ID: 955339761

View in Genome Browser
Species Human (GRCh38)
Location 3:58116348-58116370
Sequence GCCCAAGCAGCCACCTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955339761_955339767 2 Left 955339761 3:58116348-58116370 CCCAGAAAGGTGGCTGCTTGGGC 0: 1
1: 0
2: 3
3: 20
4: 172
Right 955339767 3:58116373-58116395 GGGTGTGTCCTGGCCTGGTGTGG 0: 1
1: 3
2: 5
3: 44
4: 413
955339761_955339768 3 Left 955339761 3:58116348-58116370 CCCAGAAAGGTGGCTGCTTGGGC 0: 1
1: 0
2: 3
3: 20
4: 172
Right 955339768 3:58116374-58116396 GGTGTGTCCTGGCCTGGTGTGGG 0: 1
1: 0
2: 8
3: 38
4: 560
955339761_955339766 -3 Left 955339761 3:58116348-58116370 CCCAGAAAGGTGGCTGCTTGGGC 0: 1
1: 0
2: 3
3: 20
4: 172
Right 955339766 3:58116368-58116390 GGCATGGGTGTGTCCTGGCCTGG 0: 1
1: 0
2: 3
3: 40
4: 257
955339761_955339765 -8 Left 955339761 3:58116348-58116370 CCCAGAAAGGTGGCTGCTTGGGC 0: 1
1: 0
2: 3
3: 20
4: 172
Right 955339765 3:58116363-58116385 GCTTGGGCATGGGTGTGTCCTGG 0: 1
1: 0
2: 1
3: 29
4: 251
955339761_955339771 25 Left 955339761 3:58116348-58116370 CCCAGAAAGGTGGCTGCTTGGGC 0: 1
1: 0
2: 3
3: 20
4: 172
Right 955339771 3:58116396-58116418 GCGCTTCCCCCTCAGAACACAGG 0: 1
1: 0
2: 2
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955339761 Original CRISPR GCCCAAGCAGCCACCTTTCT GGG (reversed) Intronic
900516221 1:3083451-3083473 GCCCAGGGAGACACCTTTCTAGG + Intronic
900576483 1:3385058-3385080 GCCCAAACAGCCAGGTTTCTGGG + Intronic
900715530 1:4141267-4141289 GCCCCAGCTGCCTCTTTTCTAGG + Intergenic
901148108 1:7081875-7081897 GACCAAGCAGGCACATCTCTGGG + Intronic
902245079 1:15115345-15115367 GGCTTAGCAGCCACATTTCTAGG + Exonic
902468143 1:16630674-16630696 GCCCAAGCACCCCCACTTCTGGG + Intergenic
902506016 1:16939355-16939377 GCCCAAGCACCCCCACTTCTGGG - Intronic
903154999 1:21437014-21437036 GCCCAAGCACCCCCACTTCTGGG - Intergenic
904026202 1:27505102-27505124 CCCCAGGCAGCCAAGTTTCTGGG - Intergenic
905923877 1:41736396-41736418 GCCCCAGGACCCACCCTTCTTGG - Intronic
906748898 1:48241397-48241419 GCCCAAGCATGCATCTCTCTGGG - Intronic
906845929 1:49191975-49191997 AACCCAGCAGCCACATTTCTAGG - Intronic
909074893 1:71040898-71040920 TGCCAAGCACCCACCTCTCTTGG - Intronic
911411501 1:97514377-97514399 GCCCAATTAGCCACCTATTTCGG + Intronic
912231526 1:107798376-107798398 GCACAAACAGCCACCTGCCTGGG - Intronic
913538337 1:119795593-119795615 GCCCAAGCAGACACCTAGCCAGG - Intronic
914424759 1:147565576-147565598 CCCAAAGCAGCCAGCCTTCTAGG - Intronic
916742860 1:167661587-167661609 GCCACAGCAGCCACCATCCTGGG + Intronic
920094543 1:203477595-203477617 TTCCCAGCAGCCACCTGTCTGGG + Intronic
920205296 1:204286871-204286893 GCAGAAGCAGCCAAGTTTCTGGG - Intronic
920934128 1:210415396-210415418 CCCCAGGCAGACCCCTTTCTGGG - Intronic
921046412 1:211481058-211481080 GCCACTGCAGCCACCTTTCCTGG + Intronic
924783840 1:247176554-247176576 CCCCAAGCAGACCCCGTTCTTGG + Intergenic
1062929802 10:1345212-1345234 GCCCATGCTGACACCATTCTGGG - Intronic
1063058819 10:2529620-2529642 GCCCCACCAGCCACATTTCACGG + Intergenic
1063552384 10:7045189-7045211 GCCAAAGTTGTCACCTTTCTGGG - Intergenic
1070331020 10:75417327-75417349 TCCCTTGCAGCCAGCTTTCTAGG - Intergenic
1070609764 10:77925682-77925704 GCACAATCAGCCACCAGTCTGGG + Intronic
1070818490 10:79340514-79340536 GCCCAAGCAGCCATCTTCTGTGG + Intergenic
1074386537 10:113020821-113020843 GCCAAAGCAGCCAGCTAGCTAGG + Intronic
1074582050 10:114729006-114729028 GCATAAGCAGGCACCTTTCTAGG + Intergenic
1075492565 10:122885123-122885145 CCCCAAGCATCCTCCTTCCTTGG - Intergenic
1078089773 11:8257714-8257736 TCCCAAGGTGCCACCTGTCTTGG + Intronic
1084170101 11:67396858-67396880 GCCCAAGCCCCCACCTTCCCAGG - Intronic
1084785039 11:71437337-71437359 GGTCAAGCAGCCACCTTACCTGG + Intronic
1091632977 12:2176306-2176328 GCCCCTGCAACCACCTCTCTAGG - Intronic
1094750225 12:33397742-33397764 GCCCAAGGAGCCCCCTTCCTTGG + Intronic
1095664150 12:44775070-44775092 GCCCGAGCAGCCAGCTACCTGGG - Intronic
1101039070 12:100736034-100736056 AACCAAGCAAGCACCTTTCTTGG + Intronic
1103997960 12:124842244-124842266 GCCCAGGCAGTCACCTGTCCAGG + Intronic
1112128645 13:96497510-96497532 GTCTAAGCAGCCACCTTTCATGG + Intronic
1112397652 13:99047841-99047863 CCTCAAGCAACCACCTTTCCAGG + Intronic
1115089501 14:29556996-29557018 CCCCAGGCAGGGACCTTTCTGGG + Intergenic
1115650442 14:35399140-35399162 GCCCAGTCTCCCACCTTTCTAGG - Intergenic
1117245350 14:53879470-53879492 GCCCAAGCACCCACCACCCTCGG + Intergenic
1118056079 14:62081113-62081135 GCACAGGCAGCCACATCTCTGGG - Exonic
1118161895 14:63299101-63299123 GCCAAAGCAGCTAACATTCTTGG + Intergenic
1119000696 14:70879096-70879118 GGCCCAGCAGGCACCTTGCTTGG + Intergenic
1128048387 15:64640269-64640291 GCTCAAGCAGCCTCCCATCTTGG + Intronic
1129272840 15:74428564-74428586 GAACCAGCAGCCTCCTTTCTGGG + Intronic
1129797597 15:78389790-78389812 ACCCAGGCAGCCTCCTTTCTTGG + Intergenic
1129807800 15:78479032-78479054 GCTCAAGCTCCCACCTTGCTGGG + Intronic
1130922988 15:88364649-88364671 GCCCACGCAGTCATCTCTCTGGG - Intergenic
1131345680 15:91645933-91645955 GCCCAGGGAGCCAGCTTACTTGG + Intergenic
1131799559 15:96054782-96054804 GCCCAAGCATCTACCAGTCTGGG - Intergenic
1132337343 15:101056817-101056839 GCCCAGGCAGCGACCTGACTTGG + Intronic
1136010839 16:27362708-27362730 GCCCAAGGAGGCACCTCCCTGGG + Exonic
1138550617 16:57746017-57746039 TCCCACGCCGCAACCTTTCTTGG + Intronic
1138904530 16:61314919-61314941 GCTCAAGCAACCGCCTGTCTTGG - Intergenic
1141109906 16:81263715-81263737 GCCCAAGCACATACCTTTCCTGG + Intronic
1144768626 17:17746553-17746575 GCCCCAGCAGCCCCCATCCTTGG - Intronic
1144789923 17:17851852-17851874 GCCTGAGCAGTCACCTTGCTTGG + Intronic
1146322852 17:31859787-31859809 TCCCCAGAAGCCACCTTTCGAGG - Intergenic
1146566687 17:33919215-33919237 GGCCAGGCAGACACCTTTCCAGG - Intronic
1148237200 17:45976724-45976746 TCCCAAGCAGCTCCCTTTCTGGG + Intronic
1148357895 17:46988297-46988319 GCCCCAGCAACCACCAATCTTGG - Intronic
1149006475 17:51811256-51811278 GACCAAACAGTCCCCTTTCTTGG + Intronic
1149575010 17:57705604-57705626 GCTCAAGCAGCCCCTTCTCTGGG + Intergenic
1151148672 17:72065047-72065069 GCCCAAGCTCCCAGCCTTCTTGG + Intergenic
1152118087 17:78401049-78401071 GCCCAAGCTCCCACCTTTCTGGG - Intronic
1152778802 17:82217466-82217488 GCCCCGGCATCCACCTTCCTCGG + Intergenic
1153910779 18:9704973-9704995 CACCGAGCAGCCACCTTCCTTGG + Intergenic
1156303151 18:35853110-35853132 GGCCAAGCAGCCCACTTTCCTGG - Intergenic
1156476369 18:37408377-37408399 GACCAAGCACCCAACTTTCCAGG + Intronic
1157829886 18:50847549-50847571 TCCCACGGAGCCACCATTCTAGG - Intergenic
1157859311 18:51126185-51126207 TCCCCAGCAGCCTCCTTTATTGG - Intergenic
1157946562 18:51987400-51987422 GGCCAACCAGGCACCTTGCTCGG + Intergenic
1158078751 18:53563462-53563484 GCCAAAGACTCCACCTTTCTGGG - Intergenic
1159434116 18:68393851-68393873 TAACAAGCAGCCACATTTCTTGG - Intergenic
1161376059 19:3939547-3939569 GGACAAACAGCCACCCTTCTTGG + Intronic
1161514413 19:4688778-4688800 GCACAAGCAGCCCCGCTTCTGGG - Exonic
1162712170 19:12603556-12603578 GCTCAAGCATCCACCTACCTTGG - Intronic
1163451430 19:17379523-17379545 GCCCAACCAGCCATTTCTCTGGG + Intergenic
1163684210 19:18701408-18701430 GGCCAAGCAGGCATCTTTCAAGG - Intronic
1165660708 19:37578292-37578314 AGCCAGGCAGCCACCTTCCTGGG + Intronic
1166293274 19:41877060-41877082 ACCCAAGCAGCCACCTCTCAGGG + Intergenic
1167619298 19:50552081-50552103 GCCCAACCACCCCCCTTTCTTGG - Intronic
1168304734 19:55429342-55429364 GCTCAAGCTGGCTCCTTTCTGGG + Exonic
1168474424 19:56665553-56665575 GCTCAAGCAACCACCTGCCTTGG - Intronic
925714367 2:6771246-6771268 GGCCAAGCAGCCGCCTCTCCAGG + Intergenic
930217295 2:48709787-48709809 TCCTAGGCAGCCTCCTTTCTGGG + Intronic
931201733 2:60104204-60104226 GCCCAAGCTGCAACCCTTTTTGG - Intergenic
932288047 2:70553501-70553523 GCCCAGGCAGCCACTTTCCCGGG + Intronic
932364801 2:71143423-71143445 GCCCAGCCAGCCACCATGCTGGG + Intronic
935707607 2:105870298-105870320 CCCCAAGCAGCCACCCTGCCTGG - Intronic
936820724 2:116517742-116517764 TCACAAGCAGCAACCTTTGTAGG + Intergenic
938080502 2:128367542-128367564 GCCCCAGCTGCCTCGTTTCTTGG + Intergenic
938722532 2:134079349-134079371 GGATAAGCAGCCTCCTTTCTAGG + Intergenic
939962565 2:148578352-148578374 GCCAAAGAAGCAACCTATCTAGG - Intergenic
941048198 2:160700338-160700360 GCCCAAGTAGCCACACTTCAAGG - Intergenic
941746046 2:169087989-169088011 GCCCAAGCTGGCATCTTACTAGG + Intronic
941896676 2:170636261-170636283 GGCCAGGCAGTCACATTTCTAGG - Intronic
942457667 2:176149178-176149200 TCCCAAGTATCCACCTTCCTGGG - Intergenic
942514924 2:176741967-176741989 GCTCAAGCATCCTCCTTCCTTGG + Intergenic
942846650 2:180434628-180434650 GCCAAAGCAACATCCTTTCTGGG + Intergenic
943373167 2:187041699-187041721 GGCCCAGCAGGTACCTTTCTTGG + Intergenic
946729155 2:222691708-222691730 GCCCAAGCGGCTGCCTCTCTGGG + Intronic
947432520 2:230043544-230043566 CCCCAAGCACCCTCCTGTCTGGG - Intronic
948482115 2:238256729-238256751 GCCCAGGCAGCAACCTGTCCAGG - Intronic
1169050352 20:2571765-2571787 GCTCAAGCAGTCACCTGCCTCGG - Intronic
1171302939 20:24079703-24079725 GCCCATGCTGCCTCCTTGCTGGG - Intergenic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1176300572 21:5097089-5097111 GCCCAAGCTGCCAGGTGTCTGGG + Intergenic
1179471188 21:41611808-41611830 GCCCAAGGAGCGACCTCTCGAGG + Intergenic
1179856471 21:44164892-44164914 GCCCAAGCTGCCAGGTGTCTGGG - Intergenic
1180014198 21:45072355-45072377 GCACAAGCAGCCTCCATTCTGGG + Intergenic
1181952700 22:26566052-26566074 GCCACAGCAGCCACATTTCGAGG + Intronic
1184066583 22:42125031-42125053 GGCCAGGCTGCCACCTTTCGGGG + Intergenic
1184069051 22:42137183-42137205 GGCCAGGCTGCCACCTTTCGGGG + Intergenic
1184346039 22:43913697-43913719 GTCCAAGCTGCCACCTCTCTGGG + Intergenic
1185064973 22:48627651-48627673 GACCCAGCAGCCTCCTTTCTTGG + Intronic
1185266008 22:49904323-49904345 CCCCCAGCACCCACCTGTCTGGG + Exonic
951501266 3:23390058-23390080 CCCCACTCAGCCACCATTCTGGG + Intronic
954380302 3:50215679-50215701 GCCCAACCAGCCAGCTTTCAGGG - Intronic
954730246 3:52654467-52654489 TCCCATGCAGCCAGCTTGCTTGG + Intronic
955339761 3:58116348-58116370 GCCCAAGCAGCCACCTTTCTGGG - Intronic
956776141 3:72567175-72567197 GCCCAGGCAGACACATTCCTAGG + Intergenic
956845447 3:73178216-73178238 GCACAAGCAACCACCATTCTTGG + Intergenic
959740680 3:109715818-109715840 TACCAAGCTGCCACCTCTCTTGG + Intergenic
961636138 3:128334304-128334326 GCCCCAGGAGCCATCTTTTTGGG + Intronic
963054550 3:141174992-141175014 GACCATGCAGCCACCTTGCCTGG + Intergenic
964608017 3:158579347-158579369 CTCCAAGCAGCTGCCTTTCTGGG + Intronic
968914580 4:3491858-3491880 ACCCATGCAGCCACCCTTCGGGG - Intronic
978443838 4:108762521-108762543 GCCCTAGCAGACACCATTCCAGG - Intronic
980419628 4:132542839-132542861 TACTAAGCAGCCACCCTTCTTGG - Intergenic
981117658 4:141010787-141010809 GCCCAGGCAGCCTCCTCCCTGGG - Intronic
985088718 4:186342153-186342175 GTCCTAACAGCCACCTTCCTGGG + Intergenic
985811963 5:2096866-2096888 GACCAGGGAGCCACCTCTCTTGG + Intergenic
988081053 5:26416133-26416155 GCCGAAGCAGCCACTGTTCCTGG - Intergenic
999901218 5:156088837-156088859 GTCCAAGCAGCCTCCTCTGTGGG + Intronic
1000908165 5:166988786-166988808 GTGCAAGCAGCCACATTTCTAGG - Intergenic
1001502152 5:172245477-172245499 GCTCAAGCAGTCGCCTGTCTTGG - Intronic
1001980375 5:176034014-176034036 GCCACAGCAGCCACCCTCCTGGG + Intronic
1002067425 5:176658948-176658970 GGCCAAGGAGCCACATTGCTGGG - Exonic
1002237086 5:177810051-177810073 GCCACAGCAGCCACCCTCCTGGG - Intergenic
1002703069 5:181140959-181140981 GCCCCAGCTGCCTCCTTACTGGG + Intergenic
1002724283 5:181284015-181284037 GCCACAGCAGCCACCCTCCTGGG - Intergenic
1002828824 6:800038-800060 GACCAAGCACCCACATTTGTGGG + Intergenic
1002842225 6:915962-915984 GCCCAAGCCCCCACCTTTCTAGG + Intergenic
1003076147 6:2985262-2985284 GCCCAAGGAGGCACCCTTCTGGG - Intergenic
1003471989 6:6445049-6445071 GGCCATGCTGCCACCTCTCTGGG - Intergenic
1003645033 6:7907841-7907863 GCCCACTCAGCCTCCTTTCCTGG + Intronic
1006494525 6:34412408-34412430 GCCCAAGCATCCAGCATTCTTGG + Intronic
1006910453 6:37560065-37560087 CCCGTAGCAGCCACCTCTCTGGG + Intergenic
1012872430 6:104687938-104687960 GCCCAACCAGCCCCCCTTCATGG - Intergenic
1017915176 6:158826010-158826032 GACCAAACAGCCACATTTCCCGG + Intergenic
1018534619 6:164807137-164807159 GCCCATGCAGCTACATTTGTGGG + Intergenic
1019774185 7:2902524-2902546 CCCAAAGCAGCCCCCTTCCTGGG + Intergenic
1019843826 7:3476795-3476817 TCCCAGTCAGCCACCTTGCTGGG - Intronic
1024122993 7:46264035-46264057 GCCCAGGCAGCCAACATGCTTGG + Intergenic
1027844205 7:83351027-83351049 TCCCAAGCAGCTTACTTTCTTGG - Intergenic
1031528547 7:122850275-122850297 TCCCCAGCAGCCTCCTTTCAGGG + Intronic
1033137692 7:138798429-138798451 GCAGGAGCAGCCACCTCTCTTGG + Intronic
1033910055 7:146252188-146252210 GCCAAAGCAGCCACATGACTTGG + Intronic
1034929524 7:155150595-155150617 GCCCAGGCACCCTCCCTTCTGGG + Intergenic
1035065667 7:156103453-156103475 GCCCAAGCAGCCTCCACCCTGGG + Intergenic
1035419943 7:158719143-158719165 GCTCAAGCAACCTCCTGTCTTGG - Intergenic
1036144392 8:6240978-6241000 GTACAAGCAGACAGCTTTCTGGG - Intergenic
1040021546 8:42745566-42745588 GCTCAAGCACCCACCTGCCTCGG + Intergenic
1041959989 8:63602222-63602244 TACCAGGGAGCCACCTTTCTTGG - Intergenic
1042735117 8:71979112-71979134 GCCCAATCAGCCACTTGGCTTGG + Intronic
1042915799 8:73874828-73874850 GCTCAAGCAGTCACCTGCCTTGG - Intronic
1042938941 8:74088480-74088502 CCCCAAGCATCCACCCTTCTGGG + Intergenic
1046921961 8:119740098-119740120 ACCATGGCAGCCACCTTTCTTGG - Intronic
1047212199 8:122849082-122849104 GGCCAGGCAGGGACCTTTCTGGG + Intronic
1049426005 8:142538170-142538192 CCCCATGGTGCCACCTTTCTGGG + Intronic
1050580756 9:7053500-7053522 GCTCATCCAGCCACCTTGCTTGG + Intronic
1050915211 9:11122598-11122620 GCCCATGCAGCAAACTTTCCTGG + Intergenic
1053147628 9:35722697-35722719 GCCCAAGCTGTCTGCTTTCTTGG + Intronic
1053307420 9:36994395-36994417 GGCCAAGCAGCCACACTCCTTGG - Intronic
1056556656 9:87695222-87695244 GCCTAAGCAGCCAGCTTTGGAGG + Intronic
1056755659 9:89380580-89380602 TCCCCAGCAGCCACCTTCCAGGG - Intronic
1056994016 9:91438022-91438044 GGCCCAGCAACCCCCTTTCTGGG - Intergenic
1060983522 9:127807156-127807178 GCCCATGCAGCCCCTTCTCTGGG - Intronic
1186711748 X:12204974-12204996 GCCGAAGGAGTCACCTCTCTGGG + Intronic
1187526900 X:20062416-20062438 GCCCAAGAAGCACCCTTTCATGG - Intronic
1188801540 X:34537451-34537473 GCCCAAGCAGCCTCCTGCCTTGG + Intergenic
1189217379 X:39337712-39337734 GCCCAAGCAGCCACCCTTCCAGG - Intergenic
1189973714 X:46442316-46442338 GCCCATGCAGCTACCATCCTGGG - Intergenic
1190382746 X:49855410-49855432 GCCCCAGCTGCCACCTGACTTGG - Intergenic
1191641546 X:63433189-63433211 GCCCAAGCAGACACCCTCCACGG - Intergenic
1196976196 X:121160239-121160261 GCCCAAGCAGGTACCTGTCTGGG - Intergenic
1197117612 X:122851710-122851732 ACTCAAGCCGCCACCTTTCCAGG - Intergenic
1197568819 X:128123011-128123033 GCCTAAGGAGCTAACTTTCTTGG + Intergenic
1198275450 X:135094713-135094735 GGACAAGCAGCCACCTCTCAGGG + Intergenic
1199267462 X:145845029-145845051 GCCCAAGCAGCCATGCTACTGGG + Intergenic