ID: 955347269

View in Genome Browser
Species Human (GRCh38)
Location 3:58170412-58170434
Sequence CAGAGGCTCATAGAGCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347269_955347271 9 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
955347269_955347274 11 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 84
955347269_955347273 10 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 122
955347269_955347278 28 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347269 Original CRISPR CAGAGGCTCATAGAGCCTGA CGG (reversed) Intronic
900865840 1:5268043-5268065 CCGAGGCCCAGAGAGCATGAAGG - Intergenic
900949833 1:5852487-5852509 CAGGGGCTGATACAGGCTGAGGG + Intergenic
903266069 1:22158846-22158868 CTGAGGCTCAGAGAAGCTGAGGG + Intergenic
903307055 1:22420379-22420401 CAGGGGCTCAGAGAGGCTGCAGG - Intergenic
903562456 1:24238119-24238141 CTGAGGCTCAGACAGGCTGAAGG - Intergenic
904005276 1:27360353-27360375 CAGGGGCTGAGAGAACCTGAGGG + Exonic
904374896 1:30074401-30074423 CTGAAGCTCAGAGAGGCTGAGGG + Intergenic
904403360 1:30271361-30271383 CTGAGGCTCAAAGAGGTTGAAGG - Intergenic
904541084 1:31233875-31233897 CAGAGGCTCAGAGAGGGTGCAGG + Intronic
904855869 1:33497835-33497857 GAGAGGCTGATAGAGCAGGAGGG + Intergenic
904927788 1:34062232-34062254 CAGAGTCTCAGAGGGCCTGGTGG - Intronic
906698126 1:47838453-47838475 CAGAGCCTCACAGAGCCTGCAGG - Intronic
907552172 1:55313772-55313794 CATAGGCTTTTAGAGCTTGAAGG + Intergenic
908759784 1:67500939-67500961 CATAGGCTGCTAGAGCCAGAAGG - Intergenic
909541883 1:76800753-76800775 CAGAGGCTGAGAGACCCTAAGGG - Intergenic
912102127 1:106222698-106222720 CAGAGGATCATAGAGGGTGACGG - Intergenic
912275136 1:108248793-108248815 CAGTGGCTCCTTGAACCTGAGGG - Intergenic
912293086 1:108445556-108445578 CAGTGGCTCCTTGAACCTGAGGG + Intronic
913058881 1:115186852-115186874 CAGAGGCTCAGAGAGGGAGAGGG - Intergenic
915898235 1:159827665-159827687 CAGAGGCTCATAGGGACTTTGGG + Intronic
916361875 1:163979357-163979379 GAGAGGCTCAGAGAGCTAGAGGG - Intergenic
916604517 1:166327671-166327693 CAGAGCCTGTGAGAGCCTGAGGG - Intergenic
918131223 1:181631343-181631365 GAGAGGGGGATAGAGCCTGAAGG - Intronic
918350785 1:183653660-183653682 AAGAGGCCCATAGTCCCTGAAGG + Intronic
919531904 1:198731881-198731903 GAGAGACTCATAGAGGTTGACGG + Intronic
920695642 1:208179636-208179658 GAGAGGCTAATAGAGCCTCCAGG - Intronic
920934673 1:210420101-210420123 GAGAGGGTAATAGAGGCTGATGG - Intronic
921081223 1:211739735-211739757 CAAAGGCTCTTAGGGCCAGATGG + Intergenic
923229463 1:231970985-231971007 CACAGGCTCATAGAGCACCATGG - Intronic
1063167170 10:3473872-3473894 CATAGGCTCCTACAGCCTGTGGG - Intergenic
1063276543 10:4574338-4574360 CAGAGTCTCATAGAGAATGAAGG + Intergenic
1066223979 10:33364218-33364240 CAGAGGCTCAAAGAAACTAATGG - Intergenic
1067381513 10:45777958-45777980 AAGAGGCATATAGAGACTGAAGG - Intronic
1067889212 10:50118592-50118614 AAGAGGCATATAGAGACTGAAGG - Intronic
1067926679 10:50515575-50515597 CAGTGTGCCATAGAGCCTGATGG + Intronic
1071232621 10:83606378-83606400 CAGTGTCTTATGGAGCCTGAGGG + Intergenic
1071372405 10:84965857-84965879 CAGGGGCTCATAAAGGCTGAGGG + Intergenic
1071600518 10:86956620-86956642 CTGAGGCTCAGAGAGGCTGAGGG - Intronic
1074715165 10:116211455-116211477 CAGAGGCCCAGGGAGGCTGATGG + Intronic
1074861903 10:117516559-117516581 CTGAAGCTCAGAGAGCTTGAGGG + Intergenic
1076364818 10:129914913-129914935 CAGAGGCTGAGAGAACATGAGGG + Intronic
1077318220 11:1928604-1928626 CAGAGGCTCCTGAGGCCTGAGGG + Intronic
1077992242 11:7422406-7422428 AAGTGGCTCATAGATCCTGTGGG - Intronic
1078023173 11:7672126-7672148 CTGAGGCTCAGAGAGATTGAAGG + Intronic
1081173196 11:39893516-39893538 CTGAGGCTCCAAGAGGCTGAGGG + Intergenic
1081401939 11:42653696-42653718 GAGAGGGTAATAGACCCTGAAGG - Intergenic
1081872261 11:46388673-46388695 CAGAGGCTCTCAGAGCCAAATGG - Intergenic
1083322719 11:61857255-61857277 CAGAGGCTCAGAGAGTCCCAGGG + Intronic
1083354664 11:62057327-62057349 CCAAGGCTCATAGAGGTTGACGG + Intergenic
1084003268 11:66310150-66310172 CAGACTCTCAGAGAGGCTGACGG - Intergenic
1084433894 11:69126933-69126955 CAGAGGCTCTCAGAGCTGGATGG - Intergenic
1085534606 11:77210588-77210610 CACAGACTCCTAGAGCCTTATGG - Intronic
1085796542 11:79546012-79546034 CTGAGGCTCAAAGAGGTTGAAGG + Intergenic
1087139444 11:94750959-94750981 CAGAGGCTCAGAGAGGTTAAAGG + Intronic
1087325672 11:96720409-96720431 CAGGGGCTCATAGGACCTTAAGG + Intergenic
1087644497 11:100792096-100792118 CACTGGCTCATACAGCCTCAGGG - Intronic
1088990814 11:114951811-114951833 CACAGCCTTATAGAGCCTGATGG + Intergenic
1089278480 11:117355792-117355814 CTGAGGCCCCTAGAGCCTCAGGG - Intronic
1089694761 11:120210411-120210433 CAGGGGCTCACAAAACCTGAGGG + Intergenic
1090259908 11:125312065-125312087 CAGAGGCTCAGAGAACCTAAAGG - Intronic
1091723894 12:2832788-2832810 GAGAGGTGCATAGAGCCTGGGGG - Intronic
1093183724 12:15996018-15996040 CACAGGCTGAGTGAGCCTGATGG + Intronic
1095514487 12:42991010-42991032 CTGAGGCTCAGAGAGTTTGAGGG + Intergenic
1096154173 12:49332712-49332734 CAGAGGCCCAGAAAGCCGGAGGG - Exonic
1096239109 12:49950115-49950137 CAGCAGCTCCTAGAGCCTGGGGG - Intergenic
1098386915 12:69929403-69929425 CAGAGGCTCAGAGTGCCAGGAGG + Intronic
1100224316 12:92540802-92540824 CAGAGGCTCATGCTCCCTGAAGG + Intergenic
1100431294 12:94534013-94534035 CAGGGGCTCCTGGAGCCTGGAGG - Intergenic
1101448621 12:104756220-104756242 CAGAGGCTCAGAGACCTTCACGG - Intronic
1101723350 12:107369967-107369989 CGGAGGCTCAGAGAGGTTGAGGG - Intronic
1101851126 12:108403328-108403350 GAGAAGAACATAGAGCCTGAAGG + Intergenic
1102028122 12:109725020-109725042 CTGAGGCTCAGAGAGATTGAGGG + Intronic
1104299082 12:127547740-127547762 TAGAGGCTCAGAGAGGCTCAGGG - Intergenic
1104470200 12:129024047-129024069 CAGAGGCTGACAGAGCCAGAAGG - Intergenic
1106122504 13:26872398-26872420 CGGAGGCTCCAAGAGGCTGATGG - Intergenic
1106328422 13:28716836-28716858 CAGAGACTCACAGAGCCAGCAGG + Intronic
1106504542 13:30359833-30359855 CTAAGCCTCACAGAGCCTGAAGG + Intergenic
1106628419 13:31444376-31444398 CAGAGGCTCAGAGGGCCAGGAGG - Intergenic
1109576509 13:64265678-64265700 CAGAGGTTCCTTGAACCTGATGG + Intergenic
1109615563 13:64829499-64829521 CACAGTCTCATATTGCCTGAAGG - Intergenic
1113299732 13:109005579-109005601 CAGAGGTTCTTACAACCTGATGG - Intronic
1113781249 13:112978910-112978932 CAGGGACTCTGAGAGCCTGAGGG + Intronic
1113868895 13:113546226-113546248 CAGAGGCACAGACATCCTGAGGG + Intronic
1115806174 14:37054550-37054572 CAGAGGCTGGAAGAGCCTCAAGG + Intronic
1119471829 14:74905403-74905425 AAGAGGCTCATGGTGCCTGGGGG - Exonic
1119788375 14:77328980-77329002 AAGGGGCTCATGGAGCCTGGGGG + Intronic
1120850696 14:89166485-89166507 CAGAAGCTCAGAGAGCCCCATGG + Intronic
1121177816 14:91904413-91904435 CTGAGGCTCACAGTGCCTGGAGG + Intronic
1121533373 14:94673927-94673949 CACAGGCTGACAGAGCCCGAAGG + Intergenic
1121549733 14:94789726-94789748 CTGAGGCCCATAGAGCTTAAGGG + Intergenic
1121752457 14:96368911-96368933 CAGAGGTTGAAAGAGCTTGAAGG + Intronic
1122291409 14:100682193-100682215 CAGAGTCTCATAGCTTCTGATGG + Intergenic
1122786848 14:104167893-104167915 CAGAGGGGCACGGAGCCTGATGG - Intronic
1122925085 14:104895736-104895758 CAGAGGCCCATAGCCCCTCACGG - Exonic
1122957341 14:105076849-105076871 CAGAGGATCCTAGGGCCTAAGGG + Intergenic
1123110055 14:105863041-105863063 CAGAGGCTCCCAGATCCTCAAGG + Intergenic
1124349988 15:28948192-28948214 CAGAGGCTCACAGAGGTTCAGGG + Intronic
1125430442 15:39588300-39588322 CAGTGGGTCATAGAGCAGGAAGG + Intronic
1126925873 15:53585654-53585676 GTTAGGCTGATAGAGCCTGAAGG - Intronic
1128778217 15:70340313-70340335 CAGAGGTTCCCAGAGCCTGCTGG - Intergenic
1128814647 15:70598815-70598837 CAGAAGGTCAGAGGGCCTGAGGG - Intergenic
1129653324 15:77506743-77506765 CAGAGGCTCCCAGACCCTGGAGG + Intergenic
1129708590 15:77808705-77808727 CTGAGGCTCAGAGAGATTGAGGG - Intronic
1129790302 15:78336699-78336721 CACGGGCTAATAGTGCCTGAGGG - Intergenic
1129804020 15:78438799-78438821 CAGAGGCACAGAGAGACTGAGGG - Intronic
1129907490 15:79198831-79198853 CAGAGGCTCATCCAGACTCAAGG + Intergenic
1129969889 15:79768978-79769000 CAGTGGCTCATAGACGCTGATGG - Intergenic
1131616266 15:94020054-94020076 CAGATGCTCAGGGAGGCTGAGGG - Intergenic
1132286692 15:100668694-100668716 CTGAGGCACAGAGAGGCTGAGGG + Intergenic
1138163328 16:54776811-54776833 GAGAGGCTCTGAGAGCCAGAGGG - Intergenic
1138545090 16:57713842-57713864 AAGAGGCTCATACACCATGAGGG - Intronic
1139206846 16:65037374-65037396 CAGAGGTTCACAGTGACTGATGG - Intronic
1139365969 16:66433848-66433870 CAGAGGCTTACAGAGCTGGAAGG - Intronic
1141656110 16:85417472-85417494 CACAGGCACTTAGAGCCAGAGGG - Intergenic
1143031507 17:3970494-3970516 GAGAGGCTCACAGAGCCTCGGGG + Intergenic
1143061619 17:4206785-4206807 CAGAGGCTCAGAGAGTTTTACGG + Intronic
1143256282 17:5560377-5560399 CTGAGGCTCATAGGGGCTAATGG - Intronic
1145103470 17:20095897-20095919 CAGAGGCTCTGAGAGGGTGAGGG + Intronic
1145891631 17:28420395-28420417 CAGAGGCTTACAGAGATTGAGGG + Intergenic
1147782826 17:42956027-42956049 CAGCGGATCCTAGAACCTGAAGG + Intronic
1148738272 17:49877214-49877236 CAGAGGCACAGAGAGCCCAAGGG - Intergenic
1148861423 17:50606250-50606272 CAGAGGCTCAGAGAGGGTAAGGG + Intronic
1149655477 17:58307695-58307717 CAGAGCCACAAAGATCCTGACGG + Exonic
1149866573 17:60154378-60154400 CTGAGGCTCAGAGAGCTTAAGGG + Intronic
1150027081 17:61688013-61688035 CAGAGGCCCATATAGTTTGATGG + Intronic
1150812613 17:68368562-68368584 CAGAGCCACATAGAGCAGGAAGG - Exonic
1151512473 17:74569781-74569803 CAGAGGCTCAGAGAGCCACCCGG - Intergenic
1154253741 18:12765679-12765701 CCCAGGCTCCTAGAGGCTGAGGG + Intergenic
1155026182 18:21942995-21943017 CAGAGGCCCATGGGGCATGATGG + Intergenic
1156528550 18:37792875-37792897 CAGATGCTCTCAGAGCCTGAAGG - Intergenic
1156853528 18:41755591-41755613 CAGAGGCTCCTAGAGCCACCTGG - Intergenic
1157203634 18:45680157-45680179 TAGAGGCTGATAAAGCCTGAAGG - Intronic
1158609844 18:58929179-58929201 CATAGGCTCTTACAGCCGGAGGG + Intronic
1159061463 18:63519086-63519108 ACGAGGCTCATAGAGTCTGGTGG + Intergenic
1162139871 19:8579270-8579292 CAGAGGCTCTTAAAGCCACACGG - Intergenic
1162951382 19:14073673-14073695 CAGAGGCTGCCAGAGCCTGGGGG + Exonic
1166188918 19:41162214-41162236 CAAAGGCACATTTAGCCTGATGG + Intergenic
1166646094 19:44532910-44532932 CAGGGACCCATAGAGTCTGAAGG - Intergenic
1166871763 19:45875421-45875443 CAGAGGCTCACAGTGGCTGAAGG - Intergenic
1167368294 19:49065893-49065915 CAGAGGCCCAGAGAGCGTGAGGG + Intergenic
1167819941 19:51918475-51918497 TAGAGAATCATTGAGCCTGAGGG + Intronic
1168191527 19:54741770-54741792 CAGAGGCTACTAGAGACAGAGGG + Intronic
1168195851 19:54773122-54773144 CAGAGGCTACTAGAGACAGAGGG + Intronic
925449613 2:3957366-3957388 CAGAGGCTCACAGAGTCCCAAGG - Intergenic
926707440 2:15846657-15846679 CAGAGGCTCAGGGAGGCTGAGGG + Intergenic
927517996 2:23683086-23683108 CAGAGGCTCAGAGAGACAAAGGG + Intronic
928225203 2:29442562-29442584 CAGAGGCTCAGAAAGGCTAAGGG - Intronic
928436998 2:31261145-31261167 CAGAGGCACAGAGAGACTAAAGG - Intronic
930388288 2:50726303-50726325 CTGAGGCTCAGAGAACTTGATGG - Intronic
931001086 2:57783157-57783179 CAGAGGCTAAGAGAGTATGAGGG - Intergenic
933127564 2:78628836-78628858 CAGAGGCTCAGAGATCCTTAGGG + Intergenic
933533129 2:83535694-83535716 CAGTGAATCATTGAGCCTGAGGG + Intergenic
933762008 2:85679004-85679026 CAGAGGCTCCTAGTGGCTGAAGG - Intergenic
933826232 2:86163577-86163599 CAGGGGCTCATTGAACTTGAAGG - Intronic
933832410 2:86221689-86221711 CAGGTGCTCAGAGAGACTGAGGG - Intronic
934696191 2:96402406-96402428 CAGAGGCTTACAGAGGCTGGAGG + Intergenic
935205393 2:100892496-100892518 TGGAGCCTCATAGAGCCAGATGG - Intronic
935258072 2:101330285-101330307 CAGAGGCCGAGAGAGGCTGATGG + Intergenic
935743902 2:106174551-106174573 CACAGGCAAATAGAACCTGAGGG + Intronic
939984016 2:148812790-148812812 CAGAGTCTCCCAGATCCTGATGG + Intergenic
940122404 2:150281464-150281486 CTAAGGCTGCTAGAGCCTGAGGG + Intergenic
940448918 2:153813989-153814011 TAGAGCCACATAGAGCTTGAAGG - Intergenic
942781302 2:179646619-179646641 CGTAGGCTCAGAGAACCTGAAGG - Intronic
943511834 2:188836003-188836025 CAGAGGCTCAGAGCTCCTGACGG - Intergenic
946331878 2:219014099-219014121 CAGGGGCTCTGAGACCCTGATGG + Intronic
947488283 2:230572138-230572160 CAGAGGCTGTTAGAGCCACATGG + Intergenic
947589720 2:231378747-231378769 CAGTGGCTTATAGGCCCTGAGGG + Intergenic
947720857 2:232368457-232368479 CAGAGGCTTCCAGAGGCTGAGGG + Intergenic
948047208 2:234953046-234953068 CAGAGGGTCGTGGAGCCTGATGG + Intronic
948829784 2:240593034-240593056 GAGAGGTTCAGAGAGCCTGGAGG + Intronic
1168993384 20:2113874-2113896 CTGAGGCTCAGAGAGCTTCAGGG + Intronic
1169445715 20:5669491-5669513 CAGAGGCTGGTAGAGGCTGAGGG + Intergenic
1169762953 20:9116569-9116591 CCGAGGCTCCTACAGCCTAAGGG - Intronic
1169922646 20:10751752-10751774 CTGAGGGTCAGAGAGCCGGATGG + Intergenic
1170426423 20:16239537-16239559 CAGAGGCTTATAGAGAATTAAGG + Intergenic
1170481808 20:16773491-16773513 CAGAGGTTCATAGAGTTTGGAGG + Intergenic
1172448557 20:35005929-35005951 CAGAGGCTCAGATAAGCTGAGGG + Intronic
1173471483 20:43326587-43326609 CAGAGACTCAGAGAGGTTGAAGG - Intergenic
1173858161 20:46264552-46264574 CAGTGGCTCAGAGAGGTTGAGGG + Intronic
1174178860 20:48662465-48662487 CTGAGGCTCAGAGAGGCTAAAGG - Intronic
1174291753 20:49513803-49513825 CAGAGTCTCACAGAGCCAGGAGG + Intronic
1175745819 20:61456242-61456264 GAGAGGCCCATTGTGCCTGAAGG - Intronic
1175850319 20:62087145-62087167 CGGAGGCTCATAGCTCCTGAAGG + Intergenic
1177408090 21:20696474-20696496 CAGAGCCTCAGAGAGTTTGATGG + Intergenic
1179168358 21:38953045-38953067 CAGAGGCTTGCAGAGCCAGATGG + Intergenic
1180036692 21:45253924-45253946 CAGAGGCTCATCCAGACTGGGGG - Intergenic
1181464231 22:23102187-23102209 CACAGGCTCAGAGCGGCTGAAGG - Intronic
1183263193 22:36809563-36809585 CTGAGGCTCAGAGAGGCTAAGGG - Intronic
1183600248 22:38835782-38835804 CTGAGGCTCAGAGAGGCTGAGGG - Intronic
1184425383 22:44406113-44406135 CGGAGGCTCATGGAGGCTAAGGG + Intergenic
1184483851 22:44764618-44764640 CAGAGGCCCAGAGAGGGTGAGGG - Intronic
1185334825 22:50266780-50266802 CAGAGGCCGCTAGAGCATGATGG - Intronic
950156164 3:10723236-10723258 CTGAGGTTCAGAGAGGCTGAGGG + Intergenic
950200843 3:11042591-11042613 CCGTGGCTCAGTGAGCCTGAAGG - Intergenic
950828851 3:15854615-15854637 AAGAGACTTATAGAGGCTGAAGG - Intronic
954422616 3:50426589-50426611 CTGAGGCCCACAGAGCCTGATGG - Intronic
955347269 3:58170412-58170434 CAGAGGCTCATAGAGCCTGACGG - Intronic
956210272 3:66795350-66795372 CTCAGGCTCATATAGCCAGATGG + Intergenic
961059396 3:123815608-123815630 TAGAGGCTCTTAGATCCTGCTGG - Intronic
964177635 3:153843922-153843944 CAGAGCCTGCTAGAGACTGATGG + Intergenic
964418165 3:156471931-156471953 CTGAGGCTCAGAGAGGCTAAGGG + Intronic
966289232 3:178335100-178335122 CAGATGCCCATAGAGGTTGAGGG + Intergenic
966465271 3:180224862-180224884 CAGAGGGTGACAGAGCTTGAAGG - Intergenic
966922137 3:184619407-184619429 CTGAGGTTCAGAGAGGCTGAGGG + Intronic
966996844 3:185290933-185290955 CAGAGGCTAGTATACCCTGAGGG + Intronic
968737028 4:2303065-2303087 CTGAGGCTCCCAGGGCCTGATGG + Intronic
969268419 4:6081350-6081372 CAGAGGCTCAGAGAGAATGGGGG + Intronic
969533735 4:7743118-7743140 CAGAGACTCCCAGAGGCTGAGGG + Intergenic
969971657 4:11054141-11054163 CAGAGGCCCCTAGAGTCTCAGGG - Intergenic
970192042 4:13526589-13526611 CAAAGGCTCATGAAGCCTGAAGG - Intergenic
971971141 4:33622669-33622691 CAGAGGCTGATAAAGCCAGTTGG - Intergenic
972713010 4:41617376-41617398 CAGAGGCTCAGAGACACTGTAGG - Intronic
973716527 4:53682275-53682297 CAGGGGCTCATGGAGACTGAAGG - Intronic
974214611 4:58828819-58828841 CAGAGGCTGAAAGAGTTTGAAGG - Intergenic
976269024 4:83212077-83212099 TAGAAGCTCAGAGAGGCTGAAGG + Intergenic
976317978 4:83679964-83679986 CAGAGGCTACTAGGGACTGAGGG - Intergenic
977609406 4:99016829-99016851 CAGCGTCACATAGGGCCTGAGGG + Intronic
978564087 4:110063653-110063675 TAGAGCCTCAAAGAGGCTGAGGG + Intronic
981009947 4:139915466-139915488 CAGAGCCTCATAGAACCTCATGG + Intronic
981312942 4:143314429-143314451 CAGAGGTTTGTAGGGCCTGAAGG + Intergenic
981341236 4:143624014-143624036 TAGTGGCTTACAGAGCCTGAGGG + Intronic
981794273 4:148578058-148578080 CAGAGGCTGATAGATTCTGGTGG - Intergenic
981849705 4:149215560-149215582 CAGAGGCTCAAACATCCTCAAGG - Intergenic
985196305 4:187433441-187433463 CTGAAGCTCAGAGAGCCTGAGGG - Intergenic
986068233 5:4256583-4256605 CAGAGGCTTTTGGAGGCTGAGGG - Intergenic
993346178 5:86785868-86785890 CACAGGCTCATAGATCCCGTGGG - Intergenic
998132925 5:139660237-139660259 CAGAGCCTCTTTGAGCCTGCAGG - Intronic
999721740 5:154403531-154403553 GAGAGGCTCATAGATCCAGGAGG + Intronic
1001020597 5:168179237-168179259 CTGAGGTTCATAGAGCTTAAGGG - Intronic
1001655051 5:173343000-173343022 CAGAGTCTCATAGAGCTGGCAGG + Intergenic
1002106940 5:176884176-176884198 CAGAGGCAGAGTGAGCCTGAAGG - Intronic
1002709932 5:181189286-181189308 CAGAGGTTGGTAGAGCCGGAGGG + Intergenic
1002854463 6:1024716-1024738 CAGGGGTTCTTAGAGCTTGAAGG + Intergenic
1003139107 6:3456581-3456603 CAGAGGCGCATAGAGCGCGGCGG + Intronic
1003380669 6:5621856-5621878 CAGAGGCACCCAGAGGCTGAGGG - Intronic
1005215365 6:23521249-23521271 CACTGGCTCATAAGGCCTGATGG + Intergenic
1006144112 6:31947977-31947999 TAGATGTTCATGGAGCCTGAAGG - Exonic
1006378280 6:33683768-33683790 CTGAGGCTCAGAGAGGCTAAGGG + Intronic
1007182099 6:39936444-39936466 CACATGCTCAAAGAGCCTCATGG + Intergenic
1007459975 6:42010700-42010722 CCGAGGCTCTGAGAGCCTGGGGG - Intronic
1007574359 6:42915656-42915678 CTGAGGCTCACAGAGAGTGAGGG - Intergenic
1013833002 6:114297112-114297134 CAGAGGCCCAGAGAGGCTAACGG + Intronic
1014336244 6:120140958-120140980 CAGAGATTCATAGAACCTGGAGG + Intergenic
1015113011 6:129615285-129615307 CAGTGGCTAAAAGAGGCTGATGG + Intronic
1017544855 6:155439453-155439475 CTGAGGCTCAGAGGACCTGAAGG + Intronic
1019621889 7:1996424-1996446 CAGAGGCTCTGAGAGCCACACGG + Intronic
1022597995 7:31731143-31731165 CAGAAGCTCATAGAAGCTGGAGG + Intergenic
1023060063 7:36318169-36318191 CAGAGGCTTAAAGGGTCTGAAGG + Intergenic
1024010414 7:45261488-45261510 CGGAGGCACACAGAGACTGAGGG + Intergenic
1024156042 7:46626551-46626573 CATAAGATCATAGAGCCAGAAGG - Intergenic
1026110533 7:67455520-67455542 CTGAGGACCCTAGAGCCTGAAGG - Intergenic
1031790442 7:126094991-126095013 CAGAGGTTGATAGAGTTTGAAGG - Intergenic
1033132482 7:138756728-138756750 CAGAGGCTAATGCAGCCTTAAGG + Intronic
1035768403 8:2127001-2127023 GAGAGGCTGATAGAGGCTGGGGG + Intronic
1036483640 8:9160005-9160027 CAGAGGCTCCTGGAACATGAAGG + Intronic
1036657969 8:10690186-10690208 CTGAGGCTCAAAGAGGCTGAGGG - Intronic
1036752549 8:11452493-11452515 CAGAGGCAGAAAGAGCATGAAGG + Intronic
1036770050 8:11572489-11572511 CAGAGGCTGACAGGGGCTGATGG + Intergenic
1038205194 8:25458647-25458669 GAGAGGCTCCTGGAGCCGGACGG + Intergenic
1039865799 8:41500378-41500400 CAAAGGCCCAGAGAGCTTGATGG + Intronic
1040055252 8:43052046-43052068 AAGAGGCTCAGAGAGCTTCAGGG + Intronic
1042525229 8:69757780-69757802 CAGTGCCTGATAGTGCCTGATGG - Intronic
1043052389 8:75400240-75400262 TAGAGGCTAAAAGAGTCTGAGGG - Intergenic
1044110031 8:88261582-88261604 CAGTGGTTTATAGAGTCTGAAGG - Intronic
1045437841 8:102182270-102182292 CAGGGACTCATATACCCTGAAGG + Intergenic
1045784789 8:105908434-105908456 CAGAGGCTGAAGGAGGCTGAAGG + Intergenic
1048366245 8:133741057-133741079 CAGAGGCTCAGCGAGGATGATGG + Intergenic
1049701156 8:144013378-144013400 CAGTGACTCATTGAGCCTGCAGG - Intronic
1051875916 9:21793498-21793520 CAGAGGATGGTAGAGCCAGATGG - Intergenic
1052915160 9:33919458-33919480 CAGAGGCCAATAGGGCCTGATGG - Exonic
1053464048 9:38291990-38292012 CAGAGGCTCATGGAACATCAGGG + Intergenic
1059332293 9:113543157-113543179 AAGAGGGTCAGAGAGGCTGAGGG + Intronic
1060302585 9:122383896-122383918 CCGAGGCTCACAGAGGTTGAGGG - Intronic
1060518159 9:124278750-124278772 CTGAGACTCAGAGAGGCTGAGGG + Intronic
1060539512 9:124420057-124420079 CTGAGGCACAGAGAGCCTGATGG - Intergenic
1060666326 9:125434163-125434185 CAGAGGCCCAGAGAGGCTGGGGG + Intergenic
1061117906 9:128626276-128626298 CAGAGGCGCACACAGCCTGCTGG - Intronic
1061234509 9:129334663-129334685 CAGAGGCCCAGATAGCCTGAAGG + Intergenic
1062197139 9:135280589-135280611 CTGAGGCTCAGAGAGGTTGAGGG - Intergenic
1185909844 X:3971371-3971393 AAGAGGCTCATAGAGGCTCTCGG - Intergenic
1189253957 X:39622973-39622995 CATAGGCTTATAGAGCTAGAAGG + Intergenic
1189725920 X:43968252-43968274 CAGAGGTTCTCAGAGCCTGATGG - Intronic
1190583038 X:51907088-51907110 CAGAGGCTCACAGAACTGGAAGG - Intergenic
1192226879 X:69234994-69235016 CTGAGGCTCAGAGAGGCAGAGGG - Intergenic
1192830751 X:74748731-74748753 GAAAGGCTCATAGATCCTGTAGG + Intronic
1195004231 X:100670735-100670757 CAGAGGGTAGTAGAGCCTGTGGG + Intronic
1198756593 X:139988570-139988592 CAGGGGCTCATCAAGGCTGAGGG - Intergenic
1199530896 X:148846606-148846628 CACAGAATCATAGAGGCTGAGGG - Intronic