ID: 955339276

View in Genome Browser
Species Human (GRCh38)
Location 3:58112364-58112386
Sequence CTTTCTATGCAGTCGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955339255_955339276 30 Left 955339255 3:58112311-58112333 CCCAACAGGTAGGGTCCTTCTCC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339267_955339276 -9 Left 955339267 3:58112350-58112372 CCCCAGCCAGGCCCCTTTCTATG 0: 1
1: 0
2: 2
3: 34
4: 293
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339266_955339276 -8 Left 955339266 3:58112349-58112371 CCCCCAGCCAGGCCCCTTTCTAT 0: 1
1: 0
2: 2
3: 26
4: 310
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339257_955339276 15 Left 955339257 3:58112326-58112348 CCTTCTCCCCTCTGCTCCCCTGG 0: 1
1: 0
2: 13
3: 141
4: 1262
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339268_955339276 -10 Left 955339268 3:58112351-58112373 CCCAGCCAGGCCCCTTTCTATGC 0: 1
1: 0
2: 2
3: 21
4: 260
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339261_955339276 7 Left 955339261 3:58112334-58112356 CCTCTGCTCCCCTGGCCCCCAGC 0: 1
1: 3
2: 15
3: 204
4: 1315
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339260_955339276 8 Left 955339260 3:58112333-58112355 CCCTCTGCTCCCCTGGCCCCCAG 0: 1
1: 1
2: 12
3: 126
4: 1036
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339259_955339276 9 Left 955339259 3:58112332-58112354 CCCCTCTGCTCCCCTGGCCCCCA 0: 1
1: 1
2: 9
3: 122
4: 1100
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339256_955339276 29 Left 955339256 3:58112312-58112334 CCAACAGGTAGGGTCCTTCTCCC 0: 1
1: 0
2: 0
3: 10
4: 122
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339264_955339276 -2 Left 955339264 3:58112343-58112365 CCCTGGCCCCCAGCCAGGCCCCT 0: 1
1: 0
2: 13
3: 135
4: 963
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339265_955339276 -3 Left 955339265 3:58112344-58112366 CCTGGCCCCCAGCCAGGCCCCTT 0: 1
1: 1
2: 8
3: 119
4: 905
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75
955339263_955339276 -1 Left 955339263 3:58112342-58112364 CCCCTGGCCCCCAGCCAGGCCCC 0: 1
1: 0
2: 14
3: 185
4: 1428
Right 955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955339276 Original CRISPR CTTTCTATGCAGTCGGTGCT GGG Intronic
904263681 1:29305550-29305572 CTATCTCTGCAGTCAGTGCCAGG + Intronic
904275330 1:29380094-29380116 TTTTCCATGCACTTGGTGCTGGG + Intergenic
904494362 1:30878335-30878357 CTTTCTCTGCAGACCTTGCTTGG - Intronic
910751613 1:90637284-90637306 CTTTTAATGCAGTCTGTGATTGG + Intergenic
915029931 1:152870510-152870532 TTTTCTACGCAGTCGGTGTGAGG - Intergenic
916833772 1:168520576-168520598 CTTTCTCTGCAGTCAGTTGTGGG + Intergenic
919920800 1:202165424-202165446 CTAGCTATGGAGTCTGTGCTGGG + Intergenic
1069764663 10:70845675-70845697 TTTCCTCTGCAGTCTGTGCTTGG + Intronic
1071479755 10:86056305-86056327 CTTTCTATACAGTCTGACCTTGG - Intronic
1072672927 10:97444700-97444722 CTTTCTATTCAGTCATTGTTGGG - Intronic
1075808522 10:125207640-125207662 CTTTCTTTGAAGTCGGCCCTAGG + Intergenic
1078116424 11:8456487-8456509 ATCTCAATGCAGTAGGTGCTCGG + Intronic
1078720861 11:13881838-13881860 CTTTCTATGCATCAGGTTCTGGG + Intergenic
1092670748 12:10858275-10858297 CATTCTATGTAGTTGCTGCTGGG - Intronic
1094004582 12:25735749-25735771 TTTTCTATGCATTCTGTGCTGGG + Intergenic
1097543166 12:60965244-60965266 CTTGCTATGTACTAGGTGCTGGG + Intergenic
1098198074 12:68023523-68023545 CTGTCTATTCAGTCTCTGCTTGG + Intergenic
1101555516 12:105805214-105805236 ATTTCTATGCAGAAGGTGATAGG - Intergenic
1104346865 12:128007839-128007861 CTTTCTATGCACACAGCGCTCGG - Intergenic
1106171682 13:27294063-27294085 CTTCCTATTCTGTCTGTGCTGGG + Intergenic
1107483595 13:40805433-40805455 CTTTTTATGCAGTGGGTGGTGGG - Intronic
1117118863 14:52547577-52547599 CTCTCTAGGCAGTTGTTGCTAGG - Intronic
1121579713 14:95019340-95019362 CTTTCTGTGTACTAGGTGCTGGG + Intergenic
1124594000 15:31078725-31078747 CTTTCCAGGCAGCAGGTGCTGGG - Intronic
1129682774 15:77667322-77667344 CCTTCTAGGCTGTGGGTGCTCGG + Intronic
1132992522 16:2804227-2804249 CTTTTGATGCACTGGGTGCTGGG + Intergenic
1136559874 16:31033089-31033111 CTTTCGAGGCAGTGGGTGGTAGG - Intronic
1139871376 16:70111324-70111346 CTTTCTGTGAAGTCGGTTGTAGG + Intergenic
1140031780 16:71344937-71344959 CTTTCTATGGGGTTGGTGCTGGG - Intergenic
1140364557 16:74371165-74371187 CTTTCTGTGAAGTCGGTTGTAGG - Intergenic
1141991981 16:87615734-87615756 CATTCAATGCAGGTGGTGCTGGG + Intronic
1143509243 17:7386454-7386476 CTCTGTATGTAGTCTGTGCTGGG - Intronic
1148289082 17:46426613-46426635 CTTTCTAGGCACTAAGTGCTTGG + Intergenic
1148311251 17:46644190-46644212 CTTTCTAGGCACTAAGTGCTTGG + Intronic
1159932374 18:74326964-74326986 CTTGCTACTCAGTCAGTGCTGGG - Intronic
1163250826 19:16125359-16125381 CTGGCTGTGCAGTGGGTGCTGGG + Intronic
1163722603 19:18905353-18905375 CTCTCTATGCAGTGGGTGGCAGG - Intronic
1165707137 19:37984452-37984474 CTTTTTATCCAGTCTCTGCTTGG - Intronic
1167777743 19:51571979-51572001 CTTTCTAGGCAGTGAGTGTTGGG + Intronic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
928338985 2:30425127-30425149 CATTACATGCAGTGGGTGCTGGG + Intergenic
929789168 2:45011008-45011030 CTTTCTATGGAGTTTGTGCTAGG + Intergenic
930774394 2:55158292-55158314 CTTTGTATGCATTCAGTGCTGGG - Intergenic
932452976 2:71827570-71827592 CTCTCTCTGCAGTCTTTGCTGGG + Intergenic
932799810 2:74731036-74731058 TTTTCTATGCATTTTGTGCTAGG + Intergenic
933246426 2:79979817-79979839 CTTTCTCTGCATTAGTTGCTAGG - Intronic
934019686 2:87934053-87934075 CTTTCTATGCAGTCAAAACTAGG + Intergenic
947655058 2:231819825-231819847 CTTACTATGTACTAGGTGCTGGG + Intergenic
1170336588 20:15276871-15276893 CTTTCAATGCACTCAGTGATTGG + Intronic
1170353709 20:15469806-15469828 CCTGGTATGGAGTCGGTGCTTGG - Intronic
1173221492 20:41136475-41136497 CTTCCTCTGCACTCAGTGCTAGG - Intergenic
1177098902 21:16875015-16875037 CTTTCTGTGCACTTAGTGCTGGG - Intergenic
1182442631 22:30373184-30373206 CTTTCCATTCAGTGGGTGTTAGG + Intronic
1182735219 22:32528561-32528583 CCTTCTGTGCCCTCGGTGCTGGG - Intronic
950681111 3:14585716-14585738 CCTGGTATGCAGTGGGTGCTTGG - Intergenic
951194273 3:19806200-19806222 CTTTCTATTCAATAGGTGCTGGG + Intergenic
955339276 3:58112364-58112386 CTTTCTATGCAGTCGGTGCTGGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963819310 3:149870272-149870294 TTTTCCTTGCAGTTGGTGCTCGG + Intronic
964781036 3:160338288-160338310 TTTTCTGTGCAGTTGGTGCCAGG - Intronic
970479751 4:16460934-16460956 CTTACTATGTAGTAGGTTCTGGG + Intergenic
971232997 4:24815830-24815852 CTTTTTAAGCAGTGGGTGCAGGG + Intronic
972562734 4:40243199-40243221 TTTTCAAAGCAGACGGTGCTTGG + Exonic
976833927 4:89348444-89348466 TTTTCTATGCACTTGGTGCTGGG + Intergenic
978008679 4:103651788-103651810 CTTTTTAGTCAGTCGGTGATGGG + Intronic
983228355 4:165106188-165106210 CATTCTATCCACTCAGTGCTGGG + Intronic
985440377 4:189979484-189979506 CTATCTATGCAGTCGGCACATGG - Intergenic
988313488 5:29593395-29593417 CTAGCTATTCAGTCAGTGCTGGG - Intergenic
990523535 5:56603143-56603165 CTTGCTATGCTCTTGGTGCTAGG - Intronic
1000809667 5:165845402-165845424 TTATCTATGCCGTAGGTGCTGGG + Intergenic
1003578602 6:7319316-7319338 TTTTCTATGAAGTATGTGCTGGG - Intronic
1015216813 6:130759812-130759834 TTTTCTGTGCACTTGGTGCTAGG - Intergenic
1026651966 7:72223508-72223530 CTTTTTAAGCAGTGGCTGCTGGG - Intronic
1034792794 7:153987043-153987065 CTTTCTGAGCAGTCTGTGCCTGG - Intronic
1035710401 8:1709093-1709115 CTTTCTATGCACTCCTTGCCTGG + Intergenic
1045385749 8:101669742-101669764 CTTTCTGTGCAGCCAGTGTTGGG + Intergenic
1052231254 9:26156509-26156531 CTTTCTATGTATAAGGTGCTAGG - Intergenic
1058826706 9:108781707-108781729 CTTTTTATGCAGTCTGATCTTGG - Intergenic
1188478897 X:30617331-30617353 TTTTCTATGCACTTGGTGCCAGG - Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1195503064 X:105625619-105625641 CTTACTATCCACTCTGTGCTAGG + Intronic
1195736926 X:108021151-108021173 TTTTCTATGCACTTAGTGCTGGG + Intergenic
1199124841 X:144105082-144105104 CTTTCTATGCAGTCAAAACTAGG - Intergenic