ID: 955340042

View in Genome Browser
Species Human (GRCh38)
Location 3:58118153-58118175
Sequence TGCCACCCGGCCACCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955340035_955340042 28 Left 955340035 3:58118102-58118124 CCAGCCTGGAACCGGCGAGAGGA 0: 1
1: 0
2: 0
3: 8
4: 66
Right 955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 57
955340036_955340042 24 Left 955340036 3:58118106-58118128 CCTGGAACCGGCGAGAGGAGAGA 0: 1
1: 0
2: 1
3: 16
4: 175
Right 955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 57
955340038_955340042 17 Left 955340038 3:58118113-58118135 CCGGCGAGAGGAGAGAAATGGCG 0: 1
1: 0
2: 2
3: 4
4: 99
Right 955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955340042 Original CRISPR TGCCACCCGGCCACCCGTGA GGG Intronic
900609256 1:3537535-3537557 TGCCCCCCGGCCACTCGTTCAGG - Intronic
901764013 1:11488504-11488526 TTCCACCTGGGCACCCGTGGTGG + Intronic
903184657 1:21622369-21622391 TGCCACCCGGCCGTCCGCGGAGG - Intronic
906147123 1:43566745-43566767 TGCCACTCTGCCACCCGGGAAGG - Intronic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
908501084 1:64744831-64744853 CGCCACCCGGACACCTGTGAGGG - Intergenic
924216369 1:241826494-241826516 TGCCACCAAGCCACTCATGAAGG + Intergenic
924559047 1:245142661-245142683 TTCCTCACAGCCACCCGTGAGGG - Intergenic
924730877 1:246710545-246710567 TGTCACCAGGCCATTCGTGAAGG + Intergenic
1075641992 10:124071310-124071332 GGCCACAAGGCCACCTGTGATGG - Intronic
1084473972 11:69378352-69378374 GGACACCCGGCCAGCCGTGTGGG - Intergenic
1093031632 12:14294293-14294315 TGCCACCTGGACACCAGGGAGGG - Intergenic
1104908455 12:132228086-132228108 TGCCCCCCCGCCACCCCTGCTGG - Intronic
1106104474 13:26722159-26722181 TGCCACTCACCCACCCGAGAAGG + Intergenic
1118043094 14:61938416-61938438 TCCCACCCAGCCAACCCTGAAGG - Intergenic
1121329970 14:93043771-93043793 TGCCAGCCTGCCACCAATGAGGG - Intronic
1129356275 15:74994299-74994321 TGCCACCAGGCCAACCAGGAAGG - Intronic
1132526201 16:416378-416400 TGCCAGCCAGAAACCCGTGATGG - Intergenic
1132773729 16:1580065-1580087 AGCCACCCAGCCAGCCGTCAGGG + Intronic
1135577303 16:23595941-23595963 GGTCACCCGGCCTCCCGTCAGGG + Intronic
1152306082 17:79520773-79520795 TGGCACCCGGCCAGCCGGGAGGG - Intergenic
1152551340 17:81031928-81031950 TGCAACCCGGGCACCAGCGATGG - Intergenic
1152783591 17:82237005-82237027 TGCCACCCACCCACTCGAGAGGG - Intronic
1154105553 18:11519485-11519507 TGCCCCATGGCCACCCGGGAAGG - Intergenic
1156653676 18:39257003-39257025 TGCCACCCAGTCACCCATGCTGG - Intergenic
1159224912 18:65521896-65521918 TGCCACCCAGCCACTGCTGAGGG - Intergenic
1162496038 19:11023933-11023955 TGCCCCCCGGCCCCCCATCATGG + Intronic
1164646612 19:29862926-29862948 TGCCACGTTGCCCCCCGTGAAGG - Intergenic
926123391 2:10256716-10256738 TGCCACCAGGCCAGCGGTGGAGG - Intergenic
928405114 2:31008874-31008896 TGGTCCCCGGCCACCCGTGCAGG - Intronic
947591369 2:231388063-231388085 TGCAACCCGGCCAGGCGTGGCGG - Intergenic
948351015 2:237340863-237340885 TGCCAGCATGCCACCTGTGAAGG - Exonic
948601592 2:239110816-239110838 CGCCACCCAGCCACCCCTGCAGG - Intronic
948958540 2:241314933-241314955 TGCCTCCAGGCCACGCGGGAGGG + Intronic
1175517335 20:59577720-59577742 GGCCTCCCGGCCACCCGCAACGG - Intronic
1179124125 21:38576704-38576726 TGCCTCCTGGCCACCTGTCAGGG + Intronic
1180968976 22:19805130-19805152 AGCCACCCTGCCTCCTGTGAGGG + Intronic
1181965482 22:26653695-26653717 TGACACCTGGGCACCAGTGAGGG - Intergenic
1184730719 22:46369657-46369679 GGGCACCCGGACTCCCGTGAAGG + Intronic
949755060 3:7399644-7399666 TGCCACCTAGCCACTCATGAGGG - Intronic
955340042 3:58118153-58118175 TGCCACCCGGCCACCCGTGAGGG + Intronic
955360608 3:58270981-58271003 AGCCACCTGGCCACCCATGGAGG - Exonic
969627762 4:8316453-8316475 TGCAACCAGGACACCTGTGACGG + Intergenic
969675801 4:8613756-8613778 AGCCACCTGGCCAGCCGAGAAGG - Intronic
972045858 4:34664077-34664099 TGACACCCGGCCAGGCGTGGTGG - Intergenic
980969513 4:139555966-139555988 GGGCAACCGGCCACCCGTGTAGG + Intronic
985547870 5:519133-519155 TGCTTCCAGGCCTCCCGTGATGG + Intronic
985998204 5:3609300-3609322 TGCCTCCCGGCCACCCCAGAGGG + Intergenic
993079449 5:83277439-83277461 AGCCCTCAGGCCACCCGTGATGG + Intronic
1004690460 6:17988058-17988080 TGCCACCCGGAGCCCCGGGACGG + Intergenic
1007424264 6:41736511-41736533 CGCCACCCACCCACCCATGATGG + Intergenic
1008074700 6:47133446-47133468 TGCCACTCAGCCACCCGCGCTGG - Intergenic
1019527667 7:1487979-1488001 TGTCACCCTGCCCCCCATGAAGG + Intronic
1019582005 7:1769301-1769323 TTCCATCCGGCCACCCGTGTTGG + Intergenic
1034732314 7:153398908-153398930 AGCCACCTGGCCACCCTAGAGGG + Intergenic
1035354139 7:158266913-158266935 GGCCACCCCACCACCCCTGAAGG - Intronic
1035435270 7:158854958-158854980 TGCCAGCCAGGCCCCCGTGAAGG - Intergenic
1049796151 8:144498148-144498170 TGCCTCCAGGCCTCCCGGGAGGG - Intronic
1049987001 9:960952-960974 TGTCACCGGGCCACACGTGTGGG + Intronic
1059340879 9:113597011-113597033 TGCCTCCCTGCCCCCTGTGACGG + Exonic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1062324186 9:136004539-136004561 TCCCACCAGGCGGCCCGTGAGGG - Intergenic
1195580577 X:106496587-106496609 TGGCACCAAGCCACCCATGAAGG - Intergenic