ID: 955343864

View in Genome Browser
Species Human (GRCh38)
Location 3:58146679-58146701
Sequence CCACGTGAGCTGTGGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955343864_955343873 18 Left 955343864 3:58146679-58146701 CCCTTTGCCCACAGCTCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 142
Right 955343873 3:58146720-58146742 CCCCAGCATCAGGGCTGCCCTGG 0: 1
1: 0
2: 6
3: 54
4: 417
955343864_955343869 8 Left 955343864 3:58146679-58146701 CCCTTTGCCCACAGCTCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 142
Right 955343869 3:58146710-58146732 AATCCATTGTCCCCAGCATCAGG 0: 1
1: 0
2: 1
3: 12
4: 138
955343864_955343870 9 Left 955343864 3:58146679-58146701 CCCTTTGCCCACAGCTCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 142
Right 955343870 3:58146711-58146733 ATCCATTGTCCCCAGCATCAGGG 0: 1
1: 0
2: 0
3: 16
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955343864 Original CRISPR CCACGTGAGCTGTGGGCAAA GGG (reversed) Intronic
900658021 1:3769769-3769791 CCTCTCGAGCTGTGAGCAAAGGG - Exonic
905462128 1:38128924-38128946 CCATGTGAGGTGTGGCCAGAGGG - Intergenic
907055964 1:51368322-51368344 CCAAGACAGCTGTAGGCAAAGGG + Intronic
912179071 1:107195885-107195907 GCACATGAGGTGTGGGCACAGGG - Intronic
915063685 1:153207333-153207355 CCCCTTCAGCTGTGGGCAACAGG + Intergenic
915299542 1:154944257-154944279 CCAAGGCAGCTGTGAGCAAAAGG + Exonic
915347980 1:155207732-155207754 CTACTTGGGCTGAGGGCAAATGG + Intronic
922336358 1:224621621-224621643 CCACTTCAGCTGTGGGGCAATGG - Intronic
924173142 1:241362151-241362173 CCATGTGAGCTGTGAGAGAAAGG - Intergenic
924259215 1:242212412-242212434 CCATGCGAGCGGTGGGCAGAAGG + Intronic
924941635 1:248816346-248816368 CCACGTGGGCTCTGGGCTTATGG - Intronic
1063462357 10:6222812-6222834 CCACGTGAGCTCAGGGCACTCGG - Intronic
1063702225 10:8395449-8395471 CCACCTGAGCTCTGGCCACATGG - Intergenic
1065797316 10:29319310-29319332 TTACGTGAGCTGTGTTCAAAGGG - Intergenic
1065831847 10:29621653-29621675 CCACATGGGCTGTGGGCCCATGG + Intronic
1066012254 10:31205528-31205550 CCTCTTCAGCTGTGAGCAAAGGG - Intergenic
1076721057 10:132393467-132393489 CCACAGCTGCTGTGGGCAAAAGG + Intergenic
1076942341 10:133618212-133618234 ATACCTGAGCTGTGGGCAATGGG - Intergenic
1079103894 11:17558448-17558470 CAACTTGAGCTGTGGGGAGAGGG - Intronic
1081762224 11:45584530-45584552 CCCAGTGGGCTGTGAGCAAAGGG - Intergenic
1083658774 11:64242452-64242474 CCACGGGGGCCGAGGGCAAAAGG + Exonic
1085427649 11:76419301-76419323 TCATTTGAGCTGTGGGCAGAAGG + Intergenic
1088363673 11:109017192-109017214 TAAAGTGAGATGTGGGCAAATGG + Intergenic
1088692252 11:112338047-112338069 CCACAGGAGCAGAGGGCAAAAGG + Intergenic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1098857693 12:75671204-75671226 CTCCTTGAACTGTGGGCAAAGGG + Intergenic
1099997325 12:89793247-89793269 CCACCTGGGCTGAGGGAAAAAGG - Intergenic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1101672419 12:106888510-106888532 CCAGGTGTGCTGTGGGGAAAAGG - Intronic
1104580815 12:130009508-130009530 ACAGGTGTGCGGTGGGCAAACGG - Intergenic
1105943993 13:25174561-25174583 CCCAGTAAGCTTTGGGCAAAGGG - Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1112626724 13:101113321-101113343 CCAGGTGAGCTCTAGGCCAAAGG - Intronic
1113133120 13:107060232-107060254 CCACTTCAGCTGTGGCTAAAAGG - Intergenic
1113790951 13:113027868-113027890 CCAGGTGTGCTGTGGCCAGAGGG + Intronic
1113866935 13:113532554-113532576 CCACTGGAGCTGTGGGGGAAGGG + Intronic
1115018929 14:28651043-28651065 CCACGTGTGCTGGAGGTAAAGGG - Intergenic
1118282454 14:64442081-64442103 CCATGTGCGATGTTGGCAAACGG - Exonic
1119023631 14:71135766-71135788 CCACAGGACCTGTGGGCCAAGGG - Intergenic
1121469188 14:94138817-94138839 TCAAGTCAGCTGTGGGCCAAAGG - Intergenic
1122860940 14:104582128-104582150 GGAGGTGGGCTGTGGGCAAAAGG + Intronic
1123135136 14:106021208-106021230 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123164514 14:106313930-106313952 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123585688 15:21759078-21759100 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123622330 15:22201666-22201688 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123945933 15:25238903-25238925 CCACATGGGCTTTGGGCCAAGGG + Intergenic
1124955348 15:34356586-34356608 CCCAGTGATCTGTGGGCAGAAGG + Exonic
1128761137 15:70216718-70216740 ACACGTGAGCCATGTGCAAAAGG - Intergenic
1129828523 15:78651664-78651686 CCATGTGAGTTATGGGCTAAGGG - Intronic
1129845836 15:78767385-78767407 CCACCTGGGCTGTGGGGAACTGG - Exonic
1130256027 15:82326475-82326497 CCACGTAGGCTGTGGGGAACTGG + Intergenic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134198084 16:12174476-12174498 CCATTTGAGCTCTGGGCAGATGG + Intronic
1134328323 16:13227477-13227499 CCACGTGAGATGTAAGGAAAAGG + Intronic
1136933010 16:34435735-34435757 CCACCTAAGCTGGGGCCAAAAGG + Intergenic
1136971562 16:34976079-34976101 CCACCTAAGCTGGGGCCAAAAGG - Intergenic
1141889979 16:86919931-86919953 ACAGGTGAGCTGTGGGCTGATGG + Intergenic
1143971461 17:10799078-10799100 CCACGCAGGCTGTGGGCAGAAGG + Intergenic
1149515638 17:57278927-57278949 CCACGTCTGCAGTGGCCAAAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1154502232 18:15002684-15002706 CCTCATGGGCTGTGGGCTAAGGG + Intergenic
1158892319 18:61884254-61884276 CCACGTGACCTGAGTGCACAAGG - Intronic
1166682050 19:44774802-44774824 CCACGAGACCTTTGGACAAATGG - Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
925818905 2:7779857-7779879 CCTCTTTAGCTGTGGGCTAAGGG - Intergenic
925973078 2:9121301-9121323 TCACCTGACCTGTGGGCAGAAGG - Intergenic
926068687 2:9866255-9866277 CCCCATGAAATGTGGGCAAAGGG + Intronic
930569135 2:53062642-53062664 CCACATGGGCTCTGAGCAAAAGG + Intergenic
934053706 2:88233486-88233508 CCCCAAGAGCTTTGGGCAAAAGG - Intergenic
935582755 2:104772485-104772507 CCATCTTAGCTGTGGACAAAGGG + Intergenic
938478332 2:131635849-131635871 CCACGTGGGCTGTGGGAACCTGG - Intergenic
938501406 2:131832856-131832878 CCTCATGGGCTGTGGGCTAAGGG + Intergenic
939034315 2:137112798-137112820 CCACATCAGCAATGGGCAAAAGG + Intronic
939348521 2:141000603-141000625 CCACTTGCACTGTGGGCGAAAGG + Intronic
940211790 2:151262715-151262737 CCAGGTGAGCGGTGGGGGAAGGG - Intergenic
940728407 2:157361804-157361826 CCACCCCAGCTGTGGGTAAAAGG + Intergenic
946298852 2:218809764-218809786 CCACGTGAGCTGGGGCCTGAAGG + Exonic
948802273 2:240438323-240438345 CCACGTGGGCTGAGGGAAACAGG + Intronic
1168830297 20:841838-841860 CCACGTCACGGGTGGGCAAACGG - Intronic
1169004284 20:2193868-2193890 CCGCCTGAGGTGTGGGCGAATGG - Intergenic
1169604569 20:7302314-7302336 ACACATTAGCTGGGGGCAAAAGG + Intergenic
1172828113 20:37807450-37807472 CCATGATAACTGTGGGCAAATGG + Intronic
1176146810 20:63569129-63569151 CCAAGTGAGCTGGGGGCAACAGG - Exonic
1177458354 21:21374563-21374585 CCACGTGAGTTTTGGGAAATGGG + Intronic
1179626466 21:42652367-42652389 CCACTGGAGCTGTGGGCAGGGGG + Intergenic
1181522361 22:23456975-23456997 CCACGTGAGCAGTGCTCACACGG - Intergenic
1181795224 22:25303217-25303239 CAATGTGTGCTGTGGGCAATTGG + Intergenic
1182211218 22:28679299-28679321 CCACGGGGGCTGGGGGAAAAGGG + Intronic
1182614545 22:31578212-31578234 CCAGGGAAGCAGTGGGCAAAGGG - Intronic
950423020 3:12909791-12909813 CCATGGGAGCTGTGGGCCACAGG - Intronic
951637817 3:24798843-24798865 ACACTCAAGCTGTGGGCAAATGG + Intergenic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
960301033 3:116002740-116002762 CAAAGTAAGCTGAGGGCAAAAGG - Intronic
961160982 3:124725537-124725559 CCACCTGGGCTGTCTGCAAATGG - Intronic
963259395 3:143177512-143177534 CCACGGGAAATGAGGGCAAATGG + Intergenic
967855218 3:194112305-194112327 CCAGGTCAGATGTGGGCAGATGG + Intergenic
970098960 4:12498500-12498522 CCACCTGAGCTGTGGGCCCCAGG - Intergenic
972747441 4:41951260-41951282 CCACCTGAACTGTGCTCAAAAGG - Intronic
973647132 4:52961112-52961134 TCACGGGAGCTGAGGGTAAAGGG - Intronic
976284629 4:83359619-83359641 CAATGTGAGCTTTGGGCAAGAGG - Intergenic
978763445 4:112379877-112379899 TGACGTGAGGTGTGGGGAAAGGG + Intronic
981722752 4:147817954-147817976 CCAGTTGAGATCTGGGCAAAAGG + Intronic
989391476 5:40905209-40905231 CCAAGGGAGGTGAGGGCAAATGG + Intergenic
997865443 5:137458747-137458769 ACATGTGCTCTGTGGGCAAAAGG + Intronic
998331713 5:141333027-141333049 CCAGGAGAGCTGTGAGAAAAAGG + Exonic
998332538 5:141341314-141341336 CCAGGAGAGCTGTGAGAAAAAGG + Exonic
1002192096 5:177483618-177483640 CCGCGGCAGCTGTGGGCAGAAGG + Exonic
1002692044 5:181056775-181056797 TCACATGAGATGTGGGCACATGG - Intronic
1006408603 6:33859163-33859185 CCAGCTCAGCTCTGGGCAAAGGG - Intergenic
1006636291 6:35463571-35463593 CCAGGTGAGAGGTGTGCAAAGGG + Intronic
1006680876 6:35796012-35796034 CCACGTGAGAAGTGGGCATGCGG + Intronic
1007336289 6:41157328-41157350 CCATGTGAGCTATGGCCACAGGG + Intergenic
1009611009 6:65940990-65941012 CAATGTTAGCTGTGGGCTAATGG + Intergenic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011458589 6:87579301-87579323 CAACGTGGGCTCTGGGCAGAAGG + Intronic
1018322790 6:162630937-162630959 CCTTTTGATCTGTGGGCAAATGG - Intronic
1018577722 6:165276900-165276922 CTAAGTGAGCTGTGGACACATGG - Intergenic
1018698892 6:166411958-166411980 CCACGGGAGCTGGGGACAGACGG + Exonic
1019039606 6:169092694-169092716 CCTTGTGAGCTGTGTGAAAAGGG - Intergenic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019520193 7:1457370-1457392 CCACCGGAGCTGGGGGCAGAGGG + Intronic
1020664933 7:11028764-11028786 CCATGTGACCTGTGCTCAAAAGG + Exonic
1022077057 7:26982149-26982171 CCATCTTAGCTGTGGACAAAGGG - Intronic
1026829040 7:73600404-73600426 CCAAGTGGGGTGTGGGCAAGAGG + Intronic
1031301827 7:120069568-120069590 CCACTTCAGCTGTAGGCACAGGG - Intergenic
1032853747 7:135817043-135817065 CCAGCTGAGCTGTCGGCAAGGGG - Intergenic
1034106117 7:148491265-148491287 CCATGAGACCTGGGGGCAAAGGG + Intergenic
1038452309 8:27647680-27647702 GCATGTGAGGTGTGGGCAACAGG + Intronic
1042357080 8:67839993-67840015 CCACTTGATCTGAGGTCAAATGG - Intergenic
1048790033 8:138093448-138093470 CCACTTCAGCTGTGGCTAAAGGG - Intergenic
1049010261 8:139882620-139882642 CCACGTCATCTATGGGGAAAGGG + Intronic
1049379549 8:142305222-142305244 CCCCAGGAGCTGTGGGCAGAGGG + Intronic
1052311165 9:27070889-27070911 TAACGTTAGCTGTGGGAAAAGGG + Intergenic
1053307896 9:36996735-36996757 CCACGGGAGCTATGGCCAGAGGG - Intronic
1059739939 9:117140327-117140349 CCACTGAAGCTGTGGGAAAAGGG + Intronic
1060670810 9:125467698-125467720 CCCCGGGAGCTGGGGGCACAGGG - Intronic
1062498249 9:136841664-136841686 CCTCATGGGCTGTGGGCTAAGGG - Intronic
1194144400 X:90245057-90245079 CCACTTCAGCTGTGGCTAAAAGG - Intergenic
1195613558 X:106895196-106895218 GCACCTGGGCTGTGGGCACAGGG - Intronic
1198037978 X:132820601-132820623 TCCAGGGAGCTGTGGGCAAAAGG + Intronic
1198533663 X:137567207-137567229 CCACGTGCCCTGTGGGCGACGGG - Exonic
1199773254 X:150988512-150988534 CCATCTTAGCTGTGGACAAAGGG + Exonic
1199982478 X:152928561-152928583 CCTCTTGAGCTGCGGGCCAAAGG - Exonic
1200302772 X:154995201-154995223 CAACGTGAGCCTTGGGAAAAAGG - Intronic
1200490160 Y:3814361-3814383 CCACTTCAGCTGTGGCTAAAAGG - Intergenic