ID: 955339257

View in Genome Browser
Species Human (GRCh38)
Location 3:58112326-58112348
Sequence CCAGGGGAGCAGAGGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1417
Summary {0: 1, 1: 0, 2: 13, 3: 141, 4: 1262}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955339257_955339276 15 Left 955339257 3:58112326-58112348 CCTTCTCCCCTCTGCTCCCCTGG 0: 1
1: 0
2: 13
3: 141
4: 1262
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339257_955339275 14 Left 955339257 3:58112326-58112348 CCTTCTCCCCTCTGCTCCCCTGG 0: 1
1: 0
2: 13
3: 141
4: 1262
Right 955339275 3:58112363-58112385 CCTTTCTATGCAGTCGGTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 68
955339257_955339277 24 Left 955339257 3:58112326-58112348 CCTTCTCCCCTCTGCTCCCCTGG 0: 1
1: 0
2: 13
3: 141
4: 1262
Right 955339277 3:58112373-58112395 CAGTCGGTGCTGGGTCACTGTGG 0: 1
1: 0
2: 0
3: 13
4: 174
955339257_955339271 8 Left 955339257 3:58112326-58112348 CCTTCTCCCCTCTGCTCCCCTGG 0: 1
1: 0
2: 13
3: 141
4: 1262
Right 955339271 3:58112357-58112379 CAGGCCCCTTTCTATGCAGTCGG 0: 1
1: 0
2: 2
3: 17
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955339257 Original CRISPR CCAGGGGAGCAGAGGGGAGA AGG (reversed) Intronic
900387374 1:2416750-2416772 ACAGGGGTGCAGAGTGCAGAGGG + Intergenic
900482838 1:2907673-2907695 CCAGATGCTCAGAGGGGAGATGG + Intergenic
900696739 1:4016920-4016942 TCAGGGGAGGGGAGGGGTGAGGG + Intergenic
900745348 1:4356910-4356932 CGAGGGGAGGAGGGGGGAGAAGG - Intergenic
900830153 1:4959959-4959981 GGAGGGGAGGGGAGGGGAGAAGG + Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900884647 1:5405741-5405763 CCAGTGGGGCTGAGGGGAGCTGG - Intergenic
900973200 1:6002716-6002738 CCAGGGGAGCTGAAGGGCTACGG + Intronic
901055242 1:6446145-6446167 CCATGGGAGCTGGGGGGTGAAGG + Intronic
901129737 1:6954834-6954856 CCAGGCAAGCAGAGGGAAGGCGG - Intronic
901526276 1:9824824-9824846 CCAGGGGTCCAGAGGCGAGGAGG - Intergenic
901528523 1:9839265-9839287 CGAAGGGTGCAGAGGGGAGAAGG - Intergenic
901645877 1:10716462-10716484 CATGGGGAGCAGTGGGCAGAGGG + Intronic
901654436 1:10761315-10761337 TCAGGGGAGCAGCTGGGAGCTGG - Intronic
901741179 1:11343009-11343031 ACAGGGGAGAAGAGGGGAGGTGG + Intergenic
901758152 1:11453904-11453926 CCAGGACAGCAGAGAGGGGAAGG - Intergenic
902221323 1:14967649-14967671 CCGGAGGAGCAGAGGCCAGAGGG + Intronic
902332588 1:15737906-15737928 CTATGGGAGCAGAGAGGACACGG - Intronic
902343533 1:15799849-15799871 CCAGGGGGGCAACGGTGAGAAGG + Intergenic
902404029 1:16173479-16173501 CCAGGGGTCCAGAGAGGGGAAGG - Intergenic
902429490 1:16352214-16352236 CCCGGGCCGCAGAGGGGAGCCGG - Intronic
902479129 1:16702469-16702491 CCATGGGAGCTGGGGGGTGAAGG - Intergenic
902653368 1:17851512-17851534 CCAGGGGCCCAGAGATGAGAAGG + Intergenic
902653958 1:17854700-17854722 GTAGGAGGGCAGAGGGGAGAAGG - Intergenic
903007252 1:20306983-20307005 CCAGGGGAGAAGAGGGAGGGAGG - Intronic
903056783 1:20641662-20641684 CCAGGAGAGCAGAGGCTAGGAGG - Intronic
903172605 1:21563290-21563312 TCGGGGGAGCAGTGGGGAGCAGG + Intronic
903189997 1:21651110-21651132 CAAGGGGTGCAGAGGTGGGATGG - Intronic
903296469 1:22346395-22346417 CCATGGGAGCAGAAGGGACGGGG + Intergenic
903330042 1:22592659-22592681 CGGGGTGAGCAGAGGGGAGGAGG + Intronic
903528430 1:24011012-24011034 CGAGGGGAGGGGAGGGGAGGAGG - Intergenic
903676197 1:25066137-25066159 ACAGGGGAGGGGAGGGGAGAGGG - Intergenic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904265272 1:29315136-29315158 TCAGGGAAGGAGAGGAGAGAGGG - Intronic
904340511 1:29831035-29831057 CCAGGGAAGCAGAGAGGATGAGG + Intergenic
904345519 1:29866315-29866337 TTCTGGGAGCAGAGGGGAGAGGG - Intergenic
904378692 1:30097119-30097141 CCATGGGAGGGGAGGGGAGGGGG - Intergenic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
904625417 1:31799512-31799534 CCAGGGGTGCCCAGGGGAAAGGG + Intronic
904879768 1:33686737-33686759 CCAGGGGCACAGACAGGAGAAGG - Intronic
904914394 1:33959608-33959630 CAAGGGCAGCAGGAGGGAGAGGG - Intronic
905140767 1:35842305-35842327 GTAGGGGAGCGGCGGGGAGATGG - Intronic
905187708 1:36208495-36208517 ACCGGGGGGCAGAGGGGTGATGG - Intergenic
905270120 1:36782192-36782214 TGAGGGAAGCACAGGGGAGAGGG - Intergenic
905434201 1:37945912-37945934 GCAGGGGAACAGAGGGAAGGTGG - Intronic
905501940 1:38446328-38446350 CCAAGGTAGCAGATGGAAGAAGG - Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
905789174 1:40781346-40781368 TCAGGGGAACAGGTGGGAGAGGG + Intergenic
905873244 1:41416728-41416750 CCAGGGGGGCGGGGGGCAGAGGG - Intergenic
905891751 1:41522380-41522402 CGAAGGGAGCAGATGGGAAATGG - Intronic
906155000 1:43608918-43608940 CCAGGGCAGCAGGGGAGGGACGG - Intronic
906158072 1:43625819-43625841 GCAGGGGGCAAGAGGGGAGAAGG - Intergenic
906180107 1:43810738-43810760 CCTTGGGAGCAGAGGGGCGAGGG + Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906786981 1:48624651-48624673 CCAGGGCAGCAGGGAGGTGAAGG + Intronic
907052552 1:51339551-51339573 CCAGGATGGCTGAGGGGAGAGGG + Intronic
907308893 1:53528290-53528312 GCAGCAGAGCAGAGGGGTGAGGG - Intronic
907400577 1:54222536-54222558 AAAGGGGTGCAGAGAGGAGAGGG - Intronic
908748702 1:67399584-67399606 GGTGGGGGGCAGAGGGGAGAAGG - Intergenic
908768125 1:67572400-67572422 ACAGGAGAGCAGAGGGAAGGAGG + Intergenic
908804530 1:67916612-67916634 CAAGTAGAGCAGTGGGGAGAAGG - Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909687558 1:78367962-78367984 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
909953974 1:81754464-81754486 AAAGGGGAGGGGAGGGGAGAAGG - Intronic
910262718 1:85307645-85307667 ACAGAGGAGGAGAGAGGAGAGGG - Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910509761 1:87990658-87990680 CTAGAGGACCAGTGGGGAGAAGG - Intergenic
910629999 1:89344519-89344541 ACAGCAGAGCAGAGAGGAGAAGG + Intergenic
910881478 1:91925688-91925710 GGAGGGGAGGGGAGGGGAGAAGG + Intergenic
911002327 1:93179810-93179832 CCACCGGAGGAAAGGGGAGAAGG + Intronic
911597851 1:99816936-99816958 CGAGTGGAGCAGAGGAAAGAGGG + Intergenic
912517549 1:110225808-110225830 GCCGGGGAGCAGAGGGCAAAAGG - Intronic
913121568 1:115745983-115746005 CCAGGGTAAAAGAGGGGATAGGG - Intronic
914804510 1:150982689-150982711 GCAGGGGAGCTGAGGTGAGGTGG - Intronic
915117087 1:153607947-153607969 GCAGGGGAGGGAAGGGGAGAGGG + Intronic
915160119 1:153913317-153913339 CCTGGGGATCAGAGGAGAAAAGG - Intronic
915334104 1:155130464-155130486 GGAGGGGAGAGGAGGGGAGAGGG + Intronic
915585151 1:156840373-156840395 TCAGTGGAGCTGAGGGGAGGAGG + Exonic
915601293 1:156924578-156924600 CCAGGGGAGCGGGAGGGAGCTGG - Intronic
915722767 1:157996123-157996145 TGAGGGGAGCAGAGAGGAGAGGG + Intronic
916197825 1:162241205-162241227 CAAGGGAAGCAGAGGAGAGGTGG + Intronic
916320679 1:163499788-163499810 GCAGAGGCGGAGAGGGGAGAGGG + Intergenic
916506076 1:165429142-165429164 CGAGGGACACAGAGGGGAGAGGG + Intronic
916630298 1:166605590-166605612 ACAGGGTAACAGTGGGGAGAAGG + Intergenic
917120659 1:171642183-171642205 GCAGGGGTGGAGAGGAGAGAAGG - Intronic
917593963 1:176508808-176508830 CCATGGCAGCAGGAGGGAGAGGG - Intronic
917594027 1:176509476-176509498 CCATGGCAGCAGGAGGGAGAGGG + Intronic
917789821 1:178492387-178492409 TCAGGGGAACAGAGGGGACGCGG + Intergenic
917969337 1:180197042-180197064 CCTGGGGAGGAGGCGGGAGAGGG + Exonic
918095371 1:181329944-181329966 CCAAGGGAGTGGAGGGGAGTAGG + Intergenic
918142534 1:181731657-181731679 GCAGGAGAGCACATGGGAGAGGG - Intronic
918733102 1:188022955-188022977 AGAGGGGAGGGGAGGGGAGAAGG + Intergenic
918733119 1:188022996-188023018 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
919200979 1:194355191-194355213 CCTGGGGAGCAGATGTGTGATGG + Intergenic
919257448 1:195142354-195142376 AGAGGAGAGCAGAGGGGAGGAGG - Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
919980086 1:202637561-202637583 CCAGCCGAGCAGTGGGGAGCAGG + Intronic
920111605 1:203591149-203591171 GCAGAGGAACAGAGGGAAGAAGG + Intergenic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920288896 1:204902602-204902624 CCAGTGGAGGGGTGGGGAGAAGG + Intronic
920659339 1:207902152-207902174 TCAGGTAAGCAGTGGGGAGAAGG + Intronic
920704536 1:208242050-208242072 CCTGGAGGTCAGAGGGGAGAGGG + Intronic
921300465 1:213746712-213746734 GCAGGGCAGCAGAGTGGAGGCGG + Intergenic
921315758 1:213888578-213888600 GAAGGGGAGAAGAGGGGAGAGGG + Intergenic
921326193 1:213988092-213988114 GCAGAGGAGGAGAGAGGAGAAGG - Exonic
921341119 1:214135845-214135867 CCAGGGTAGCAGAAGTGAGCAGG + Intergenic
921799527 1:219386092-219386114 ACTGGGCAACAGAGGGGAGACGG + Intergenic
922022131 1:221716036-221716058 GAAGGGTAGAAGAGGGGAGATGG - Intronic
922546765 1:226463926-226463948 ACTGGGGAGCAGATGGTAGAAGG + Intergenic
922729289 1:227941616-227941638 CCCTGGGAGCACAGGGGAGATGG + Intronic
922879548 1:228970350-228970372 GCAGAAGAGCAGAGGGGAAAAGG - Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923086656 1:230707786-230707808 TCAGACGAGCAGAGGGAAGACGG - Intronic
923087831 1:230714504-230714526 CCGGAGGTGCAGAGGGCAGAGGG + Intergenic
923718349 1:236446184-236446206 TCTGGGTAACAGAGGGGAGAAGG - Intronic
923875813 1:238045776-238045798 CTTGGGGAGAAGAGGGGAGAGGG + Intergenic
923962714 1:239103091-239103113 CCAGGTGTGAAGAGGGGAGGTGG - Intergenic
924384322 1:243487976-243487998 CCGGGGGAGCCGTGGGGAAATGG + Intronic
924557470 1:245130129-245130151 CCAAGGAAGACGAGGGGAGAGGG + Intergenic
1063081990 10:2776054-2776076 CGAAGGAAGCAGGGGGGAGAAGG + Intergenic
1063082603 10:2782710-2782732 AGATGGGAGGAGAGGGGAGATGG - Intergenic
1063223430 10:3992498-3992520 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1063708790 10:8457120-8457142 GCTGGGGAGTACAGGGGAGAAGG - Intergenic
1063924710 10:10966494-10966516 CCAGAGGAGAAGGTGGGAGAGGG - Intergenic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1064143733 10:12810961-12810983 CCCAGGGGGCTGAGGGGAGAGGG + Intronic
1064210523 10:13357284-13357306 GGAGGGGAGGAGAGGGGAGGGGG - Intergenic
1064279013 10:13933835-13933857 CTAGGGGAGCAGGGGGCAGGTGG + Intronic
1064325137 10:14343444-14343466 TCAGGGTGGTAGAGGGGAGATGG - Intronic
1064501456 10:15977819-15977841 CCATGGGATCAGAGGAGAGAAGG - Intergenic
1065024108 10:21525620-21525642 GAAGGGGAGGAGAGAGGAGAGGG + Exonic
1065203049 10:23331617-23331639 GGAGGGGAGGGGAGGGGAGAAGG + Intronic
1066199017 10:33128068-33128090 GGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1066569380 10:36754354-36754376 GAAGGGGAGGGGAGGGGAGAGGG + Intergenic
1067042231 10:42961112-42961134 CCAGAGGAGCAGACGGGACCAGG + Intergenic
1067107346 10:43374933-43374955 CCAGGGGAGAGGAGGAGAGGAGG - Intronic
1067363991 10:45608098-45608120 CCAGGGGACTAGATGGGGGAGGG + Intergenic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067530554 10:47068591-47068613 CCAGGAGAGCAGATTGGAAAGGG - Intergenic
1069594296 10:69660658-69660680 CCAGGAAAGCAGAGTAGAGAAGG - Intergenic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069797039 10:71060128-71060150 GCAGGGGTACAGAGGTGAGATGG + Intergenic
1069807087 10:71132801-71132823 ACAGGGGAGAAGAGGGAGGATGG - Intergenic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1070285437 10:75080062-75080084 GCAGGAGAGCAGAGGAGTGAAGG + Intergenic
1070642767 10:78181239-78181261 CTAGGGGAGCAGTGGGGAAGGGG - Intergenic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070837958 10:79462938-79462960 CCACAGGAGCAGAGAGGGGAGGG + Intergenic
1071026196 10:81116605-81116627 CCAGGAGTGGAGAGGGAAGAGGG + Intergenic
1071336487 10:84604664-84604686 CCAAGAGAGCAGAGGGGAGGGGG - Intergenic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1071888131 10:89972722-89972744 CAATGGGAGCAGAGAGGAGAAGG + Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1072020497 10:91394653-91394675 CCAAGGGAGGATAAGGGAGAGGG - Intergenic
1072079258 10:92012192-92012214 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
1072305903 10:94106982-94107004 CCAAGGAAGCAGAGGGGAGAGGG - Intronic
1072690211 10:97567830-97567852 CCTGGGGAGGGGAGGGGAGGGGG + Intronic
1072745551 10:97936615-97936637 GCAGGGTGGCAGAGGGGAGTGGG + Intronic
1072889119 10:99306150-99306172 CCAGAAGAGCAGAGAGGAAATGG + Intergenic
1073011391 10:100362713-100362735 GCAGGGGAGCACAGGGGTGTAGG - Exonic
1073045830 10:100637754-100637776 CCAGGGGAAAAGTGGGGAGAAGG - Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073098185 10:100993168-100993190 CCTGGGGAACAGGGGGCAGAAGG - Exonic
1073148873 10:101298313-101298335 GCAGGGGAGGAGAGGTGAGAAGG + Intergenic
1073447336 10:103589543-103589565 GCAGGGGAGCAGGGGAGTGATGG - Exonic
1073816190 10:107209973-107209995 GTGGGGGAGAAGAGGGGAGAGGG + Intergenic
1074191773 10:111144411-111144433 GACGGGGAGGAGAGGGGAGAGGG - Intergenic
1074250013 10:111735638-111735660 TCAGGTGAGCAGAGGGGGCATGG + Intergenic
1074409191 10:113211000-113211022 AGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1074409200 10:113211017-113211039 GGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1074719351 10:116251065-116251087 AGAAGGGAACAGAGGGGAGAAGG - Intronic
1074899558 10:117804406-117804428 GCAGGGGTGCAGAGAGAAGAGGG + Intergenic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075204772 10:120437340-120437362 CCATGGGAGCAGAGTTGAGAGGG + Intergenic
1075207735 10:120461640-120461662 ACAGGGGATGAGAGGAGAGAAGG + Intronic
1075293949 10:121255947-121255969 GCAGGGGAGGAGAAGGGAAATGG + Intergenic
1075708263 10:124515963-124515985 ACAGGGAATCAGAGAGGAGAAGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075813519 10:125246425-125246447 CAAGGGGAGGAGCGGGGAGATGG - Intergenic
1075871020 10:125772967-125772989 GCCTGGGAGCAGAGGGGAGCGGG + Intronic
1075970735 10:126649995-126650017 ACAGGGGAGGGGAGGGGAGAGGG + Intronic
1076070593 10:127485256-127485278 CCAGGGAAGCAGAGCACAGAGGG - Intergenic
1076122593 10:127948132-127948154 CCAGGAGAGCAGATGGGGAAGGG + Intronic
1076274126 10:129182235-129182257 CCAGGGGAAGGGAAGGGAGAGGG - Intergenic
1076358557 10:129870373-129870395 GCAGGGAAGCAGTGGGGACAGGG + Intronic
1076380432 10:130021423-130021445 CCAAGGGAGGAGAGTGGGGAAGG + Intergenic
1077051691 11:569459-569481 GCCAGGGAGCTGAGGGGAGACGG - Intergenic
1077140503 11:1022202-1022224 ACAGGGCTGCAGAGGGCAGAGGG - Intronic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1077219321 11:1408406-1408428 CCACGGGAGAACTGGGGAGAAGG + Intronic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077281215 11:1747113-1747135 CCAGGGCAGCCCAGGGAAGAGGG - Intronic
1077366199 11:2162325-2162347 CCTGGCCAGGAGAGGGGAGATGG - Intergenic
1077411429 11:2405662-2405684 CCCTGGCAGGAGAGGGGAGATGG - Intronic
1077411871 11:2407472-2407494 CCAGGAGAGCAGAGTGGACAGGG - Intronic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077497340 11:2892576-2892598 CAGGGGGAGCAGAGAGGAAATGG - Intronic
1077819704 11:5725022-5725044 CCAGGAGAGCAGAAAAGAGAAGG - Intronic
1078614335 11:12851235-12851257 CCAGAGGAGGAGAGAGGAAACGG + Intronic
1078830461 11:14972648-14972670 CCAGGGGTGGAGTGGGGCGAGGG - Intronic
1079008809 11:16811813-16811835 CCAGGGCAGCAGAGGGGAGGTGG - Intronic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079512563 11:21228675-21228697 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1079934458 11:26600285-26600307 AGAGGGGAGGAAAGGGGAGAGGG - Intronic
1080007302 11:27423461-27423483 CCATCAGAGCAGAGGGGAGAAGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080503704 11:32892968-32892990 CCCGGCGAGCAGGCGGGAGAAGG - Intergenic
1080542352 11:33280013-33280035 CTGGGGGAGCTGAGGGGAGGTGG + Intronic
1080560452 11:33457972-33457994 CCATGGAAGCAGACGGGACATGG - Intergenic
1080642269 11:34164868-34164890 CCAGGGCAGCTGAGGCGAAAGGG + Intronic
1080652520 11:34234140-34234162 ACAGGGGAGGGGAGGGGAGAAGG - Intronic
1080874869 11:36266130-36266152 CCAGGGAAGCTGAGGGAAGGTGG - Intergenic
1080931624 11:36817411-36817433 CAAGGGAATCAGTGGGGAGATGG - Intergenic
1081079230 11:38718851-38718873 GCAGGTCAGCAGAGGGGAGCAGG - Intergenic
1081615950 11:44591296-44591318 ACAGAGGCACAGAGGGGAGAAGG - Intronic
1081656703 11:44862139-44862161 ACAGGGGAGCAGAGGGGGACGGG + Intronic
1081786365 11:45750562-45750584 CCAGGGGAGCAGAGCGTGGGGGG + Intergenic
1081808918 11:45904574-45904596 CCAAGGGAGGAGAAGGGAGAGGG - Intronic
1082029846 11:47595915-47595937 GGAGGGGAGGGGAGGGGAGAAGG + Intergenic
1083148047 11:60773207-60773229 CCAGGGGAGGAGAAGAGAAAAGG + Intronic
1083156742 11:60828047-60828069 ACAGGGGAGCCGAGGGAGGAGGG + Intergenic
1083207636 11:61161975-61161997 CCAGGGGGGAAGGGAGGAGATGG - Intergenic
1083266120 11:61547647-61547669 GGAGGGGGACAGAGGGGAGAAGG + Intronic
1083278760 11:61612415-61612437 ACAAGGGAGCAAGGGGGAGATGG + Intergenic
1083574156 11:63777337-63777359 ACAGGGGAGCAGGGTAGAGATGG - Intergenic
1083896931 11:65624710-65624732 GGAGGGAAGGAGAGGGGAGAAGG - Intronic
1083990079 11:66241488-66241510 CCCGGGGAGCGGAGGAGGGAAGG + Exonic
1084166202 11:67375802-67375824 TCGGGGGAGCGGAGGGGAGGGGG + Intronic
1084210177 11:67617168-67617190 ACTGGGGAGAAGAGAGGAGAGGG - Intergenic
1084215793 11:67646216-67646238 CCAGGGGAAGAGAGGTGAGAGGG - Intronic
1084381163 11:68813708-68813730 AGAGGGGAGGGGAGGGGAGAGGG + Intronic
1084568639 11:69945838-69945860 CCACGGGGGCAGAGGTGGGAGGG + Intergenic
1084757533 11:71249266-71249288 AAAGGGAAGGAGAGGGGAGAAGG - Intronic
1084893570 11:72249707-72249729 CCAGGGGACCAGAGGGATGGGGG - Intergenic
1084937623 11:72595517-72595539 AGAGGGGAGGAGAGGGGGGAGGG - Intronic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1084972609 11:72780173-72780195 CCAGGGGACCAGATGGGGCAGGG - Intronic
1085177208 11:74500243-74500265 TCAGGGGTGGAGTGGGGAGACGG - Intronic
1085193906 11:74654658-74654680 GGTGGGGAGCAGAGGAGAGAAGG - Intronic
1085350416 11:75794913-75794935 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1085505416 11:77056088-77056110 AAAGGGGAGAAGAGGAGAGAAGG + Intergenic
1085739145 11:79064448-79064470 GCAGGGGAGCAGAGAGGGCATGG - Intronic
1085831283 11:79903964-79903986 CCAGGAGAGCAGAGGTAAGGTGG - Intergenic
1086371891 11:86163430-86163452 CTATGGGAGCAGAGTGGAGGAGG + Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1086951052 11:92890588-92890610 CCAGGGGAGCACACGGGAGCTGG + Exonic
1088245062 11:107809880-107809902 ACAGAGCAGCACAGGGGAGAAGG + Intronic
1088491535 11:110393132-110393154 ACTGGGGAGCAGAGGGGAGGTGG - Intergenic
1088575343 11:111266236-111266258 TGAGGGGTGCAGATGGGAGAGGG + Intronic
1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG + Intergenic
1088896645 11:114083570-114083592 CTAAGAGGGCAGAGGGGAGAGGG - Intronic
1088900832 11:114115792-114115814 CCAGAGGAGGGGAGGGGAGAAGG + Intronic
1088995060 11:114989022-114989044 CAAGGGCAGCAAAGGGCAGATGG + Intergenic
1089125641 11:116174666-116174688 TCAGGGGAGGGGAGGGGAGGAGG - Intergenic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089636723 11:119818975-119818997 CACGCGGAGCTGAGGGGAGAGGG + Intergenic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1090022115 11:123137456-123137478 ACAGGGTCCCAGAGGGGAGATGG + Intronic
1090251386 11:125254295-125254317 CCAGGGCTGCAAAGGGGCGATGG + Intronic
1090416497 11:126544032-126544054 CCTGGGGAGCAGACAGGAGTGGG - Intronic
1090664132 11:128903776-128903798 GGAGGGGAGCAGGAGGGAGAGGG + Intronic
1090749418 11:129732823-129732845 GAAGGGGAGGAGAGAGGAGAAGG + Intergenic
1090940575 11:131384599-131384621 CCAGGGAAGGAGAGGCAAGAAGG + Intronic
1091002570 11:131922654-131922676 CCAGAAGAGCCGAGGAGAGACGG - Intronic
1091635471 12:2193620-2193642 CCAGGAAAGCAGGGGAGAGAAGG - Intronic
1091722676 12:2824563-2824585 CCAGGGGAGCAGTGGAGGTAAGG + Exonic
1091748761 12:3009948-3009970 CCCGGGGAGGTGAGGGGAGTGGG - Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092202898 12:6597868-6597890 CCAGCTGAGCACACGGGAGACGG - Intronic
1092237558 12:6819594-6819616 CCAAATGAGCAGTGGGGAGAGGG - Exonic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092921169 12:13233106-13233128 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
1092970533 12:13689950-13689972 AGAGGAGAGAAGAGGGGAGAAGG - Intronic
1094083726 12:26565973-26565995 GGAGGGGAGGGGAGGGGAGAAGG + Intronic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1094711965 12:32973514-32973536 CCAGGAGATCAAAGGGGAAATGG - Intergenic
1095051034 12:37554500-37554522 CCAGGGGAGTATGGGGGAGTTGG + Intergenic
1095170286 12:39026879-39026901 ACAGGGAAGCAGAAGAGAGATGG + Intergenic
1095451588 12:42337196-42337218 GCAGAGTGGCAGAGGGGAGAGGG - Intronic
1096159850 12:49367386-49367408 CCAGGAGAGAAGTGGGGAGGCGG + Intronic
1096235864 12:49925875-49925897 ACAGGGGAGCTGGGGGGTGAGGG + Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096657163 12:53098804-53098826 CATGGGGGGCAGCGGGGAGATGG + Intronic
1096719496 12:53510450-53510472 CCAGAGGAGCAGCGGTGTGAGGG + Intronic
1096839305 12:54370804-54370826 CCAGGGGGCCAGATGGGAGGGGG - Intronic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097052196 12:56230357-56230379 CCTGGGGAGGAGGGGGGAAAAGG - Intronic
1097065224 12:56315812-56315834 CCCTGGGAGCAGAGGTGGGACGG - Exonic
1097167872 12:57095158-57095180 ACGGGGAAGGAGAGGGGAGAAGG - Exonic
1097241813 12:57580874-57580896 CCAGAGGAGCGTAGGGGACAGGG - Intronic
1097644588 12:62221172-62221194 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1098009050 12:66031120-66031142 AAGGGGGAGCAGAGGGGAAATGG - Intergenic
1098254785 12:68606071-68606093 AGAGGAGAGGAGAGGGGAGACGG + Intergenic
1099198556 12:79648679-79648701 CCAGGGAGGCAGAGGTGGGAGGG + Intronic
1099424298 12:82503597-82503619 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1099752345 12:86791935-86791957 CCTCAGCAGCAGAGGGGAGACGG + Intronic
1100405651 12:94270888-94270910 AAAGGGGAGCAGAGTGAAGAGGG + Intronic
1100752701 12:97716716-97716738 CAAAGGGAGCAGAGGAGAGAAGG - Intergenic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1102068175 12:109996131-109996153 CCAGGAAAGCAGAGGGGAGCGGG + Intronic
1102116903 12:110409749-110409771 CCTGGGGAGGAGAGGTCAGATGG + Intergenic
1102453474 12:113057423-113057445 CCAGGAGACAAGAGGGGAGAGGG - Intronic
1102465398 12:113127998-113128020 CCTGGGCACCTGAGGGGAGAGGG - Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102902249 12:116647443-116647465 GGAGGGGAGGAGAGGGAAGAAGG - Intergenic
1102921453 12:116794629-116794651 GAAGGGGAGGGGAGGGGAGAAGG + Intronic
1102976087 12:117207967-117207989 GAAGGGGAGAAGAGAGGAGAAGG - Intergenic
1103149592 12:118625425-118625447 CCAGAGGAACAGAGAGGGGATGG + Intergenic
1103450626 12:121026104-121026126 CCTGGGAGGCAGAGGGGAGCCGG + Intronic
1103736556 12:123064455-123064477 GCAGGGGAGCTGAGGGGAGTAGG + Intronic
1104298754 12:127543198-127543220 GCTGGGGAGGAGAAGGGAGAGGG + Intergenic
1104449933 12:128860824-128860846 TCAGGGGATCAGAGGGGGGTGGG - Intronic
1104544406 12:129698540-129698562 GGAGGGGAGGGGAGGGGAGAAGG + Intronic
1104695743 12:130862384-130862406 GCAGGTGAGCACAGGAGAGAAGG - Intergenic
1104757420 12:131277852-131277874 CCACGGCTGCAGGGGGGAGATGG + Intergenic
1104836625 12:131795977-131795999 ATAGGGGAGGGGAGGGGAGAGGG + Intronic
1104836638 12:131796000-131796022 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
1104956743 12:132470454-132470476 GGAGGGGAGGAGAGGGGGGAGGG + Intergenic
1104974999 12:132548349-132548371 CCTGGGCAGCAGAGGGCAGCTGG + Intronic
1105356655 13:19665092-19665114 AGTGGGGTGCAGAGGGGAGATGG + Intronic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1106076393 13:26464786-26464808 GCAGGGGAACAGAGCGGAGAAGG + Intergenic
1106840854 13:33683652-33683674 CCTGGGGTGGGGAGGGGAGAAGG + Intergenic
1107528635 13:41259817-41259839 TCATGGGAGCAAAGAGGAGAGGG - Intronic
1107554077 13:41502310-41502332 CCAGGGAAGGGGAGGGGAGGAGG - Intergenic
1107897180 13:44976796-44976818 CCAAGGCAGCAGAGGGGCAAGGG + Intronic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108299736 13:49061634-49061656 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1108299769 13:49061699-49061721 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1108477099 13:50831119-50831141 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
1108556183 13:51595192-51595214 CCAGGAGACCAGTGGGGACAAGG - Intronic
1108605490 13:52033937-52033959 GCAGAGGAGCAGCGGGGAGGGGG - Intronic
1110518589 13:76446168-76446190 GGAGGGGAGGGGAGGGGAGAGGG + Intergenic
1110615652 13:77539014-77539036 CCTGGGGAGAACTGGGGAGAGGG - Intronic
1111096022 13:83516901-83516923 CTCGGAGAGCAGAGGGGAGCCGG - Intergenic
1111823881 13:93244597-93244619 TTTGGGGAGCAGTGGGGAGAAGG - Intronic
1111939116 13:94590592-94590614 GAAGGGGAGCAACGGGGAGATGG - Intronic
1112264229 13:97908137-97908159 CCATGGGAGCACAGGAGAGAGGG - Intergenic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1113509256 13:110839198-110839220 AGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1113575141 13:111390051-111390073 GCAGGGGAGCAGAAGGGCTACGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1113938101 13:114005771-114005793 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938139 13:114005881-114005903 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938153 13:114005919-114005941 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938188 13:114006029-114006051 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938214 13:114006103-114006125 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938248 13:114006213-114006235 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938283 13:114006323-114006345 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938297 13:114006361-114006383 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938309 13:114006399-114006421 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938344 13:114006509-114006531 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938358 13:114006547-114006569 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938369 13:114006585-114006607 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938404 13:114006695-114006717 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938418 13:114006733-114006755 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938452 13:114006843-114006865 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938487 13:114006953-114006975 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938510 13:114007027-114007049 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938522 13:114007065-114007087 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938545 13:114007139-114007161 GCAGGGCAGGAGTGGGGAGAAGG - Intronic
1113938581 13:114007249-114007271 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1113938616 13:114007342-114007364 GCAGGGCAGGAGGGGGGAGAAGG - Intronic
1114266377 14:21074784-21074806 CCAGGGGAGCTTAGAGGAGGAGG + Exonic
1114322306 14:21557389-21557411 CCGGGGGAGCAGTGGTGAGGTGG - Intergenic
1114522662 14:23348683-23348705 GCAGGGGTGGAGAGAGGAGAGGG + Intronic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1115783153 14:36793499-36793521 TGGGAGGAGCAGAGGGGAGAAGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116996232 14:51328100-51328122 ACAGGAGAGGAGAGGGGAGGTGG - Intergenic
1117318592 14:54598799-54598821 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117662311 14:58020364-58020386 CCGAGGGAACAGAGAGGAGAAGG - Intronic
1117798224 14:59416513-59416535 CCAAGGGAGGAGAGAGAAGATGG + Intergenic
1118066203 14:62193369-62193391 GCCGGGGAGCAGTGGGGGGAAGG + Intergenic
1118115210 14:62768061-62768083 CCAGGGTGGGAGAGGGGTGAGGG + Intronic
1118252574 14:64176567-64176589 CCAGCAGAGGAGAGGGGTGACGG + Intronic
1118982842 14:70730324-70730346 CCAGCGGAGATGAGGGGAGCTGG - Exonic
1119195503 14:72714346-72714368 CCAAGGAAGCACAGGGAAGAGGG + Intronic
1119482271 14:74965455-74965477 CAAGGGGTGCAGAGGGGAGCCGG + Intergenic
1119594594 14:75922807-75922829 CCAGAGGTACAAAGGGGAGATGG - Intronic
1119707497 14:76793382-76793404 AGAGGGGAGAGGAGGGGAGAGGG + Intronic
1120883644 14:89434612-89434634 CCAAGGGTTCAGATGGGAGATGG - Intronic
1121209830 14:92199898-92199920 CAAGAAGAGCAGAGAGGAGAGGG + Intergenic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121242526 14:92440734-92440756 ACAGGGGAGCCAAAGGGAGAGGG + Intronic
1121307029 14:92912901-92912923 CCAAGGGGGCTGATGGGAGAGGG + Intergenic
1121310664 14:92933508-92933530 CCACAGGAGCAGGGGGGAGTTGG + Intronic
1121442156 14:93956143-93956165 CCAGGGGTACAGAGAGGGGAGGG + Intronic
1121520319 14:94581625-94581647 CCAAGGCAGCAGAGGTGAGTGGG + Exonic
1121668527 14:95690964-95690986 CCAGGGGCACAGAAGAGAGAGGG - Intronic
1121692661 14:95889134-95889156 GCAGGGGAGGGGAGGGGAGGTGG - Intergenic
1121854440 14:97253944-97253966 CCTGGGGAGGAGAGGAGAGTTGG + Intergenic
1121994338 14:98590440-98590462 AGATGGGAGCAGAAGGGAGATGG + Intergenic
1122034085 14:98935004-98935026 CAAGGGGAGGACAGGGCAGAGGG + Intergenic
1122249336 14:100427104-100427126 CCAGAGCAGCAGAGAGGAGGAGG - Intronic
1122287086 14:100658525-100658547 CCAGGAGGGCAAAGGGGAGGTGG + Intergenic
1122309434 14:100785244-100785266 GCAGGGGAGCAGAAGGCAGGGGG - Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122359438 14:101150858-101150880 GGAGGGGAGAAGAGGGGAGGGGG - Intergenic
1122541747 14:102501870-102501892 CCCCGGAAGCAGAGGTGAGATGG + Exonic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1122719456 14:103714164-103714186 AGAGGGGAGGAGAGGGGAGGAGG - Intronic
1122877928 14:104677407-104677429 CCAGGGCAGCAATGGGGGGAGGG - Intergenic
1122900764 14:104781464-104781486 CCAGGGGAGCTCAGAGGACATGG + Intronic
1122917826 14:104866878-104866900 CCAGTGGAGCAGAGGAGAAGGGG - Intronic
1123113215 14:105882524-105882546 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123115568 14:105892675-105892697 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123164773 14:106315675-106315697 CCTGGGAAGCAGCAGGGAGAGGG - Intergenic
1123402551 15:20002960-20002982 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1123511889 15:21009614-21009636 AGAGGAGAGCAGAGGGGAGGAGG + Intergenic
1124226726 15:27901466-27901488 CCTGAGGGGCAAAGGGGAGATGG - Intronic
1124495699 15:30185606-30185628 CCAGCCGAGCAGTGGGGAGCAGG + Intergenic
1124513603 15:30348067-30348089 AGAGGGGAGCAGAGGGGACAGGG - Intergenic
1124729318 15:32182698-32182720 AGAGGGGAGCAGAGGGGACAGGG + Intergenic
1124747874 15:32353040-32353062 CCAGCCGAGCAGTGGGGAGCAGG - Intergenic
1124844326 15:33275723-33275745 CCTGGGGAGAGGAGAGGAGAAGG - Intergenic
1125178702 15:36856718-36856740 GGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1125498673 15:40222696-40222718 TGAGGAGAGCAGAGAGGAGAGGG - Intergenic
1125972507 15:43923341-43923363 ACAGGGTAGCAGAGGGCACATGG + Intronic
1126064989 15:44819721-44819743 TCAGGGGAGCAGAGCAGAGCAGG + Intergenic
1126094843 15:45080868-45080890 TCAGGGGAGCAGAGCAGAGCAGG - Intergenic
1127412874 15:58726896-58726918 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
1127533607 15:59869007-59869029 CCAGGGTCCCATAGGGGAGATGG - Intergenic
1127657774 15:61071613-61071635 GGAGGGGAGAGGAGGGGAGAGGG + Intronic
1127681963 15:61306183-61306205 CAAAGGTAGCTGAGGGGAGATGG + Intergenic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1128091479 15:64922041-64922063 CCAGGGGAGCCGAGGGGACAGGG - Intronic
1128145689 15:65331299-65331321 CCGGGGGGACAGCGGGGAGAAGG + Intronic
1128151842 15:65368214-65368236 TCTGGAGAGAAGAGGGGAGAGGG + Intronic
1128246255 15:66134698-66134720 ACAGGGGCCCAGCGGGGAGAAGG + Intronic
1128342896 15:66835064-66835086 CCATGGGAACACAGGGGAGCCGG + Intergenic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128524952 15:68406086-68406108 CCAGGCCTGCAGAGGGGTGAGGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128775826 15:70319566-70319588 CCAGGAGAGCAGGGTGCAGAGGG + Intergenic
1129165504 15:73775066-73775088 CCATGGGAGCTGCTGGGAGATGG - Intergenic
1129225710 15:74169261-74169283 TCAGGGGAGGGGAGGGAAGAAGG + Intergenic
1129471195 15:75754996-75755018 CCAGGGCAGCAGGAGAGAGAAGG + Intergenic
1129629607 15:77244500-77244522 CCAGGAGAGCCCAGAGGAGAGGG - Intronic
1129659728 15:77546459-77546481 TCAGGGGAGAAAAGGGGAAATGG - Intergenic
1129733808 15:77948181-77948203 CCAGGGCAGCAGGAGAGAGAAGG - Intergenic
1129841775 15:78747822-78747844 CCAGGGCAGCAGGAGAGAGAAGG + Intergenic
1129946749 15:79545142-79545164 TCATGGGAACAGAGAGGAGAGGG + Intergenic
1130006839 15:80107822-80107844 AGAGGAGAGGAGAGGGGAGAGGG + Intronic
1130069805 15:80636839-80636861 AAAGGGGAGCAGAGGGGAGGAGG + Intergenic
1130180538 15:81622855-81622877 TTAGAGGAGCTGAGGGGAGAAGG - Intergenic
1130392733 15:83473290-83473312 CCAGGGGTGAGGAGGGGAGAGGG + Intronic
1130459981 15:84153661-84153683 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1130577407 15:85104868-85104890 CCAGGGGAGCACTGAGGAGCAGG + Intronic
1130905703 15:88239631-88239653 TCAGGGGTGCAGAGAGAAGAGGG + Intronic
1131487524 15:92834048-92834070 CCAGGAGAGAAGAGGGAGGAGGG - Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132258516 15:100400255-100400277 TCAGGGAAGCAGTGAGGAGAAGG - Intergenic
1132374823 15:101322143-101322165 CGAGGGATGCAGAGGAGAGAGGG + Intronic
1132587168 16:710648-710670 CCTGGGGAGAAGAGGGGCAAAGG - Intronic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132680850 16:1141171-1141193 CCAGGGCGGCAGAGGGGCCAAGG - Intergenic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1132801704 16:1757868-1757890 CGATGGGAGCAGAGGGCAGCAGG + Intronic
1133344657 16:5061793-5061815 AGTGGGGAGCAGAGGGGACAGGG + Intronic
1133359279 16:5161062-5161084 CAAGGGGAGGAGATAGGAGAGGG - Intergenic
1133631697 16:7628231-7628253 CCAGGCGTGCACAGGAGAGAAGG + Intronic
1134046170 16:11102899-11102921 CCTGAGGGCCAGAGGGGAGACGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134212473 16:12289304-12289326 CCAAGGGAGAGGAGGGAAGAAGG - Intronic
1134468772 16:14503067-14503089 TCAGGGGCGCAGCGGGGTGAGGG - Intronic
1134537817 16:15040748-15040770 CCTGGGGTGCTGGGGGGAGAGGG + Intronic
1134600322 16:15528700-15528722 CCAGGGAAGGAGAGGGGGGTGGG - Intronic
1134650259 16:15903060-15903082 GGAGGGGAGGAGAGGGGAAAGGG - Intergenic
1135080652 16:19431774-19431796 CCAGGGCAGGAGATGGGAAAAGG + Intronic
1135322708 16:21507782-21507804 CCAGGGGATGACACGGGAGATGG - Intergenic
1135424368 16:22324987-22325009 CCTGGGGACCAGAGGGGTGTTGG + Intronic
1135463497 16:22665051-22665073 CCCTGGAAGCAGAGGGGAAATGG + Intergenic
1135722101 16:24826816-24826838 CCAGGGGAGCAGAGCAAGGAGGG - Intronic
1135828592 16:25753185-25753207 CCACTGTAGCAGAGGGGAAAGGG - Intronic
1135852414 16:25976411-25976433 CTAGGGAAGCAGAGGTGAAAAGG - Intronic
1135880282 16:26249008-26249030 GCCGGGGAGTTGAGGGGAGAGGG - Intergenic
1136334193 16:29600945-29600967 CCAGGGGATGACACGGGAGATGG - Intergenic
1136393635 16:29980846-29980868 TCAGGGAAGCAGTGTGGAGAAGG + Intronic
1136995239 16:35184490-35184512 CCAGGGGAGCACAGCAGAGCTGG + Intergenic
1137350108 16:47706005-47706027 CCAACCGAGCAGAGGGGAAAGGG - Intergenic
1137540920 16:49361076-49361098 CAAGGGGACTAGAAGGGAGAGGG - Intergenic
1137762579 16:50952550-50952572 GCAGTGGAGCAGAAGGGACAAGG + Intergenic
1137801003 16:51262103-51262125 AGAGGGGAGGTGAGGGGAGAAGG - Intergenic
1138128534 16:54458312-54458334 CCAGGGGAGGAGGGCAGAGAGGG - Intergenic
1138531009 16:57634368-57634390 GCAGAGGAGCAGTGGGCAGAGGG - Intronic
1138532026 16:57639730-57639752 ACAGGGGAGAAGCGGGGAGCAGG - Intronic
1138599328 16:58045732-58045754 CCAGGGGAGCAGAGGGGCAGAGG + Exonic
1138873599 16:60922974-60922996 CCAGGGGAGGTGGGGGGAGCAGG + Intergenic
1138891715 16:61150673-61150695 CAAGGAGAGCAGAGAGGAGCAGG - Intergenic
1139377433 16:66508982-66509004 ACGTGGGGGCAGAGGGGAGAGGG + Exonic
1139589252 16:67924324-67924346 CTTGGGGAGCAGCGGGGAGAGGG + Intronic
1139612181 16:68067150-68067172 AGAGGGGAGGAGATGGGAGAGGG - Intronic
1139672032 16:68498632-68498654 CCAGGGGAGTAGAAGCTAGAAGG + Intergenic
1139786600 16:69397910-69397932 CCAGGGAAGGAGAGATGAGATGG + Intronic
1140271403 16:73469370-73469392 ACAGGGGTGCGGTGGGGAGAGGG + Intergenic
1141136884 16:81472458-81472480 CCAGGGGACCCCTGGGGAGATGG - Intronic
1141393206 16:83681612-83681634 CCAGGAGAGGAGAGGGGTGGAGG - Intronic
1141395349 16:83699595-83699617 CCAAGGGAGGACTGGGGAGAAGG - Intronic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141413527 16:83852914-83852936 ACTGGGGAGGAGAGGTGAGAAGG - Intergenic
1141611471 16:85183502-85183524 CCAGAGGACCACAGGGGTGAGGG - Intronic
1141625859 16:85260758-85260780 ACAGGGAAGCAGAGAGTAGATGG - Intergenic
1141784072 16:86186844-86186866 TTAGGGGAGGAAAGGGGAGAGGG + Intergenic
1142267623 16:89071794-89071816 GCAGAGGTGCGGAGGGGAGAGGG - Intergenic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1142545299 17:697378-697400 CCAGGGGAGCATAGGTAATATGG + Intronic
1142758304 17:2028626-2028648 CCAGAGAAGCTGGGGGGAGATGG + Intergenic
1142882667 17:2893937-2893959 GCAGGGAAGGAGAGGTGAGAAGG - Intronic
1143018454 17:3904171-3904193 CCAGGGCGGAGGAGGGGAGACGG + Intronic
1143528301 17:7484875-7484897 CCAGGGGAGGAGGGGGGAAGGGG - Intronic
1143550885 17:7629883-7629905 CTAGAGGAGGAGAGGGGAGATGG + Intronic
1143567665 17:7734320-7734342 CCTGGCGATCACAGGGGAGAGGG + Intronic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144521252 17:15953564-15953586 CAAGTGGGGCATAGGGGAGAAGG - Intronic
1144534771 17:16077499-16077521 AGAGGGGAGGAGAGGGGAGGGGG + Intronic
1144534798 17:16077556-16077578 GGAGGGGAGGAGAGGGGGGAGGG + Intronic
1144675409 17:17158547-17158569 GCACGGGAGCGGAGGCGAGAGGG + Exonic
1144871600 17:18375618-18375640 CCTGGGGAGAGGAAGGGAGAGGG - Intergenic
1145055363 17:19700094-19700116 CCAGGGCAGGAGATGGGAGCAGG + Intronic
1145249594 17:21289913-21289935 GCAGGGGACCAGCTGGGAGAGGG - Intronic
1145274763 17:21422848-21422870 GCAGGGAAGGATAGGGGAGAGGG + Intergenic
1145371646 17:22311324-22311346 CCAGGGGAGTACAGGGGAGTTGG + Intergenic
1145924035 17:28632836-28632858 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146123724 17:30216258-30216280 GGAGGGGAGGGGAGGGGAGAAGG + Intronic
1146272948 17:31496458-31496480 CCAAGGGAGCAGAGGGAAACTGG + Intronic
1146608963 17:34287977-34287999 CCAGGGAGGAAGAGAGGAGAGGG - Exonic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1146945444 17:36870126-36870148 CCAGGGGAGCTGGGGAGAGGAGG + Intergenic
1147228235 17:38997686-38997708 GCAGGGGAAGGGAGGGGAGAAGG - Intergenic
1147754859 17:42761402-42761424 CCCGGAGGGGAGAGGGGAGAGGG + Intronic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147894401 17:43741114-43741136 CTTGGGGAGCACAGAGGAGAGGG + Intergenic
1147915046 17:43880942-43880964 ACAGGGGAGCAGGGGGGAGTCGG + Intronic
1147959144 17:44155491-44155513 CCTGGGGAGCAGAGGTCTGAAGG + Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1147961124 17:44168230-44168252 GCAGCGGAGCAGAAGGGATATGG + Intergenic
1147998914 17:44376277-44376299 CCAGGGGTGGAGAAGGGAGATGG - Intronic
1148073385 17:44921591-44921613 TCAGGGAGGCAGAGGGGAGTGGG - Intergenic
1148174250 17:45550173-45550195 CCAGGGGATTAGAGGTGAGCTGG + Intergenic
1148206700 17:45784171-45784193 GAAGGGGAGCGGAGGGGAGAGGG + Intergenic
1148275012 17:46295274-46295296 CCAGGGGATTAGAGGTGAGCTGG - Exonic
1148297119 17:46512853-46512875 CCAGGGGATTAGAGGTGAGCTGG - Exonic
1148580882 17:48742957-48742979 CGAGGGCTGCAGAGAGGAGATGG - Intergenic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148716607 17:49720285-49720307 GGAGGAGAACAGAGGGGAGAGGG + Intronic
1148732708 17:49847187-49847209 CCAGGGGGGCAGACAGGACAAGG - Intronic
1148784685 17:50140324-50140346 CCAGGGGAGGAGAGATGAGAGGG + Intronic
1148794410 17:50190216-50190238 TCAGGGGAGAAGGGTGGAGACGG - Intronic
1148822006 17:50365205-50365227 TCAGGGGAGCAGTGTGGAAAGGG + Intergenic
1148864084 17:50619627-50619649 GCAGGGGAGCAGGGGTCAGAGGG - Intronic
1149187918 17:54023319-54023341 TCAGGGTAGCAGAGATGAGAAGG + Intergenic
1149200925 17:54185111-54185133 CCAGAGGAATAGAGGGGTGACGG - Intergenic
1149633727 17:58149065-58149087 CTAGGAGAGACGAGGGGAGAAGG - Intergenic
1149781497 17:59400026-59400048 CTAGGGTGGCACAGGGGAGATGG - Exonic
1150124617 17:62628084-62628106 GCGGGGGAGGAGAGGGGAGGAGG + Intronic
1150139900 17:62718821-62718843 GCAGGGGAGGGGAGAGGAGAAGG - Intronic
1150149484 17:62797596-62797618 CCAGGGGAGCAAGGTGAAGAAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150505375 17:65693275-65693297 TCAGGAGAGCAGTGGGGACAGGG - Intronic
1150658550 17:67056371-67056393 GCAGGGGGGCAGATGGGAGCAGG - Exonic
1150784656 17:68152622-68152644 TAAGGGGAGGAGAGGGGAGGGGG - Intergenic
1150947773 17:69765851-69765873 GGAGGGGAGGAAAGGGGAGAGGG - Intergenic
1151161775 17:72172112-72172134 GGAGGGGAGGAGAGGGGAGAGGG - Intergenic
1151304133 17:73252087-73252109 CCTGGGGAGCAGAAAGGAGTGGG + Intronic
1151337307 17:73447530-73447552 CCAGGGGATCATTGGGAAGATGG - Intronic
1151338931 17:73457309-73457331 GGAGGGGAGGAGAGGGGAGGGGG - Intronic
1151366105 17:73617322-73617344 CCTGCGGAGGGGAGGGGAGAGGG + Intronic
1151384134 17:73744800-73744822 CCCAGGGAGCTGTGGGGAGATGG + Intergenic
1151394326 17:73811655-73811677 CCAGGGCTGCTGAGGGGAGTGGG + Intergenic
1151436443 17:74100492-74100514 CCCTGGGAGCAGGAGGGAGAAGG + Intergenic
1151460728 17:74252641-74252663 CCTGGTGAGAAGAGAGGAGAAGG - Intronic
1151529401 17:74695015-74695037 TGAGGGGAGCAGGGGGCAGACGG + Exonic
1151562385 17:74877672-74877694 CCAGGGGAAGTGAGGGGAGAAGG - Exonic
1151654346 17:75488823-75488845 CCCGGGGAGAAGTGGAGAGAGGG + Exonic
1151765465 17:76131286-76131308 CCAGGGGACCAGGGAGGAGGAGG - Intergenic
1151887787 17:76933323-76933345 GGAAGGGAGCAGAGGGTAGAGGG - Intronic
1152045102 17:77930273-77930295 CCAGGGCAGCAGGAGGGAGCCGG + Intergenic
1152269130 17:79313578-79313600 TCAGGGGAGCAAGGGAGAGATGG + Intronic
1152322021 17:79613018-79613040 CATGGGGAGCTGAAGGGAGACGG - Intergenic
1152867386 17:82732357-82732379 CCAGGGGAGCCGAGAGGAGATGG + Intergenic
1153255434 18:3165791-3165813 CCATGGCTGCAGAGGAGAGAAGG - Intronic
1154194437 18:12255016-12255038 CCTGGGGAGCAGGGGGGACAAGG + Intronic
1155387346 18:25292922-25292944 TGAGGAGAGCAGAGTGGAGATGG - Intronic
1155517732 18:26640107-26640129 CCAGTGGTCCAGAGGAGAGAGGG + Intronic
1155566247 18:27137960-27137982 CCAGAGGACCAGAGGAGAGCAGG - Intronic
1156076733 18:33288226-33288248 GGAGGGGAGCGGAGGGGAGGAGG - Intronic
1156077783 18:33301427-33301449 CCAGTGGAGCTGTGGGAAGATGG + Intronic
1156366959 18:36438411-36438433 GCAGGGGAGCCGGTGGGAGAGGG - Intronic
1156468352 18:37362094-37362116 CCAGGGCAGATGAGGGGAGGAGG + Intronic
1157014003 18:43687545-43687567 TCAGGAGAGCAGAGAAGAGAGGG + Intergenic
1157298525 18:46462780-46462802 CCAGGGGTGGAGTGGGGGGAGGG - Exonic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157545709 18:48545090-48545112 CCAGGAAAGGAGATGGGAGACGG + Intronic
1158323070 18:56284649-56284671 TGGGGGGATCAGAGGGGAGAAGG - Intergenic
1158544501 18:58384676-58384698 CCAGGGGAGCAGAGGTATCAGGG - Intronic
1160223081 18:76991388-76991410 GCAGGGGAACACAGGGGACATGG + Intronic
1160227964 18:77025905-77025927 GCAGGGGAGCAGTGGGCAGCGGG + Intronic
1160250331 18:77198015-77198037 CCAGGTGTGCAGAGAGGAAAGGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160657725 19:281941-281963 CCAGGGGAGGACTGGGGGGAAGG + Intronic
1160722196 19:602653-602675 GCAGAGGAGCAGAGAGGAGCCGG - Intronic
1160763679 19:797872-797894 CGAGGGGAGCGGACGGGAGGCGG - Intronic
1160867061 19:1260663-1260685 CCAGGGGTGCAGCGGGCGGAGGG + Intronic
1160983295 19:1826515-1826537 AAAGGGGAGGCGAGGGGAGAGGG + Intronic
1161030728 19:2056697-2056719 GGAGGGGAGGAGAGGAGAGAAGG - Intergenic
1161058971 19:2204910-2204932 CCAGGGGAGGAGAGCTGGGATGG + Intronic
1161085419 19:2332902-2332924 GCAGGGGAGCAGAAGGAAGGTGG + Intronic
1161249196 19:3271240-3271262 CCAGGGGAGGTGGGGAGAGATGG - Intronic
1161356966 19:3824549-3824571 GCAGGGGAGCACAGTGGAGGTGG + Intronic
1161374667 19:3933350-3933372 GAAGGGGAGGAGAGGGGAGGAGG + Intronic
1161438697 19:4278994-4279016 GCTGGGGAGGGGAGGGGAGAGGG - Exonic
1161585334 19:5102546-5102568 CCAGGGGAGCAGGGGAGGAATGG + Intronic
1161592185 19:5133860-5133882 CTAGAAGAACAGAGGGGAGAGGG - Intronic
1161635870 19:5388645-5388667 GGAGGGGAGGGGAGGGGAGATGG + Intergenic
1161647648 19:5463833-5463855 CCAAGGGAGCTGTTGGGAGATGG + Intergenic
1161767228 19:6214440-6214462 CCAGGGGAGCATCGGAGGGACGG - Intronic
1161792804 19:6370748-6370770 CAAGGGGAGCAGAGGGTGGGGGG + Intergenic
1161957970 19:7506765-7506787 CCAGGGGAGGAGAGAGGAGCTGG - Intronic
1162111940 19:8404120-8404142 GCAGGAGAGGGGAGGGGAGAGGG - Exonic
1162129261 19:8515430-8515452 CCACTGGAGCAGAGTGGAGGCGG + Intergenic
1162753488 19:12843307-12843329 CGTGGGGAGGAGAGTGGAGACGG + Intronic
1162802244 19:13118104-13118126 CCAGGGGCATAGAGAGGAGACGG + Intronic
1163378498 19:16948933-16948955 GGAGAGGAGCAGAGGGGGGAGGG + Intronic
1163451376 19:17379285-17379307 CCAGGGTAACAGAGTGGGGAGGG + Intergenic
1163752458 19:19085828-19085850 CAAGAGGAGAGGAGGGGAGAGGG + Intronic
1163864894 19:19764828-19764850 GAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1164235033 19:23324208-23324230 CCAGGAGAGGAGAGGAGAAAAGG - Intronic
1164285967 19:23818017-23818039 CTATGGGAGGAGAGGGGATAAGG + Intronic
1164450508 19:28358859-28358881 CTAGGGGAGGGGAGGGGAGGGGG + Intergenic
1164537561 19:29097574-29097596 CCTGGGAAGGAGAGGGGAGTGGG - Intergenic
1164597421 19:29539402-29539424 CCAGGGGAGAAGTGGGGAGAAGG + Intronic
1164615298 19:29664006-29664028 AGAGGGGAGCAGCGGGGGGAGGG - Intergenic
1164771375 19:30812030-30812052 CCAGGGGAGGAGTGGGCAGTAGG - Intergenic
1164802242 19:31087305-31087327 CCAGGTGAGCAGGGAAGAGAGGG - Intergenic
1164825196 19:31279677-31279699 CCAGAGGAGCATACGGCAGATGG - Exonic
1165097270 19:33416521-33416543 CCAGGTGAGCAGGAGGGAGCAGG - Intronic
1165245271 19:34494947-34494969 CTGGGGGAGCAGATGAGAGATGG + Intronic
1165449082 19:35871882-35871904 CCCGGGGAGCAGAGTAGAGGGGG + Exonic
1165717076 19:38053141-38053163 TGAGGGGAGCCCAGGGGAGATGG + Intronic
1165854061 19:38869572-38869594 CCAGATGAGCTGCGGGGAGAGGG - Exonic
1165855626 19:38878067-38878089 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
1165869087 19:38957995-38958017 ACTTGGGAGCTGAGGGGAGAAGG + Intronic
1166158049 19:40930131-40930153 CCAGGAGAGTGGAGGAGAGAGGG + Intergenic
1166166916 19:40997160-40997182 CCAGGAGAGTGGAGGAGAGAGGG + Intronic
1166234945 19:41449135-41449157 CGAGGGGAGGGGAGGGGAAAAGG - Intergenic
1166504213 19:43361423-43361445 GCTGGGGAGCAGAGGGAAGGTGG - Exonic
1166506246 19:43373335-43373357 GCTGGGGAGCAGAGGGAAGGTGG + Intergenic
1166658149 19:44627265-44627287 GCAGGAGAGCAGGGAGGAGAGGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166993981 19:46710619-46710641 CTAGGGGAGCAGAAGGGTGGCGG - Intronic
1167166474 19:47802980-47803002 CCTGGGGGGCAGAGGGGACAGGG + Exonic
1167175369 19:47860780-47860802 CCTGGGGGGCAGAGGGGACAGGG - Intergenic
1167461028 19:49624871-49624893 CAAGTGGAGCAGAGTGGGGAGGG + Exonic
1167621631 19:50564012-50564034 CAAGGGAAGGAGAGTGGAGAGGG + Intronic
1167621749 19:50564618-50564640 CCAGGGAAGATGAGGGGAGATGG + Intronic
1168346544 19:55652812-55652834 GCAGGGGCGCGGCGGGGAGAGGG - Exonic
1168417284 19:56176676-56176698 CCAGGAGGGCAGAGGGGTGGAGG + Intronic
1202713169 1_KI270714v1_random:28375-28397 CCATGGGAGCTGGGGGGTGAAGG - Intergenic
925045580 2:770980-771002 CCAAGGGAGCAGAGTGTGGAGGG - Intergenic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
925631560 2:5899062-5899084 CTAGGTTAGCAGATGGGAGAAGG - Intergenic
925799760 2:7586630-7586652 CCAGAAGACCAGAGGGGAGAAGG - Intergenic
925802042 2:7611044-7611066 CCAGGTGAGCAGAGCAGACAGGG - Intergenic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
925913752 2:8589675-8589697 GCAGGGGAGGGGAAGGGAGAGGG + Intergenic
925913762 2:8589697-8589719 GGAGGGGAGGAAAGGGGAGAGGG + Intergenic
925913781 2:8589741-8589763 GGAGGGGAGGAAAGGGGAGAGGG + Intergenic
925913791 2:8589763-8589785 GGAGGGGAGGAAAGGGGAGAGGG + Intergenic
925913801 2:8589785-8589807 GGAGGGGAGGAAAGGGGAGAGGG + Intergenic
925913811 2:8589807-8589829 GGAGGGGAGGAAAGGGGAGAGGG + Intergenic
926025367 2:9538006-9538028 GGAGGGGAGGAGAGGGGAGGGGG + Intronic
926459275 2:13108984-13109006 CCAGGGGAAAAGGTGGGAGAAGG + Intergenic
926645980 2:15290033-15290055 GGAGAGGAGAAGAGGGGAGAGGG + Intronic
926828229 2:16931287-16931309 CAAGGGAAGAATAGGGGAGAAGG - Intergenic
926921665 2:17946387-17946409 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
927181631 2:20450621-20450643 CTCCAGGAGCAGAGGGGAGAGGG + Intergenic
927200115 2:20572885-20572907 CCATGGGAGCAGAGGGGCCTGGG + Intronic
927538775 2:23887943-23887965 CGAGGGGAAAAGAAGGGAGATGG - Exonic
928029895 2:27769230-27769252 TCAAGAGAGGAGAGGGGAGAGGG - Intergenic
928196963 2:29223038-29223060 CCAGGGGAGCAGGGGAGCAAAGG - Intronic
928250812 2:29677232-29677254 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
928276153 2:29901929-29901951 TCAGGGAAGCAGAGGGGAGGGGG + Intronic
928331381 2:30360394-30360416 CCAGGGGAGGAAAGGACAGATGG + Intergenic
928357163 2:30628577-30628599 TCAGTGGAGCAGAAGAGAGAAGG + Intronic
929048243 2:37811832-37811854 ACAGGGTAGCACAAGGGAGAGGG + Intergenic
929419810 2:41779092-41779114 CCAGGGAAACAGATGGAAGAGGG + Intergenic
929444522 2:41991999-41992021 GCAGGAGAGGGGAGGGGAGAGGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
929687831 2:44049618-44049640 TCAGTGGAGGAGAGTGGAGAGGG + Intergenic
929910418 2:46085024-46085046 CCAGGGGTGGAGATGGGAAATGG - Intronic
930480729 2:51944780-51944802 CCAGGGTGGCAGGGGAGAGAAGG - Intergenic
930639505 2:53840566-53840588 GGAGGGGAGGGGAGGGGAGAGGG + Intergenic
931228885 2:60357223-60357245 TGAGGGGTGCAGAGGGGAGTGGG - Intergenic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931442003 2:62296592-62296614 CCAAGGGAGCAGAGGAGGAAGGG + Intergenic
931461399 2:62453309-62453331 CCAGGGGAGCAGGAGGCACACGG + Intergenic
931695049 2:64865194-64865216 CCCGGGGAGCAGAGAGGCGGAGG - Intergenic
931696588 2:64875487-64875509 CTAGGGGAGAAGATGGGAAAGGG - Intergenic
931721243 2:65069179-65069201 CCATGAAAGCAGAGGGGAAATGG + Intronic
932030984 2:68184143-68184165 CCAGGGGAACAGAGTAGGGAAGG + Intronic
932222635 2:70011480-70011502 CCAGGTGAGCAGATGAGGGAAGG + Intergenic
932261364 2:70330461-70330483 TCTGGGGTGCAGAGGAGAGAGGG - Intergenic
932470299 2:71950786-71950808 CCAAGGGAGCAGAGGTGAGTGGG - Intergenic
933483107 2:82882282-82882304 CCAAGGAAGCAGAGTGGAGAGGG - Intergenic
933663468 2:84946095-84946117 CGAGGGGAGGGGAGGGGAGAGGG + Intergenic
933663478 2:84946117-84946139 GGAGGGGAGAGGAGGGGAGAGGG + Intergenic
933776331 2:85773418-85773440 CCTGGGGAGGAAAGGAGAGAAGG + Intronic
933837788 2:86259842-86259864 CTAGGGGAGAAGTGGGAAGAGGG + Intronic
933946003 2:87286674-87286696 CCAGGGGAGGAGACAGTAGAGGG + Intergenic
934573143 2:95384571-95384593 GCTGGGGGGCAGGGGGGAGAGGG + Exonic
934715349 2:96539727-96539749 GCTGGGCAGCAGCGGGGAGAGGG - Intronic
934775088 2:96932269-96932291 GCTGGGTAGGAGAGGGGAGAAGG - Intronic
934901769 2:98165526-98165548 ACAGAGGTGCAGAGGGCAGAGGG + Intronic
934947135 2:98550196-98550218 TATGGGGAGCAGGGGGGAGACGG - Intronic
935308320 2:101759472-101759494 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
935672911 2:105570872-105570894 CCAGGGGAGGACAGGGGAGGAGG - Intergenic
935728500 2:106045169-106045191 CCAGGGAAGTACAGTGGAGATGG - Intergenic
936152630 2:110030045-110030067 CCGGGGGAGCAGGGGCCAGAGGG + Intergenic
936192050 2:110341367-110341389 CCGGGGGAGCAGGGGCCAGAGGG - Intergenic
936334208 2:111574912-111574934 CCAGGGGAGGAGACAGTAGAGGG - Intergenic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
936816132 2:116463492-116463514 TCAGGGGAGATGAGGGGATAGGG - Intergenic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
937043553 2:118838702-118838724 ACAGGGGAGCAGGGCAGAGAAGG - Intergenic
937150511 2:119682828-119682850 CAAGGAGAGCAGAGGGGTGGAGG + Intronic
937223812 2:120356923-120356945 CCCCGGGAGCAGAGGTGGGATGG - Intergenic
937236262 2:120433417-120433439 GCAGGGGAGGAGAGTGGAAAAGG - Intergenic
937255714 2:120553989-120554011 CTAGGGGGGCTGAGGCGAGAGGG + Intergenic
937268522 2:120632485-120632507 CTAGGGGAGCACAGAGGAGCTGG + Intergenic
937345270 2:121121422-121121444 CCATGGGAGCAGGGCCGAGATGG - Intergenic
937439973 2:121907305-121907327 TCAAGGTAGGAGAGGGGAGATGG - Intergenic
937708558 2:124950484-124950506 CCAGGGATGCAGAATGGAGAAGG - Intergenic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
937818057 2:126275542-126275564 TCAGGGGAGGAGAGGAGGGATGG - Intergenic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
937914470 2:127092171-127092193 TCAGGGGAGCAGAGGGGCTCCGG + Intronic
938062289 2:128263038-128263060 CAAGGGGAGCAGTGGGGAGCAGG + Intronic
938139249 2:128782931-128782953 CCTGGTGAGCAGTGTGGAGAGGG - Intergenic
938743139 2:134251896-134251918 CCAGGGGTGGGGAGGAGAGAGGG - Intronic
939606665 2:144262802-144262824 AGATGGGAGGAGAGGGGAGAGGG + Intronic
939606703 2:144262905-144262927 AGATGGGAGGAGAGGGGAGAGGG + Intronic
939623251 2:144446413-144446435 AAAGGGGAGCAGAGGGGATGTGG - Intronic
939628761 2:144510366-144510388 CCAGCGGACCAGAGAGGTGAGGG - Intronic
939731709 2:145792921-145792943 CCAGGGAAGTAGGGGGAAGATGG + Intergenic
940079093 2:149779852-149779874 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
940886991 2:158998849-158998871 CCAAGAGATCAGAGGGGAGGGGG - Intronic
941272561 2:163448692-163448714 CAAGGGGAGGGGAGGGGAGGGGG + Intergenic
941376452 2:164737234-164737256 CCAGGAAAGCAAAGGGAAGAGGG + Intronic
941743035 2:169056379-169056401 CCAGAGGTACAGAGGGGAGCTGG + Intergenic
942100105 2:172572206-172572228 CTAGGGGAGGGGAGGGGAGCAGG - Intronic
942129329 2:172862914-172862936 GCAGTGGAGCACAGGGGAGGTGG + Intronic
942565131 2:177258435-177258457 CCAGGAGAGTTGAGGGGAAATGG + Intronic
942836611 2:180306203-180306225 CCATGGGAGCAGAGTGGGGAGGG + Intergenic
943748046 2:191482842-191482864 GATGGGGAGCTGAGGGGAGAGGG + Intergenic
944325789 2:198401963-198401985 ACAGTGGAACAGAGGGCAGAAGG - Intronic
944530393 2:200662271-200662293 GCAGGGCAGCAGAGGAGAGAGGG + Intronic
944605431 2:201347859-201347881 TCAGGGGAGCAGGGGCGGGAGGG - Intronic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945255901 2:207802894-207802916 CCAGGGGTGGGGAGGGGAAATGG - Intergenic
945412844 2:209532938-209532960 TCAGGGGAGCAGGGAGGAGTGGG - Intronic
946040804 2:216781302-216781324 GCAGGGGAGAAGAGGGGGAAGGG - Intergenic
946321453 2:218956928-218956950 CCAGAGGAACATAAGGGAGATGG + Intergenic
946361600 2:219222316-219222338 CCCGGGTTGCAGCGGGGAGAAGG + Exonic
946369149 2:219270108-219270130 CCAGGGGACCTGAAGGGAGTGGG - Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947521609 2:230850067-230850089 AGAGGGGAGGAGAGGGCAGAGGG + Intergenic
947641613 2:231710414-231710436 CCCGGGGAGCAGTGGGGGCAGGG - Intronic
947718592 2:232354088-232354110 CATGGGGAGCTGAGTGGAGAAGG + Intergenic
947731076 2:232432126-232432148 CACGGGGAGCTGAGTGGAGAAGG + Intergenic
948052396 2:234988513-234988535 CCAGGGGAGCAGAGCCCAAAGGG + Intronic
948079136 2:235191348-235191370 CCAGGAGAGGAGAGGAGAGAAGG - Intergenic
948094103 2:235320024-235320046 CCTGGGGTAGAGAGGGGAGAGGG - Intergenic
948175602 2:235940221-235940243 CCAGGGGAACACAGAGGAGGTGG - Intronic
948381645 2:237554370-237554392 CCAGTGGGGCAGAGGACAGAGGG + Exonic
948420982 2:237859784-237859806 CTAGGGGAGAGGAGGGGAGCGGG + Intronic
948502810 2:238407261-238407283 CCAGGGGACCTGGGGTGAGAGGG + Intergenic
948667609 2:239546181-239546203 CCAGGGGAGCCGAGGAGGCAGGG - Intergenic
948683869 2:239658669-239658691 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683881 2:239658701-239658723 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683892 2:239658733-239658755 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683922 2:239658827-239658849 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683934 2:239658859-239658881 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683945 2:239658891-239658913 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683976 2:239658985-239659007 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683988 2:239659017-239659039 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948683999 2:239659049-239659071 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684029 2:239659143-239659165 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684041 2:239659175-239659197 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684053 2:239659207-239659229 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948684064 2:239659239-239659261 GAAGGGGAGCAGAGGAGAGGAGG - Intergenic
948762946 2:240203948-240203970 GCAGGGAAGCAGAGGGCTGAGGG + Intergenic
948868848 2:240788331-240788353 CCAGGGCAGCACAGTGGGGAGGG + Intronic
1168887110 20:1267271-1267293 CCAGGGAAGCTCCGGGGAGACGG - Intronic
1168955722 20:1832948-1832970 CCAGTGGTGCAGCGGGGAGGTGG - Intergenic
1169259710 20:4127441-4127463 ATAAGGGAGCAGAGGGGAGATGG + Intronic
1169276581 20:4237147-4237169 CCAGAGGACCAGGAGGGAGATGG + Intronic
1169346960 20:4836222-4836244 CCAGGCAAGCAGGGAGGAGATGG + Intergenic
1169347707 20:4841896-4841918 GGATGGGAGCAGGGGGGAGATGG - Intergenic
1170415312 20:16133308-16133330 CCATGGCAGCAGAGCTGAGACGG + Intergenic
1170728294 20:18948878-18948900 CCAGGGAAGGAGAGGGAACAAGG + Intergenic
1170763848 20:19273969-19273991 CCAAAGGCGAAGAGGGGAGAAGG + Intronic
1170763858 20:19274033-19274055 CCAGAGGGGAAGAGGGGAGAAGG - Intronic
1170873937 20:20233485-20233507 ACAGGGGGGCATATGGGAGATGG + Intronic
1171012519 20:21516315-21516337 CCAGGGGAAAAAAGGGGGGAAGG - Intergenic
1171263607 20:23752830-23752852 CCAGGAGAGGAGAGGGTGGAAGG + Intergenic
1171430650 20:25081582-25081604 CCAGGGGTGCGGTGGGGCGATGG + Intronic
1171545565 20:25997953-25997975 CCAGGGGAGTATGGGGGAGTTGG + Intergenic
1171812560 20:29757023-29757045 CTGGGGGAGAAGAGGGGACAAGG + Intergenic
1171906681 20:30905264-30905286 CTGGGGGAGAAGAGGGGACAAGG - Intergenic
1171974836 20:31587867-31587889 CCAGGGGAGCGGCGCGCAGATGG - Intergenic
1172104975 20:32511315-32511337 CCAGGTGGGGTGAGGGGAGACGG + Intronic
1172107165 20:32523710-32523732 CCAGGGCAGCGGAGGGCAGTTGG - Intronic
1172147009 20:32763759-32763781 CCAGGGGAGGAAAAGGGAGCAGG - Intronic
1172443939 20:34983580-34983602 ACAGTGGAGCCCAGGGGAGAGGG + Intronic
1172474209 20:35225695-35225717 CCAGGGGAGGGGAGAGGAGAGGG - Intergenic
1172581102 20:36049602-36049624 TCAGGGGAGGAGAGAGGAGGGGG - Intergenic
1172621383 20:36320318-36320340 CCAGGACAGCAGAGGAGGGAGGG - Intronic
1172855726 20:38000713-38000735 TCAGGGGAGCAGAGTGGAAATGG + Intronic
1172869547 20:38127194-38127216 GCAGAGGAGCAGATGGGAGAAGG - Intronic
1173024992 20:39299242-39299264 CCAGAGGGTCAGAGGAGAGATGG - Intergenic
1173157595 20:40627705-40627727 GCAGGGGGGCAGAGAGGAGCAGG + Intergenic
1173183449 20:40821399-40821421 CCACAGGAGGAGAGGGGAGGGGG - Intergenic
1173274335 20:41566502-41566524 CCACAGGAGCAGAGTGGGGAAGG - Intronic
1173800410 20:45891366-45891388 GCGGGGGAGCAGAGGTGAGCTGG + Exonic
1173826396 20:46050531-46050553 CCGAAGGAGCAGAGGTGAGATGG + Intronic
1174020826 20:47526771-47526793 CCATGGGGAGAGAGGGGAGAGGG + Intronic
1174173507 20:48631041-48631063 CCTGGGGAGCAGAGGGCTGGGGG - Intronic
1174445949 20:50591384-50591406 ACAGGGGAGTGGAGGGGAAAGGG + Intronic
1175125821 20:56750765-56750787 GGAGGGGAGGGGAGGGGAGAGGG + Intergenic
1175225701 20:57442686-57442708 GCAGAGGGGCAGAGGGGACAGGG - Intergenic
1175252281 20:57616790-57616812 AGAGGGGAGTAGAGGGCAGAAGG + Intronic
1175569875 20:60010490-60010512 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1175609556 20:60339405-60339427 CCCGGGGATCCTAGGGGAGAAGG + Intergenic
1175720500 20:61283873-61283895 CCAGGGTGGCAGTGGGGACATGG - Intronic
1175723876 20:61303699-61303721 TCAGGGGAGCAGGGAGGAGGAGG + Intronic
1175943384 20:62548038-62548060 GAAGGGGAAGAGAGGGGAGAAGG - Intergenic
1176138786 20:63536193-63536215 CCAGGTGAGAAGTGGGGAGGAGG - Intronic
1176240785 20:64074975-64074997 CCAGGGGAGCAGAGGCAGAAGGG - Intronic
1176270397 20:64233176-64233198 AGAGGGGAGGAAAGGGGAGAGGG - Intronic
1176307976 21:5134273-5134295 CCAGGGGAGTAGTGGGGTGGGGG - Intronic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1176722230 21:10402161-10402183 GCAGGGGTGCTGTGGGGAGAGGG - Intergenic
1177184673 21:17780365-17780387 CCATGGGGGCAGTGGGGAGCAGG - Intergenic
1177705991 21:24705468-24705490 CCATGGAAGCAGAGTGGAGAGGG + Intergenic
1177779501 21:25607505-25607527 CCGGGGGAGGAGGGCGGAGAAGG - Exonic
1177816948 21:25988020-25988042 TCGGGAGAGCTGAGGGGAGAGGG + Intronic
1178270684 21:31186671-31186693 CCTGGGGGGCTGAGGTGAGAGGG + Intronic
1178379894 21:32099067-32099089 CCAGGACAGAAGAGGTGAGAAGG - Intergenic
1178506937 21:33170140-33170162 CCAAGGGAGCAGAGGAGGGCAGG - Exonic
1178517901 21:33264265-33264287 CCAGGTGAGCAGTGGAGAGAAGG + Exonic
1178582407 21:33847848-33847870 CCAGGAGATCAGAGGAAAGATGG - Intronic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1179049553 21:37877220-37877242 CCTGGGGAGAAAAGGTGAGAGGG - Intronic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179215922 21:39366950-39366972 CGAGGGGAGGGGAGGGGAAAGGG - Intergenic
1179602619 21:42490196-42490218 GCAGGAGAGGAGTGGGGAGACGG - Intronic
1179819911 21:43930692-43930714 TGAGGGGAGCAGAGGGAAGCAGG + Intronic
1179849085 21:44127759-44127781 CCAGGGGAGTAGTGGGGTGGGGG + Intronic
1179873981 21:44258277-44258299 CCCTGGTAGCAGATGGGAGAGGG - Intronic
1180303415 22:11054923-11054945 GCAGGGGTGCTGTGGGGAGAGGG - Intergenic
1180738428 22:18035946-18035968 CCAAGGTAACAGAGAGGAGACGG - Intergenic
1180857777 22:19059193-19059215 ACAAGGGAGCAGAGGTGAAAAGG + Intronic
1181317333 22:21979137-21979159 CCAGGTGAGTAGGAGGGAGAGGG + Intronic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181537932 22:23556346-23556368 CCAGATCAGCAGAGGGGAGTGGG - Intergenic
1181584332 22:23844871-23844893 GGAAGGGAGCAGAGGAGAGAAGG + Intergenic
1181630184 22:24147083-24147105 CCAGGGCAGCTGGGGGCAGAGGG - Intronic
1181634095 22:24166422-24166444 CCAGAGGTGCAGAGGAGGGAAGG + Intronic
1181688490 22:24545056-24545078 CCAGAGGGACAGAGGGCAGATGG + Intronic
1181876650 22:25945700-25945722 GGAGGGGAGGCGAGGGGAGAGGG - Intronic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182614545 22:31578212-31578234 CCAGGGAAGCAGTGGGCAAAGGG - Intronic
1183292323 22:37010405-37010427 CCTGGGGAGCAGTGGAGGGAGGG - Intergenic
1183544612 22:38448890-38448912 CCAGCAGGGCAGAGGGGAGCTGG - Intronic
1183544948 22:38450493-38450515 AGAGGGGAGCAGAAGGGAAATGG - Intronic
1183653370 22:39171614-39171636 GCAAGGGAGGAGAGGGGAGCTGG - Intergenic
1183688697 22:39376234-39376256 CCAGGGGCTCAGTGGGGAAAGGG - Intronic
1183735545 22:39642938-39642960 CCAGGGGACCTGAGGAGGGAGGG + Intronic
1183738665 22:39657973-39657995 CCAAGGTAGCAGAGTTGAGAGGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183928812 22:41224644-41224666 CCAGGGGAGGCGTGTGGAGATGG + Intronic
1183975908 22:41512052-41512074 CCAGGGGGGCTGAGGGGAACTGG + Intronic
1184087951 22:42276827-42276849 CCAGGGGAGCAGAAAGCAGCAGG + Intronic
1184097634 22:42325218-42325240 CCAGGGGAGCACAGAGGTGGTGG - Intronic
1184106388 22:42369553-42369575 CCACGGAAGCAGAGAGGAAAAGG - Intergenic
1184186509 22:42868693-42868715 GCAGGGCAGGAGAGGGAAGATGG + Intronic
1184280227 22:43433255-43433277 ACAGGGCAGCAGAGGGGACAGGG - Intronic
1184408013 22:44311168-44311190 CCAGGGGAGCTGAGGTGGGCCGG + Intronic
1184482512 22:44756133-44756155 GCAGGGGAGGAGAGTGGAGCCGG + Intronic
1184532075 22:45062369-45062391 GGAGGGGAGGGGAGGGGAGAGGG + Intergenic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184863862 22:47191941-47191963 ACAGGGGAGGAGAGAGGAGGGGG + Intergenic
1185085163 22:48737037-48737059 CCTGGGGACCAGGGGAGAGACGG - Intronic
1185332684 22:50258739-50258761 CCAGGGGTGCTGAGGGGACCAGG - Intronic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
1185398002 22:50602227-50602249 ACAGGGCTGCAGAGGGGACAAGG - Intronic
949578269 3:5360094-5360116 CCAGGGGAGCTGAAGTCAGAGGG + Intergenic
949587280 3:5454294-5454316 CCAAGGGAGAAGAGAGCAGAGGG + Intergenic
950092496 3:10305764-10305786 CCTGAGAAGCGGAGGGGAGAGGG - Intronic
950400689 3:12767315-12767337 CCAGGACAGCAGGGGGGAAAAGG + Intronic
950458945 3:13109653-13109675 GCAGGGGAGGAGAGGGGAGCAGG - Intergenic
950466387 3:13157640-13157662 CCAGGGGAGCAAAGGAAGGAAGG + Intergenic
950520153 3:13493308-13493330 TGAGGGGAGGAGAGGGAAGAGGG - Intronic
950525209 3:13519164-13519186 CCAGGGTATCAGAGGAGGGAAGG - Intergenic
950611635 3:14130801-14130823 CCCTGGGAGCAAAGGGGAGTGGG - Exonic
950766554 3:15277456-15277478 GCAGAGGAGAAGTGGGGAGAAGG + Intronic
950799140 3:15535215-15535237 CCTGGGGAAGAGAGGGGAGGAGG + Intergenic
951180337 3:19652258-19652280 CAATGGGAGCAGAGGGGATTAGG + Intergenic
951365998 3:21783346-21783368 CCAGTGGAACAGAGGGAAAAAGG + Intronic
951505051 3:23435799-23435821 TCATGAGAGCAGAGTGGAGAGGG + Intronic
951611375 3:24495262-24495284 CCAGGGGCGCAGCGAGGAAATGG + Intronic
952210869 3:31227999-31228021 TCTGGGGAGCTGAGGGTAGAAGG + Intergenic
952253072 3:31673004-31673026 GGAGTGGAGAAGAGGGGAGAAGG - Intronic
952331259 3:32366375-32366397 CGAGGGGGCCAGAGAGGAGATGG - Intronic
952877245 3:37956625-37956647 CCAGGGGAAGACTGGGGAGAGGG - Intronic
953116816 3:40000894-40000916 CCAGGGTAGGAGAAAGGAGAAGG - Intronic
953375109 3:42421867-42421889 CCAGGGGTGCAGTGCGGAGCGGG + Intergenic
953818992 3:46188110-46188132 GCAGGGGAGCAGGAGTGAGAGGG - Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
953886500 3:46717343-46717365 CTAGGGGAGCAGAAGGGACGGGG - Intronic
954013360 3:47663164-47663186 GTAGGGGAGAGGAGGGGAGAGGG + Intronic
954036996 3:47856194-47856216 CCATGTGAGCTGAGAGGAGATGG - Intronic
954116252 3:48468407-48468429 CCAGGGGAGATGCGGGGACAGGG + Exonic
954137754 3:48589843-48589865 CCAGTGGAGGAGTGGGGAGGTGG + Intronic
954155183 3:48681475-48681497 CCTGGGGACCACAGAGGAGAAGG - Exonic
954218855 3:49140059-49140081 GCAGGAGTGCAGAGGTGAGAGGG - Intergenic
954349960 3:50035048-50035070 GGAGGGGAGGAGAGGGGAGTAGG - Intronic
954388675 3:50257833-50257855 CCAGGGGACAAGGGAGGAGAAGG + Intronic
954530051 3:51310435-51310457 CCATGGGAACAGAGAGGAGAGGG + Intronic
954715832 3:52526344-52526366 CCAGGGGAGCAATGTGGAGGTGG - Intronic
954985767 3:54790294-54790316 CCAGCAGATGAGAGGGGAGAAGG - Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955576226 3:60366657-60366679 GCAGGGGAGCGGACGGCAGAAGG - Intronic
956258626 3:67311824-67311846 TCAGGGGAGCCAAGGTGAGAGGG + Intergenic
956626662 3:71273443-71273465 CAAGGGGATTAGAGGAGAGAAGG - Intronic
957064525 3:75510584-75510606 CAAGGGGAGGAGATAGGAGAGGG - Intergenic
957469323 3:80638272-80638294 CCTGGGAACCTGAGGGGAGAGGG - Intergenic
957676740 3:83377289-83377311 CTAGTGGAGCAGGGAGGAGAGGG - Intergenic
958100275 3:88999750-88999772 GAAGGGGAGCACAGGTGAGAGGG - Intergenic
959167094 3:102793941-102793963 AGAGGGGAGGGGAGGGGAGAGGG + Intergenic
959849626 3:111071630-111071652 CCCGGGGATCAGACGGGAGGTGG + Intronic
960223861 3:115147430-115147452 ACGGGGGGGCGGAGGGGAGAAGG - Intergenic
960620706 3:119633972-119633994 ACAGGGGAGAGGAGAGGAGATGG + Intergenic
960943511 3:122950279-122950301 CCGGTGAAGCAGTGGGGAGAGGG + Intronic
961035978 3:123641824-123641846 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
961050926 3:123746389-123746411 CCAGGGGTGGAGATGGGAGAAGG + Intronic
961288829 3:125828816-125828838 CAAGGGGAGGAGATAGGAGAGGG + Intergenic
961329381 3:126129747-126129769 CCAGGGCAGGAGTAGGGAGAAGG - Intronic
961491079 3:127257270-127257292 ACAGGTGTGCAGTGGGGAGAGGG - Intergenic
961532275 3:127547100-127547122 CAAGAGGAGAGGAGGGGAGAGGG + Intergenic
961809683 3:129514699-129514721 ACAGGGAAGCACAGGGGAGCTGG - Intronic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
962203086 3:133415896-133415918 AGAGGTGAGTAGAGGGGAGAGGG - Intronic
962203094 3:133415932-133415954 TCAGGCGAGTAGAGGGGAGATGG - Intronic
962203330 3:133416903-133416925 ACGGGTGAGTAGAGGGGAGAGGG - Intronic
962203538 3:133417717-133417739 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962203583 3:133417917-133417939 ACGGGTGAGTAGAGGGGAGATGG - Intronic
962374916 3:134851415-134851437 CCAGGGGAGCAAATGGGAAGTGG - Intronic
962744825 3:138389495-138389517 CCAGTGGAGAGGAGGGGAAAGGG + Intronic
962747891 3:138411002-138411024 CAACGGGAGCAGAGGAGAGATGG + Intergenic
963044817 3:141094775-141094797 CCAGGGGGGCAAAGGGGCGGGGG - Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963942208 3:151106305-151106327 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
964762664 3:160149012-160149034 CCAGGTGACAAGAGGGGAAAAGG - Intergenic
965752361 3:171989475-171989497 CCAGGGGCTGAGATGGGAGAAGG - Intergenic
966093358 3:176167643-176167665 TGAGGAGAGCAGAGGGGAAAAGG + Intergenic
966140527 3:176751919-176751941 GGAGGGGAGGGGAGGGGAGAAGG + Intergenic
966179251 3:177172667-177172689 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
966754513 3:183355934-183355956 CAAGGGGAGGGGAGGGGGGAAGG - Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967271539 3:187737461-187737483 CCAGGGGAGGAGGGAGGAAAAGG - Intronic
967328491 3:188266523-188266545 GGAGGGGAGGAGAGGAGAGACGG + Intronic
967762654 3:193242385-193242407 CCTGGGGAGTGGAGGAGAGAGGG + Intronic
968054977 3:195684305-195684327 GCAGGGGAGCAGAGGGGATGTGG + Intergenic
968100936 3:195964971-195964993 GCAGGGGAGCAGAGGGGATGAGG - Intergenic
968136669 3:196224725-196224747 AGAGGGGAGGAGAGGGGAGAGGG + Intronic
968265217 3:197357445-197357467 CCCGGGCGGCACAGGGGAGATGG + Intergenic
968270493 3:197399632-197399654 CCAGGGATGCAGAGGAGAGCTGG + Intergenic
968503103 4:960270-960292 CAAGGGGCTCAGTGGGGAGAGGG + Exonic
968546314 4:1200737-1200759 GGAGGGGAGCAGCGAGGAGAGGG + Intronic
968684608 4:1949067-1949089 CCAGGGGAGCACAGGGCATGGGG - Intronic
968762971 4:2451808-2451830 CCAGGCTAGCAGAGGACAGAAGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
968943756 4:3653023-3653045 CCTGGGGAGCCCACGGGAGAGGG - Intergenic
968970535 4:3791359-3791381 CCAGGGAAGGTGAGGGCAGACGG - Intergenic
969091628 4:4698260-4698282 GCAGTGGGGCAGAGGAGAGAAGG + Intergenic
969132793 4:5004127-5004149 GCAGCTGAGCAGAGGAGAGATGG + Intergenic
969203166 4:5622125-5622147 CCACAGGAGCAGAGGGGGAAGGG - Intronic
969262796 4:6044208-6044230 CAAGGGGGGCAGCGGGGTGAGGG - Intronic
969281317 4:6172507-6172529 CCTGGGGAGGAGAGAGGACACGG + Intronic
969301368 4:6299271-6299293 CAAGAGGAGCAGAGGGCTGAGGG - Intronic
969315617 4:6379990-6380012 GCAGGGGAGGGGAGGGGAGGAGG - Intronic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
969540541 4:7786041-7786063 CCAGGAGAACAGAGATGAGATGG + Intronic
969633197 4:8350524-8350546 TCAGGGGAACAGAGGGGAGCCGG + Intergenic
969684900 4:8665933-8665955 CCATGGGAGCAGGTGGGAGGAGG - Intergenic
969688207 4:8688728-8688750 CCAGGGGCACAGCTGGGAGAGGG - Intergenic
969804544 4:9596718-9596740 CAAGGGGAGGAGACAGGAGAGGG + Intergenic
970550070 4:17171462-17171484 CCAGGGGAACAGCTGTGAGAGGG - Intergenic
970701504 4:18745969-18745991 CCAGGGGCTGAGAGGGAAGAAGG - Intergenic
971412124 4:26384985-26385007 GGAGGGGAGGAGAGGGGAGAGGG - Intronic
973607808 4:52605197-52605219 GCGGGGGAGCAGTGGGGAGCAGG - Intronic
975503493 4:75113428-75113450 CCAGGGGTACAAAGAGGAGATGG + Intergenic
975647422 4:76558942-76558964 CCTGGGGCCCAGAGGGGAAAGGG - Intronic
975831032 4:78369014-78369036 CAAGGGGGTCAGAGCGGAGATGG + Intronic
976613943 4:87057243-87057265 AGAGGAGAGCAGTGGGGAGATGG + Intronic
977294105 4:95192491-95192513 GCAGGGGAGGAGAGGTGAGAAGG - Intronic
977476718 4:97519786-97519808 AAAGGGGAGAAGAGGAGAGAAGG + Intronic
977805128 4:101288519-101288541 AGAGGGGAGGAGAAGGGAGAAGG + Intronic
978331250 4:107614919-107614941 GCTGGGGAGTAGAGGGCAGAGGG - Intronic
978536655 4:109770035-109770057 CCTGGGGTGCAGGTGGGAGATGG + Intronic
978593718 4:110354482-110354504 CCTGGGAAGCAGAGCTGAGAGGG - Intergenic
979546301 4:121944169-121944191 TGAGGGCAGTAGAGGGGAGAGGG + Intronic
981172339 4:141638902-141638924 CCAGGAGAGATGAGGGGAAAAGG - Intronic
981377917 4:144037373-144037395 CCAGGGGAAGTGAGGAGAGAAGG + Intergenic
981616256 4:146647845-146647867 AGAGGGGTGGAGAGGGGAGATGG - Intergenic
981903861 4:149896832-149896854 CCAGAAATGCAGAGGGGAGAGGG + Intergenic
982146645 4:152402055-152402077 TCAGTGAAGCAGAGGGGAGTGGG + Intronic
982148875 4:152429385-152429407 GCGGGGGAGGAGAGGGGAGAAGG + Intronic
982404208 4:155002315-155002337 TCAGGGGAGCACAGGGGAAGAGG - Intergenic
982480997 4:155909899-155909921 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
982506057 4:156219068-156219090 CCAGTGGAGCTGAGAGAAGAGGG + Intergenic
983026709 4:162746803-162746825 GAAGGGGAGGAGAGGGGAGGCGG + Intergenic
983626592 4:169807737-169807759 CCAGAAGAGCAGATGTGAGATGG - Intergenic
983937470 4:173512141-173512163 CCAGGGATGCAGGGGGCAGAGGG + Intergenic
983981658 4:174005016-174005038 CCAGAGGAGCAGATAGCAGAGGG + Intergenic
984762688 4:183376638-183376660 GCGGGGGAGCAGAGGCGAGGAGG - Intergenic
984771956 4:183444299-183444321 CGCCGGGAGCAGAGGCGAGAGGG - Intergenic
984940016 4:184922685-184922707 CCAGGGAAGCAGAGTGGGGAGGG + Intergenic
985485565 5:146449-146471 GCAGGGGTGAAGAGGAGAGATGG - Intronic
985502151 5:254944-254966 GCAGGGGAGCTGAGGGGATGTGG + Intronic
985734869 5:1573723-1573745 GCAGGGGAGCTGAGGGGATGTGG - Intergenic
985781586 5:1874463-1874485 AGAGGGGAGCAGAGTGGAGTTGG + Intergenic
985912650 5:2895964-2895986 CCAGGGAAGAAGAGGGGACCTGG - Intergenic
986169174 5:5301942-5301964 CAAGGGGATGAGAGGGGAGCTGG - Intronic
986772593 5:10987658-10987680 GGAGGGGAGGAGAGGGGAGTGGG - Intronic
987075575 5:14379103-14379125 GGAGGGAAGCACAGGGGAGAAGG + Intronic
987075770 5:14380430-14380452 CCAGGGCAGCAGTGGGAAGCGGG - Intronic
987119411 5:14752683-14752705 CCAGGACTGCAGCGGGGAGAGGG + Intronic
987612643 5:20226813-20226835 GCAGAGGAGCAGAGGAGACAAGG + Intronic
987989209 5:25189671-25189693 TCAGGGGAGGAGAGAGGAGGGGG - Intergenic
988610879 5:32723834-32723856 AGAGGGGAGAAGAGGAGAGAGGG - Intronic
988798287 5:34672998-34673020 CCAGGAGAGCAGAGAAGATAGGG + Intronic
989156786 5:38351929-38351951 TCAGGGGTGCAACGGGGAGAAGG + Intronic
989285625 5:39696202-39696224 CCAGGGGAGGAAAAAGGAGAAGG - Intergenic
989291480 5:39771329-39771351 CCAGGGGGGCAGTCAGGAGATGG + Intergenic
990780326 5:59353712-59353734 GCAGGGGAGAGGAGGGGAGCAGG - Intronic
990941653 5:61208095-61208117 CCAGGGCAGAAAGGGGGAGATGG + Intergenic
991091274 5:62696138-62696160 CCAGGGCAGCAGCAGGGAGTAGG + Intergenic
991504604 5:67311053-67311075 GGAGGGGAGGAGAGGGGAGAGGG + Intergenic
992038537 5:72805748-72805770 CCAGGGATGCAGAGAGGAGCTGG - Intergenic
992194028 5:74322127-74322149 CCAGGATAGCAGAGATGAGAAGG - Intergenic
992400207 5:76404176-76404198 CGAGGGGAGCGGGGGGGAAAGGG - Intronic
992773469 5:80070041-80070063 GCAGAGCAGCAGAAGGGAGATGG - Intronic
992883863 5:81138279-81138301 CCAGGGAAGCAGGGGGCAGTGGG - Intronic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
995334377 5:110983138-110983160 CCAGGGGAGCAGTGGAGGTAAGG - Intergenic
995420914 5:111965590-111965612 CTAGGGGAAGATAGGGGAGATGG - Intronic
995815038 5:116158278-116158300 AGAGGGGAGGAGAGGGGAGACGG - Intronic
996012191 5:118493261-118493283 GGAGGGTGGCAGAGGGGAGAGGG + Intergenic
996222433 5:120950051-120950073 CTAGGGGAGCTGTGAGGAGAGGG + Intergenic
996295420 5:121909163-121909185 TAAGGGGAACAGTGGGGAGAGGG - Intergenic
996606736 5:125331483-125331505 CTAGGGGAGCAGAGAGCAAAAGG + Intergenic
997131277 5:131278765-131278787 GGAGGGGAGAAGAGAGGAGAGGG - Intronic
997178393 5:131802397-131802419 GATGGGGAGCAGAGAGGAGATGG + Intergenic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998113924 5:139522370-139522392 AGAGGGGAGCACAGGGGAAATGG + Intergenic
998171188 5:139872881-139872903 CCCTGGGAGCTGAGGGGAGCAGG - Intronic
998182507 5:139955353-139955375 GCAGAGGCCCAGAGGGGAGAGGG + Intronic
999081879 5:148852251-148852273 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999082092 5:148854331-148854353 AAAGAGGACCAGAGGGGAGAAGG + Intergenic
999438533 5:151582914-151582936 ACAGAAGAGCAGACGGGAGAGGG + Intergenic
1000209114 5:159095223-159095245 CCCGGGAAGCAGAGGGGCGAGGG - Intronic
1000345713 5:160312135-160312157 TCCGGCGAGCAGAGGGGAGGGGG - Intronic
1000630756 5:163587878-163587900 CCAGGGAAGCAGATGGCAGAAGG - Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001284930 5:170415972-170415994 GCTGGGGAGGAGAGGGGAGCGGG + Intronic
1001303479 5:170554793-170554815 GAAGGGGAGAAGAGGAGAGAGGG - Intronic
1001650178 5:173310467-173310489 TCAGGGGGGCAGTGAGGAGAGGG - Intergenic
1001905577 5:175470042-175470064 CCAGGGGAGCAGGAGGAAGCTGG + Intergenic
1002211946 5:177604558-177604580 GCAGGGGTGCCGAGGGGAGAGGG - Intronic
1002762225 6:210905-210927 CCAGGGCTGCTGAGGGGAGAGGG - Intergenic
1002888933 6:1317296-1317318 CGAGGGGAGGAGAGAGGAGCAGG - Intergenic
1003518473 6:6837135-6837157 AGAGGGGAGGAGAGGGGAGAAGG + Intergenic
1003556663 6:7146042-7146064 CCTGGGGGGCGGTGGGGAGACGG - Intronic
1003712285 6:8605416-8605438 ACAGGGCATCAGAGGGCAGAGGG - Intergenic
1004517800 6:16335413-16335435 CCAGGGGTGCAGAGCCGAGAAGG - Intronic
1004557641 6:16715024-16715046 TTAGGGAAGGAGAGGGGAGAGGG - Intronic
1004627792 6:17393490-17393512 AAAGGGGAGCAGAGAGGAGAAGG - Exonic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005512506 6:26523042-26523064 TCAGGGGAGGAGAGAGGAGGGGG + Intergenic
1005614304 6:27557908-27557930 CCAGGAGGGGAGAGGGGAGTGGG + Intergenic
1005773319 6:29099934-29099956 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005779369 6:29172408-29172430 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1006384689 6:33723841-33723863 ACAGGGGAGGGGAGGAGAGATGG - Intronic
1006804164 6:36777728-36777750 GCAGGGGAGCAGCGAGGAGGAGG - Intronic
1006854581 6:37124078-37124100 GGAGGGGAGCAGAGGGGAAGGGG + Intergenic
1006854587 6:37124094-37124116 GAAGGGGAGCAGAGGGGAAGGGG + Intergenic
1006897154 6:37478556-37478578 CCTGGCGAGGAGAGGGGAGAGGG - Intronic
1006970821 6:38043381-38043403 GAAGGGGAGCAGAGGAGAGGGGG - Intronic
1006970859 6:38043531-38043553 AGAGGGGAGAAAAGGGGAGAGGG - Intronic
1007059803 6:38927626-38927648 CCAGGGGAGCCAAGGGGAATGGG - Intronic
1007085299 6:39140134-39140156 GCAGGAAATCAGAGGGGAGAAGG + Intergenic
1007166522 6:39832285-39832307 GCATAGGAGGAGAGGGGAGAAGG - Intronic
1007224556 6:40303520-40303542 CCATGAGAGGAGAGAGGAGAGGG + Intergenic
1007507719 6:42349190-42349212 TCAGGGGAGCACAGGGGCCAAGG + Intronic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007718438 6:43870611-43870633 AAAGGGGAGGGGAGGGGAGAAGG - Intergenic
1007764029 6:44150539-44150561 GGAGGGAAGCAGAGGAGAGATGG - Intronic
1008286195 6:49654082-49654104 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
1008496139 6:52136304-52136326 CCTGAGGAACAGAGAGGAGAGGG + Intergenic
1008546598 6:52589013-52589035 GCACGGGAGCAGAGTGTAGAAGG - Intergenic
1009408138 6:63333446-63333468 GAAGGGGAGGAGAGGGGAGGGGG + Intergenic
1009840984 6:69073824-69073846 CCAGGGTGGTAGAGGGGTGAGGG - Intronic
1010116446 6:72317090-72317112 CATGGGGAGCAGTGGGGAGGAGG - Intronic
1010536346 6:77036396-77036418 CCATGGCGGCTGAGGGGAGAGGG + Intergenic
1010686937 6:78864276-78864298 CAAGAGGATCAGAGGTGAGATGG - Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011460942 6:87603085-87603107 CTAGGGAAGCTGAGGTGAGAGGG - Intronic
1011908936 6:92410443-92410465 CTCTGGGAGCAGAGGGGAGTAGG - Intergenic
1012384190 6:98658885-98658907 CCAGGTGAGCACAAAGGAGATGG + Intergenic
1013273091 6:108560502-108560524 CCGCGGGCGAAGAGGGGAGAGGG + Intronic
1013273520 6:108562053-108562075 CCAGGTGAGGAGAGGGGGCAGGG + Intronic
1013457310 6:110342282-110342304 CCTGGGGAGCTGTTGGGAGAGGG + Intronic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1015176157 6:130311629-130311651 CCAGTGCAGCAGAGTGGAGGTGG + Intronic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1016605490 6:145918616-145918638 CCAGGGGGACAGAGGAAAGAAGG - Intronic
1016881558 6:148916979-148917001 CCAGAGGAGCACATGGGAGCTGG - Intronic
1016919976 6:149283146-149283168 GCGGGAGAGCAGAGGGGAGCTGG - Intronic
1017122822 6:151040080-151040102 TCAGGGGAGGTGAGGGGTGACGG + Intronic
1017136063 6:151148334-151148356 ACAGGCGTGCAGAGGGGAGGTGG - Intergenic
1017243660 6:152198012-152198034 GGAGGGGAGGGGAGGGGAGAAGG + Intronic
1017652077 6:156593140-156593162 GGAGGGGAGAAGAGGGGAGGAGG + Intergenic
1018839607 6:167508290-167508312 ACAGGGCAGGAGAGGGGACAGGG - Intergenic
1018839676 6:167508484-167508506 ACAGGGGAGGAGAGGGGACGGGG - Intergenic
1018839725 6:167508616-167508638 ACAGGGCAGGAGAGGGGACAGGG - Intergenic
1018841762 6:167522521-167522543 CCAGAGGAACAGAGTAGAGAGGG - Intergenic
1018973600 6:168546592-168546614 CCATGGCAGCAGTGGAGAGAGGG + Intronic
1019029156 6:168995410-168995432 CCAGGAGAGGTGAGGTGAGATGG - Intergenic
1019029163 6:168995445-168995467 CCAGGAGAGGTGAGGTGAGATGG - Intergenic
1019143592 6:169962909-169962931 CCAGAGCAGCGGAGAGGAGAAGG - Intergenic
1019223438 6:170492967-170492989 CAAGGGGCCCAGAGGGGACAGGG + Intergenic
1019354766 7:572706-572728 CCTGGAGAGCCGAGGGGAGCAGG + Intronic
1019484889 7:1284915-1284937 CCAGGGGACAAGCAGGGAGAAGG + Intergenic
1019493737 7:1326675-1326697 CTAGGGGAGCATAGGAGGGACGG - Intergenic
1019517547 7:1446524-1446546 GAAGGGGAGGAGAGGGGAGGAGG + Intronic
1019621406 7:1994228-1994250 CCAGGGCAGCACAGGGACGATGG + Intronic
1019628644 7:2034756-2034778 ACAGGGGAGGAAAGGAGAGAAGG + Intronic
1019660163 7:2219667-2219689 CAAGGGGGGCAGAGGGCAGGGGG + Intronic
1019781055 7:2939939-2939961 CCAAGGGTGCCCAGGGGAGAAGG + Intronic
1019863252 7:3680306-3680328 AGAGGGGAGGTGAGGGGAGACGG + Intronic
1020080004 7:5282150-5282172 AGATGGGAGCAGAGGGGAGGAGG + Intronic
1020204478 7:6104628-6104650 CCAGGGAAGCACAGGGCGGAAGG + Intergenic
1021098654 7:16562669-16562691 CCAGGGGAGCAGAGGGATTCTGG + Intronic
1021373279 7:19877194-19877216 AGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1021638684 7:22716992-22717014 CAAGGGAAACAGAGAGGAGAAGG - Intergenic
1021939670 7:25667363-25667385 CCATGGAAGAACAGGGGAGAGGG + Intergenic
1022547074 7:31199845-31199867 CCAGGTGAGCAGAGAGGCTAAGG - Intergenic
1022758900 7:33326239-33326261 TCAAGGGAGAAGAGGGGAGGGGG - Intronic
1022814779 7:33904303-33904325 CCAGTGCTGCAGAGGCGAGAGGG + Intergenic
1023652760 7:42388800-42388822 CCCCGGGAGCAGAGTGGAAAGGG - Intergenic
1023752392 7:43385192-43385214 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1023752418 7:43385243-43385265 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1023752427 7:43385260-43385282 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1023752436 7:43385277-43385299 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1023837568 7:44077305-44077327 GCAGAGGGGCAGAGGGGAGGAGG + Intronic
1023864503 7:44232397-44232419 AGAGGGGAGCAGAGGAGGGAGGG + Intronic
1024080915 7:45854107-45854129 GGAGGGGAGAGGAGGGGAGAAGG + Intergenic
1024085352 7:45888040-45888062 CCAGGTGAGGAAAGGCGAGATGG - Intergenic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1024639576 7:51317775-51317797 GCAGGGGATCAGAGGGAGGAAGG - Intergenic
1024644983 7:51363372-51363394 CCATGGAAGGACAGGGGAGATGG + Intergenic
1025076598 7:55949470-55949492 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
1025123590 7:56327732-56327754 GGAGGGGAGAGGAGGGGAGAAGG - Intergenic
1025198910 7:56950066-56950088 AGATGGGAGCAGAGGGGAGGAGG - Intergenic
1025301359 7:57821599-57821621 CGAGGGGCGCAGAGGGCTGATGG + Intergenic
1025673036 7:63626867-63626889 AGATGGGAGCAGAGGGGAGGAGG + Intergenic
1025847849 7:65216855-65216877 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
1025898096 7:65722720-65722742 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
1026104177 7:67407932-67407954 ACAGGGGAGGGGAGGAGAGAGGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026319324 7:69255249-69255271 CCATTGGAACAGAGGAGAGATGG + Intergenic
1026406634 7:70073013-70073035 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1026622426 7:71961770-71961792 CAAGGGCAGCAGAAGAGAGAGGG + Intronic
1026634893 7:72073653-72073675 GGAGGGGAGGGGAGGGGAGAAGG - Intronic
1026948021 7:74328437-74328459 CCAGGGGATGAGAGGGGAGTTGG + Intronic
1026979409 7:74517853-74517875 CCAGGTGCCCAGAGTGGAGAGGG + Intronic
1027503050 7:78979422-78979444 CCCTGGGAGCACAGAGGAGAAGG - Intronic
1027802656 7:82774901-82774923 CCAGGGGTTTAGCGGGGAGAAGG - Intronic
1028296663 7:89141059-89141081 CCAAAGGAGAGGAGGGGAGATGG + Intronic
1028454871 7:91027847-91027869 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1028469153 7:91186099-91186121 AGAGGGGAGGGGAGGGGAGAAGG - Intronic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029207408 7:98878161-98878183 CCAGGAGAGCAGCGGGGACCGGG + Intronic
1029364993 7:100111044-100111066 ACAAGGGGGCAGAGGGAAGAGGG - Intronic
1029457610 7:100679011-100679033 CCAGGGCAGCAGAAGGATGAGGG - Exonic
1029477563 7:100794041-100794063 CCTGGGGAGCAGAGGCGCCAAGG + Intronic
1029523256 7:101077870-101077892 CCAGCAGGGCAGAGGGGAGGGGG + Intergenic
1030344097 7:108413817-108413839 CCAGAGGAACAGTGTGGAGAGGG - Intronic
1030711393 7:112754187-112754209 GCAGATGAGCATAGGGGAGAAGG - Intergenic
1030781851 7:113610686-113610708 AGAGGGGAGAAGAGGGGAGGAGG + Intergenic
1030783098 7:113625787-113625809 GGAGGGGAGGAGAGGGGAGAAGG - Intergenic
1031151543 7:118059883-118059905 ACAGGGGAGCAGGGGAGGGATGG - Intergenic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1032267852 7:130381176-130381198 GCAGGTCAGAAGAGGGGAGAAGG + Exonic
1032327819 7:130948404-130948426 TCAGGGGAGCTGGGGGGAGGAGG + Intergenic
1032425069 7:131815969-131815991 CCTGGGGAATAGAGGGCAGAGGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1032700008 7:134371003-134371025 CCAGGTGGGCAGAGGAGATACGG + Intergenic
1033223670 7:139544701-139544723 CCAGGGCTGCAGTGAGGAGAGGG - Exonic
1033229317 7:139584148-139584170 GGAGGGAGGCAGAGGGGAGAGGG + Intronic
1033554403 7:142476040-142476062 CAAGAGGAGCAAAGGGTAGATGG + Intergenic
1033559033 7:142513597-142513619 CAAGAGGAGCAAAGGGTAGATGG + Intergenic
1034190638 7:149210735-149210757 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
1034348532 7:150401939-150401961 GGTGGTGAGCAGAGGGGAGAAGG - Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1035669904 8:1409231-1409253 CCAGGGCTGCCAAGGGGAGATGG - Intergenic
1035688041 8:1539943-1539965 CCATAGGAGCAGAGAAGAGATGG - Intronic
1036130418 8:6104300-6104322 GGAGGGGAGGAGAGGGGAGGGGG + Intergenic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1036614748 8:10379571-10379593 CCAGAGGGGAAGAGGGGGGAAGG - Intronic
1036782803 8:11661198-11661220 TCGGAGGAGTAGAGGGGAGACGG + Intergenic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1036925408 8:12900130-12900152 CCTGCGGAGCAAAGGGGAAATGG - Intergenic
1037587602 8:20288709-20288731 GCAGGGAAGCTGTGGGGAGAGGG - Intronic
1037676133 8:21052200-21052222 CCAGGGGTGCAGAGTTGAAATGG - Intergenic
1037754690 8:21703274-21703296 GCAGGGGAGCCTAGGGGAGGAGG + Intronic
1037804132 8:22049842-22049864 TCTAGGGAGCAGAGAGGAGAAGG - Intronic
1037821933 8:22139298-22139320 GCCGGGGAGCAGGGGTGAGAAGG - Intronic
1037826350 8:22162815-22162837 CAAGGGGAGTGGAGGGGAGGAGG + Intronic
1037837207 8:22221325-22221347 CCTGGGGAGCTGGGGGGCGAGGG - Exonic
1037886550 8:22599118-22599140 GGAGGAGAGGAGAGGGGAGAGGG - Intronic
1037886599 8:22599240-22599262 CGAGGGGAGGGGAGAGGAGAGGG - Intronic
1037988358 8:23303493-23303515 CCAGGGGACCAGAGGGGGCCGGG + Intronic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1039170699 8:34741599-34741621 CCAGGGGTACAGAGGGGAGCTGG + Intergenic
1039438957 8:37581431-37581453 CCAGGGGAGCACAGGACACATGG - Intergenic
1039658803 8:39439556-39439578 GGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1039832674 8:41228518-41228540 CCAGAGGTACAGAGGGGAGCTGG + Intergenic
1039912412 8:41835585-41835607 CGAGGGGAGGAGCGGGGAGCAGG + Intronic
1039963792 8:42269593-42269615 GGAGGGGAGGAGAGGGGAGGGGG + Intergenic
1040288922 8:46114408-46114430 ACAGGGGAGAAGAGGCGAGATGG - Intergenic
1040290365 8:46121111-46121133 TCAGGAAGGCAGAGGGGAGAAGG - Intergenic
1040310686 8:46235263-46235285 TGAGGGAGGCAGAGGGGAGAAGG + Intergenic
1040772501 8:50994575-50994597 CCAGGGGAGCAGAGAAAATAAGG - Intergenic
1040951551 8:52942092-52942114 CCAAGGAAGCAGAGGAGAAAGGG - Intergenic
1041153738 8:54962567-54962589 CCTGGGTGGCAGAGGTGAGATGG - Intergenic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041552513 8:59118410-59118432 CCAGGGGAGCAGCCGGGAGTCGG - Intronic
1041669156 8:60475611-60475633 GAAGGGGAGGAGAGGGGAGGAGG - Intergenic
1042564566 8:70099063-70099085 GAAGGGGAGGGGAGGGGAGAAGG + Intergenic
1042847797 8:73185588-73185610 CCAGGGGAGCAAAGTGGGGAGGG + Intergenic
1043209031 8:77487411-77487433 CTAGTGGAGCTGAGGGGTGAAGG - Intergenic
1043260494 8:78188508-78188530 GGAGGGGAGGGGAGGGGAGAAGG + Intergenic
1044537646 8:93375612-93375634 CCTGGTGAGGAGATGGGAGAAGG - Intergenic
1045023476 8:98064376-98064398 CCAGGAGACAGGAGGGGAGACGG - Exonic
1045049165 8:98307107-98307129 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1045098725 8:98825324-98825346 CGAGGGGACCTGAGGGGAGCGGG - Intronic
1045106261 8:98895677-98895699 CCAAGGGTGCTGAGTGGAGAGGG + Intronic
1045399648 8:101800843-101800865 GGAGGGGAGGGGAGGGGAGAGGG + Intronic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1046498394 8:115043349-115043371 CCAGAGGAGCGGAGGGGGGCGGG + Intergenic
1046514994 8:115247515-115247537 ACTGTGGAGCAGAGGAGAGAAGG - Intergenic
1046780649 8:118211086-118211108 CCAGGGGAGCAGAAGGGAGGGGG + Intronic
1046848924 8:118951699-118951721 CCAGCGGACCGGCGGGGAGAAGG - Intronic
1046936489 8:119889685-119889707 ACAGGGGAGAGGAGTGGAGAAGG + Intronic
1046983374 8:120360969-120360991 GCAGGGGTGCAGAGGGGTGGTGG - Intronic
1047297427 8:123583551-123583573 CCAGGGTAGCTGAGGGTATAAGG + Intergenic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1047521815 8:125600757-125600779 CTTGGGGAGCAGAAGGGAGGAGG + Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1047826553 8:128582227-128582249 GGAGGGGAGGAGAGGAGAGAAGG - Intergenic
1048207387 8:132426256-132426278 CCATGGGAGCGGAGGAGGGAGGG - Intronic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048365380 8:133733594-133733616 CCAAGGGTGCAGATGGTAGAAGG - Intergenic
1048443099 8:134474450-134474472 AAAGGGGTGGAGAGGGGAGATGG + Intergenic
1048590477 8:135816590-135816612 ACAGGGGCACAGAAGGGAGAAGG + Intergenic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1048883082 8:138886115-138886137 ACAAAGGATCAGAGGGGAGAAGG - Intronic
1049094616 8:140540995-140541017 CCAGGGGAGGAGATGGGACACGG - Intronic
1049321480 8:141999218-141999240 TGAGGGGAGCAGAGAGGATAAGG - Intergenic
1049367035 8:142244818-142244840 GCAGGGGAGCAGAGGGAGCAGGG + Intronic
1049706238 8:144044198-144044220 ACAGGGGAGCAGAGAGAAGGTGG + Intronic
1049796910 8:144501107-144501129 CCTGGGGAGGAGAGAGGAGAGGG - Exonic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1050091682 9:2021564-2021586 ACAGGGGGGAAGATGGGAGAGGG - Intronic
1050129827 9:2400286-2400308 CCAGAGGTACAGAGAGGAGATGG - Intergenic
1050234043 9:3559443-3559465 CCAGAGGTACAGAGAGGAGAAGG - Intergenic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1050985443 9:12076567-12076589 AGAGGGGAGGAGAGAGGAGAGGG - Intergenic
1050985448 9:12076584-12076606 AGAGGGGAGGAGAGAGGAGAGGG - Intergenic
1051066544 9:13110951-13110973 CCAGGGGAGAGGGAGGGAGAAGG + Intronic
1051240460 9:15050101-15050123 GCGGGGGAGGTGAGGGGAGAGGG + Intergenic
1051642716 9:19238530-19238552 GGAGGGGAGGAGAGGGGGGAGGG - Intronic
1051642764 9:19238621-19238643 GGAGGGGAGGAGAGGGGGGAGGG - Intronic
1051742314 9:20263827-20263849 CCAGGAGGGCACAAGGGAGAGGG - Intergenic
1051743858 9:20276577-20276599 CCAGTGGAGCAGTGAGAAGAGGG - Intergenic
1052946846 9:34175521-34175543 CCTGAGGAGTAGAGAGGAGAGGG - Intergenic
1052951899 9:34219912-34219934 GGAGGGGAGGGGAGGGGAGAGGG - Intronic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053175574 9:35920498-35920520 CCAGGAGAGCAGCCGGGAGGAGG + Intergenic
1053329359 9:37188930-37188952 AGAGGGGAGGGGAGGGGAGAGGG - Intronic
1055030011 9:71764628-71764650 CCAGGGGTGCGGTGGGGAGGGGG - Intronic
1055703309 9:78970529-78970551 CCACGGGAGCAGTGTGGAGGTGG - Intergenic
1056252689 9:84766307-84766329 CCTGGGGAGGAGAGCAGAGAGGG + Intronic
1056363604 9:85882308-85882330 CCTGGGGAGGAGAGGTCAGATGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056546468 9:87617838-87617860 CTAGAGAAGCAGAGGGGAGCAGG - Intronic
1056787477 9:89603683-89603705 CCTGGGGAGTAGAGGGCAAAAGG - Intergenic
1056814554 9:89791988-89792010 CCAGGGTAGCAAAGAGTAGAGGG - Intergenic
1056829205 9:89900789-89900811 CCAGGTGAGCAAAGGGGTAAGGG + Intergenic
1057605354 9:96494820-96494842 GGAGGGGAGGGGAGGGGAGACGG - Intronic
1057771156 9:97969276-97969298 CCAGAGGGGCAGAGGACAGATGG - Intergenic
1057961413 9:99461184-99461206 CCAGGGTAGGAGAGGGGACAAGG - Intergenic
1058140167 9:101349262-101349284 TCTGGGGAGCAGGGTGGAGAAGG - Intergenic
1058550780 9:106112581-106112603 TGAGGGGATCATAGGGGAGAGGG + Intergenic
1058844629 9:108944678-108944700 CCAGGGGAGTAAAGGGAGGAAGG + Intronic
1059067692 9:111102759-111102781 ACAGGGGAGCAGACTGGGGAGGG + Intergenic
1059341304 9:113599016-113599038 GCCGGGGAGCAGAGGGAAGGGGG - Intergenic
1059484626 9:114617235-114617257 CCAGGGGAGGAGGGGGGCAATGG - Exonic
1059528989 9:115018421-115018443 GAAGGGGAGCAGATGAGAGAAGG + Intergenic
1059542500 9:115144314-115144336 GGAGGGGAGTGGAGGGGAGAAGG - Intronic
1059542520 9:115144366-115144388 GAAGGGGAGGGGAGGGGAGAAGG - Intronic
1059641739 9:116223847-116223869 CCAGAGGATCAGAGGTGAGATGG - Intronic
1059949291 9:119445240-119445262 GGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1060031455 9:120218178-120218200 CCAGGGGAGGAGAAGTGATATGG - Intergenic
1060049200 9:120365284-120365306 AGAGGGGAGAAGTGGGGAGAGGG + Intergenic
1060102905 9:120856197-120856219 CCAGGGAAGCAGAGGAAAGTGGG + Exonic
1060413785 9:123416668-123416690 CCAGGGCAGGAGGGGAGAGAGGG + Intronic
1060508232 9:124214430-124214452 CCAGGGGAGCAGAGATGAACTGG - Intergenic
1060733204 9:126050699-126050721 GCAGGGGAGGGGAGGGGAGAGGG - Intergenic
1060973562 9:127752617-127752639 GTATGGGAGCAGAGGGGTGAGGG - Intronic
1061147525 9:128808640-128808662 TCAGGGGAGCAGAGGCAAGCGGG - Exonic
1061202832 9:129147351-129147373 GCAGGTGAGCAGAGTGGTGAGGG - Intronic
1061263720 9:129493995-129494017 CCCAGGGAGCAGGCGGGAGATGG + Intergenic
1061277792 9:129579406-129579428 CCAGGGGAGCAAATGGGGGATGG + Intergenic
1061278512 9:129583605-129583627 CCAGAGAACCAGTGGGGAGAAGG - Intergenic
1061392295 9:130324178-130324200 CCCAGGGGGCTGAGGGGAGACGG - Intronic
1061551424 9:131336962-131336984 CCGGAGGAGATGAGGGGAGAGGG + Intergenic
1061584258 9:131555884-131555906 CCAGGGGTGCAAGAGGGAGAGGG + Intergenic
1061618258 9:131794127-131794149 CCAGGACAGCAAAGGGGAGCAGG + Intergenic
1061759989 9:132843933-132843955 CCAGGGTAGCTGTGGGGAGATGG + Intronic
1061773269 9:132944314-132944336 CCTGGGGAGGAGAGGCGAGCCGG - Intronic
1061807538 9:133144701-133144723 CTAGGGGAGCAGCGGGGAGTCGG - Intronic
1061840663 9:133356820-133356842 TCAGGGGAGGAGAGGGAAGGGGG + Intronic
1061847879 9:133398074-133398096 CTAGGGGAGCAGCTGGGAAAGGG - Intronic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062255507 9:135618991-135619013 TGAGGGCAGCAGAGGGGTGAGGG - Intergenic
1062269057 9:135700421-135700443 TCAGGGAAGCAGAGGGGACGAGG + Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062338890 9:136084788-136084810 CCGGAGGAGCCGTGGGGAGAGGG + Intronic
1062438815 9:136559860-136559882 CTAGTGGAGCAGTGAGGAGAGGG + Intergenic
1062451106 9:136616188-136616210 CCGAGTGGGCAGAGGGGAGACGG - Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062731358 9:138111888-138111910 CAAGGAGAGCAGAGCGGGGAAGG - Intronic
1185493500 X:537146-537168 CCTGGGGATGAGAGGGGACACGG - Intergenic
1185504369 X:620301-620323 CCAGGGGCGCGGCGGGGACACGG - Intergenic
1185581530 X:1213653-1213675 GGAGGGGAGGAGAGGGGAGGGGG - Intergenic
1185595090 X:1301489-1301511 CCAGTGGAGCAGAGGGAGGTGGG - Intronic
1185623836 X:1468975-1468997 AGAGGGAAGGAGAGGGGAGAGGG - Intronic
1185623866 X:1469050-1469072 AGAGGGAAGGAGAGGGGAGAGGG - Intronic
1186428382 X:9483570-9483592 CCAGGCGAGAAGATGGGAGGAGG - Intronic
1186809516 X:13174490-13174512 CCAGGGGTGGAGTGGGGAGTAGG - Intergenic
1187404744 X:18993174-18993196 CCAGGGGAGCGGGGAGAAGAAGG - Intronic
1188533097 X:31164004-31164026 CCAGGGGAGAAGGTTGGAGAAGG + Intronic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1189697563 X:43680530-43680552 GGAGGGGAGGAGAGGGGAGAAGG - Intronic
1190285984 X:48961765-48961787 CCAGAGGAGAAGAGAGGAGGAGG + Exonic
1190558112 X:51658265-51658287 CCATGGGAGCAGAGAGGGAAGGG + Intergenic
1191181844 X:57572713-57572735 CCAGAGGTACAAAGGGGAGATGG + Intergenic
1191650032 X:63527077-63527099 CCAGGGAAGCAGAGGGCAAGAGG - Intergenic
1192182288 X:68923692-68923714 GGAGGGGGGAAGAGGGGAGAGGG - Intergenic
1193066417 X:77265046-77265068 CCAGGGGAGCTGTGAGAAGAGGG + Intergenic
1193068904 X:77286405-77286427 CCAGAGGTGCAGAGAGGAGCTGG + Intergenic
1193397457 X:81002879-81002901 TCAGGGGAGGAGAGAGGAGGGGG - Intergenic
1195119741 X:101738406-101738428 GGAGGGGAGGGGAGGGGAGAGGG - Intergenic
1195332452 X:103815000-103815022 CCAGAGGTACAAAGGGGAGATGG + Intergenic
1196098857 X:111827930-111827952 CCAAGGGAGGAGAGGGAAGTAGG - Intronic
1196812082 X:119636821-119636843 CCAGGAGAGCTGTGGGGAGCAGG - Intronic
1196817578 X:119677392-119677414 ACAGGGGAGGGGAGGGGACAGGG + Intronic
1197720914 X:129744093-129744115 CCAGGGTAGCAGAGAGGGCAAGG - Intronic
1197822770 X:130558306-130558328 CCAGGGGAGCTGATGGCTGAGGG + Intergenic
1198045835 X:132901713-132901735 CCAGGGAAGCAGATTTGAGATGG + Intronic
1198152700 X:133926773-133926795 GCAGGGGGGCGGAGGGGGGACGG - Intronic
1198966915 X:142237173-142237195 CCAGTGGAGCAGTGAGAAGAGGG + Intergenic
1199086809 X:143636630-143636652 GGAGGGGAGCAGAGAGGAGTTGG + Intergenic
1199845830 X:151692653-151692675 CAAGGCTTGCAGAGGGGAGAAGG + Intergenic
1200252643 X:154561913-154561935 TCAGGGAAGCTGTGGGGAGATGG + Intronic
1200265124 X:154642503-154642525 TCAGGGAAGCTGTGGGGAGATGG - Intergenic
1200308567 X:155053986-155054008 CCAGGAGGGTAGAGGGGAGGTGG + Intronic
1201365027 Y:13195621-13195643 GGAGGGGAGGGGAGGGGAGAAGG - Intergenic
1201647766 Y:16254137-16254159 GGAGGGGAGGAGAGGGGAGGGGG + Intergenic
1201655045 Y:16331160-16331182 GGAGGGGAGGAGAGGGGAGGGGG - Intergenic
1202120589 Y:21518029-21518051 CCTGGGGAGTACAGGGGAGGTGG + Intronic
1202123040 Y:21541570-21541592 CCTGGGGAGTACAGGGGAGGTGG + Intronic
1202155965 Y:21887811-21887833 CCTGGGGAGTACAGGGGAGGTGG - Intronic
1202158413 Y:21911352-21911374 CCTGGGGAGTACAGGGGAGGTGG - Intronic
1202184868 Y:22176277-22176299 CCTGGGGAGTACAGGGGAGGTGG - Intronic
1202206492 Y:22410124-22410146 CCTGGGGAGTACAGGGGAGGTGG + Intronic
1202379265 Y:24261512-24261534 AGAGGAGAGGAGAGGGGAGAGGG - Intergenic
1202491517 Y:25408609-25408631 AGAGGAGAGGAGAGGGGAGAGGG + Intergenic
1202583724 Y:26404879-26404901 CCAGGGCAGCAGAAGGGGCAGGG + Intergenic
1202587188 Y:26443861-26443883 CCTGGGCAACAGAGGGGAGGAGG - Intergenic