-236584503 GGGTGGGCCTTGAAGGGAGGAGG + Intergenic
1169347455 20:4839742-4839764 TGGTGAGCCTGGAGTGAGGGAGG + Intergenic
1169363096 20:4968233-4968255 GGGTTAGCCTTGAAAGATGGCGG + Intronic
1169978039 20:11352887-11352909 TGGTGGGTCTGGAAAGCTGGAGG + Intergenic
1170491238 20:16877049-16877071 TGGTGGGAATTGAATCATGGGGG + Intergenic
1172581233 20:36050578-36050600 TGGTGGGCCGGGAAGTATGGCGG - Intergenic
1173031616 20:39366427-39366449 TGGAGGTAATTGAATGATGGGGG + Intergenic
1173564705 20:44030459-44030481 GGGTGGGCCTTGAATGCCAGGGG - Intronic
1177487611 21:21779116-21779138 TGGAGGTAATTGAATGATGGGGG - Intergenic
1181258910 22:21583220-21583242 AGATGGGCCTTGAAAGACGGGGG - Intronic
1181443480 22:22950837-22950859 TGGTGGGCCTTTATGGCTGGAGG + Intergenic
1181491320 22:23262535-23262557 TGGGGGGGCTTCAAAGATGGAGG - Intronic
1184666758 22:45993366-45993388 TGGTGGTGATGGAATGATGGTGG + Intergenic
1185245374 22:49770320-49770342 TGGTGGGCCTTGTATGCAGGAGG - Intergenic
950314804 3:11991864-11991886 AGCTGGGCCTTAAATGATGGGGG + Intergenic
952286608 3:31975583-31975605 TGGTGGGCCCTAAATCAGGGTGG + Intronic
953678754 3:45023934-45023956 TGGAGGTCATTGAACGATGGGGG + Intronic
954417193 3:50399090-50399112 GGGAGGGCCTTGGGTGATGGGGG + Intronic
955338878 3:58109432-58109454 TGGTGGGCCTTGAATGATGGAGG + Intronic
956009711 3:64817513-64817535 TGATGGGCCTTGAAGGATAAGGG + Intergenic
956698460 3:71938309-71938331 TGGAGGTCATTGAATCATGGGGG - Intergenic
957142936 3:76384798-76384820 TGGAGGTCATTGAATCATGGAGG - Intronic
961184915 3:124906257-124906279 TTGTGACCCTTGAAAGATGGTGG + Exonic
962314307 3:134349628-134349650 TGGTGGGCCTGGGATGATTTGGG + Intergenic
963141457 3:141949383-141949405 AGGTGGGCCTTGGAGGAGGGCGG - Intergenic
964466516 3:156998958-156998980 TGGTGGTGATTGAATCATGGGGG + Intronic
967089391 3:186122283-186122305 TGGTGTGCCTAGAAGGAGGGAGG - Intronic
967191964 3:186992195-186992217 TGGAGGGAATTGAATCATGGGGG + Intronic
967449768 3:189611009-189611031 TGGAGGTAATTGAATGATGGGGG - Intergenic
968286901 3:197514105-197514127 TGCTGGGCCTGGGGTGATGGTGG - Intronic
969665620 4:8555779-8555801 AGGTGGCCCTTGAATAATGTGGG - Intergenic
970639978 4:18053075-18053097 TGGAGGTAATTGAATGATGGGGG + Intergenic
972878816 4:43398204-43398226 AGGTCACCCTTGAATGATGGTGG + Intergenic
973864969 4:55103579-55103601 TGGTGTGACTTGAAGGATGCTGG + Intronic
980552764 4:134361660-134361682 TGATGGGACTTGACTTATGGTGG + Intergenic
980635081 4:135491790-135491812 TGGAGGTCATTGAATCATGGGGG - Intergenic
984086497 4:175319109-175319131 TGGTGGGCCTTGACTGTAAGTGG + Intergenic
985493851 5:193623-193645 CGGTGGGTCCTGAAGGATGGGGG + Intronic
986782158 5:11076255-11076277 AGGTGGGCTTTGAATGGTGGTGG + Intronic
987463039 5:18237120-18237142 TGGTGGTAATTGAATCATGGGGG - Intergenic
987989334 5:25190644-25190666 TGGTGGGCCGGGAAGTATGGCGG - Intergenic
988068734 5:26259287-26259309 TGGTGACCCTTGAATCAGGGAGG + Intergenic
992951624 5:81863715-81863737 GGGTGAGCCTTGAATAAGGGGGG - Intergenic
994120910 5:96111530-96111552 AGGTGAGTCTTGAAGGATGGAGG - Intergenic
996831320 5:127743579-127743601 TGGTGGCCCTGGGAGGATGGTGG - Intergenic
998555035 5:143114882-143114904 TGGTGGGCTTTGTATGGTGGGGG + Intronic
999217722 5:149949477-149949499 AGGTGGGCTTTGAATGAGGGAGG + Intergenic
1000752215 5:165111030-165111052 TGGTGATAATTGAATGATGGGGG + Intergenic
1001094004 5:168762276-168762298 TGGTGGGCCTAGCATGATGCCGG + Intronic
1001918458 5:175581584-175581606 TGGAGGTCCTTGAATCATGGGGG - Intergenic
1003247024 6:4391098-4391120 TGGAGGGCGCTGGATGATGGAGG - Intergenic
1003701763 6:8473936-8473958 TGGTGGTAATTGAATCATGGGGG - Intergenic
1003856498 6:10281336-10281358 TGGAGGTACTTGAATCATGGGGG - Intergenic
1004852634 6:19715822-19715844 TTGTGGGAATTGAAGGATGGGGG + Intergenic
1006029523 6:31169250-31169272 TGCTGAGCCTTGAATGATAATGG - Intronic
1007556698 6:42772372-42772394 AGCTGGGCCTTGAAGAATGGTGG + Intronic
1007797355 6:44360640-44360662 TTGTGGGCCTTCGATGAGGGTGG - Intronic
1007902880 6:45427324-45427346 TTGTGGGCCATGTATCATGGTGG - Intronic
1008662179 6:53679669-53679691 TGGTGGGCTTTACATGTTGGGGG - Intergenic
1011768378 6:90649096-90649118 TGGTAGCCCTAGAATGATGCAGG - Intergenic
1013154000 6:107475820-107475842 AGCTGGGCCTTGAAGGATGATGG - Intergenic
1013154289 6:107478190-107478212 AGCTGGGCCTTGAAGGATGATGG + Intergenic
1013610230 6:111787918-111787940 TGGTGGGTTTGGAATGATGGTGG - Intronic
1014295455 6:119611882-119611904 AGGTGGCCTTGGAATGATGGAGG + Intergenic
1014419102 6:121218756-121218778 TGGTGGTAATTGAATCATGGGGG + Intronic
1014436348 6:121425051-121425073 TGGAGGTAATTGAATGATGGGGG - Intergenic
1017956574 6:159183236-159183258 TTGAGGGCCTTGAATGGTGGTGG + Intronic
1021482487 7:21132980-21133002 TGGAGGGAATTGAATCATGGGGG - Intergenic
1022042369 7:26592975-26592997 TGGTGGGCCATGCATGTTTGCGG + Intergenic
1022137872 7:27466355-27466377 TGGAGGGCCTTGGATGTGGGAGG + Intergenic
1023240799 7:38145323-38145345 TTTTGGACCTTGATTGATGGTGG - Intergenic
1027466678 7:78523751-78523773 TGGTGGTAATTGAATCATGGGGG - Intronic
1029129840 7:98321732-98321754 TGGTCGGCATTGTTTGATGGTGG - Intronic
1029130003 7:98322665-98322687 TGGTGGGACGTGAGTGCTGGGGG - Intronic
1030798064 7:113814448-113814470 TGGTGTACCCTGACTGATGGTGG + Intergenic
1032053295 7:128663244-128663266 GGGAGGTCATTGAATGATGGGGG + Intergenic
1033010302 7:137614969-137614991 TGGTAGGCCTTAAAGGATGTAGG - Intronic
1034450262 7:151133453-151133475 TGGTGCTCCCTAAATGATGGGGG + Intronic
1034608602 7:152343004-152343026 TGGTGGGCCTTGTAGGAGGAGGG - Intronic
1035333800 7:158113036-158113058 TGGGGGGCCCTCAATGCTGGGGG - Intronic
1036798660 8:11773586-11773608 AGTTGGGCCTTGAAGGCTGGAGG + Intronic
1037993231 8:23335557-23335579 AATTGGGCCCTGAATGATGGTGG + Intronic
1038492888 8:27982729-27982751 TGCGGGGCCTTGAAGGATGCAGG + Intronic
1044186283 8:89255520-89255542 TGGAGGTCATTGAATCATGGAGG - Intergenic
1044325194 8:90850905-90850927 AGGTGAGTCTTGAAGGATGGGGG + Intronic
1044727955 8:95208292-95208314 TGCTGGGCCCTGGAAGATGGTGG + Intergenic
1044951380 8:97438593-97438615 TGGTGGACCGTGACTCATGGTGG + Intergenic
1049469669 8:142769696-142769718 TGGTTGGGCTAGAGTGATGGGGG + Intronic
1051285460 9:15491955-15491977 TGGAGGTAATTGAATGATGGAGG - Intronic
1054965957 9:71026814-71026836 TGGTGGTGTTAGAATGATGGCGG - Intronic
1055441252 9:76338648-76338670 CTCTGGGCCTTGAAGGATGGGGG - Intronic
1055759488 9:79591446-79591468 TAGAAGGCCTTGAATGCTGGTGG + Intronic
1061271515 9:129546282-129546304 TAGTTGTGCTTGAATGATGGTGG - Intergenic
1061271986 9:129548976-129548998 TGGTTGTGCTTGAATGATAGTGG + Intergenic
1185663338 X:1744378-1744400 GGGAGGTCATTGAATGATGGGGG + Intergenic
1186730284 X:12402579-12402601 TGGTGGACCTTGATTGCTGATGG - Intronic
1190572201 X:51794715-51794737 TAGTGAGCCCTGAATGATGGGGG - Intergenic
1190758432 X:53420998-53421020 AGGTGGGCCTTGAAGAACGGGGG + Intronic
1197128712 X:122978840-122978862 AGCTAGGCCTTGAAGGATGGAGG + Intergenic
1197297646 X:124738634-124738656 AGCTGGGCCTGGAATAATGGGGG - Intronic
1199326597 X:146505302-146505324 TGGTAGGTCATGAATGTTGGAGG - Intergenic
1200933581 Y:8719161-8719183 GGAAGTGCCTTGAATGATGGAGG - Intergenic