ID: 955347270

View in Genome Browser
Species Human (GRCh38)
Location 3:58170429-58170451
Sequence AGCGTGGCAATTACAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347270_955347282 28 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49
955347270_955347271 -8 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
955347270_955347274 -6 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 84
955347270_955347273 -7 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 122
955347270_955347278 11 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347270 Original CRISPR AGCGTGGCAATTACAAGCAG AGG (reversed) Intronic
900672966 1:3867297-3867319 AGCGTGGCATGTACACGCAGTGG - Intronic
901657227 1:10776458-10776480 CGTGAGACAATTACAAGCAGGGG - Intronic
912614307 1:111082225-111082247 AAACTGACAATTACAAGCAGTGG - Intergenic
913058398 1:115183016-115183038 AGCGAGGCCATTCCAGGCAGAGG - Intergenic
913665628 1:121045806-121045828 AATGTGGCAAATACATGCAGTGG + Intergenic
920087081 1:203425325-203425347 AGCCTGGCAATGACAGGCACAGG + Intergenic
921115577 1:212087796-212087818 GGCGTGGCAATTAGAAGCTTGGG - Intronic
924689911 1:246337330-246337352 AGGGTGACAATAACAAGCATGGG - Intronic
1064315657 10:14253677-14253699 AGTGTGGCAGTGACAGGCAGAGG + Intronic
1068409597 10:56637674-56637696 AGCCTGACAAAAACAAGCAGTGG - Intergenic
1069695028 10:70380332-70380354 AGCGTGGTGATTTTAAGCAGCGG - Intronic
1070149127 10:73794821-73794843 AGCGCTGCGATTACAAGCATGGG - Intronic
1078844727 11:15110835-15110857 AGCATGGCAACTTCAAGCAGTGG + Intergenic
1080436011 11:32245305-32245327 AGAGTAGCAATTAAAAGCAGGGG + Intergenic
1085979222 11:81702242-81702264 AACCTGGCAAAAACAAGCAGTGG + Intergenic
1088851692 11:113708510-113708532 AGCCTGGCAGCTACAAGAAGGGG + Intergenic
1089305148 11:117521864-117521886 AGTGGGGCAATGCCAAGCAGGGG - Intronic
1090114489 11:123953852-123953874 ATCGTGTCATTTACAAACAGAGG - Intergenic
1091649919 12:2302350-2302372 AGCCTGGCACTAGCAAGCAGAGG - Intronic
1093499072 12:19790038-19790060 AGCATTGGAATTACAAGCATGGG + Intergenic
1098124928 12:67280974-67280996 AGTGTTGGGATTACAAGCAGGGG - Intronic
1104104300 12:125644646-125644668 AGGCTGACATTTACAAGCAGGGG - Intronic
1104417358 12:128606438-128606460 AGCGAGGGAAATACAGGCAGGGG - Intronic
1105626954 13:22121890-22121912 AGCGTGGTGTTTACTAGCAGTGG + Intergenic
1110302256 13:73942632-73942654 ACCGTGGCAATTACTAACATTGG - Intronic
1111731019 13:92077088-92077110 GGCGGGGCAATTCAAAGCAGGGG - Intronic
1112358724 13:98696949-98696971 AAGGTGGCATTTACAAGCCGAGG + Intronic
1114460570 14:22883711-22883733 AGCCTGGGAATCACAGGCAGGGG + Intronic
1115468389 14:33741425-33741447 AGGGTGGAACTTACAGGCAGAGG + Intronic
1117616598 14:57540064-57540086 AACCTGGCAAAAACAAGCAGTGG - Intergenic
1118588267 14:67377802-67377824 AGTGTGGCTGTTAAAAGCAGAGG - Intronic
1121523246 14:94600470-94600492 AGCTTGGCACTTACCAGCAGTGG + Intronic
1130102645 15:80905635-80905657 AGACTGGCAATTACTAGGAGGGG + Intronic
1134398621 16:13888680-13888702 AACGTGCCAATTCCCAGCAGAGG + Intergenic
1137848618 16:51715756-51715778 AGCTTTGCAATTACAGGAAGGGG + Intergenic
1146807145 17:35873654-35873676 AGCTTAGCAAATAGAAGCAGAGG - Intronic
1147871173 17:43588679-43588701 AGTGCTGCAATTACAAGCACCGG + Intergenic
1159450204 18:68591394-68591416 TGCATGGCCATTACAAACAGTGG - Intergenic
1164887686 19:31796651-31796673 AGCCTGGCAATATCAAGCATTGG + Intergenic
926401621 2:12502970-12502992 ATGGTGGCATTTACATGCAGAGG - Intergenic
928089463 2:28365206-28365228 AGCGCGGCAGCTACAAGCTGAGG + Intergenic
933942231 2:87254254-87254276 AGCGAAGCAAATAAAAGCAGTGG - Intergenic
935805611 2:106744616-106744638 AGGGTGGCATTTACAAGCCAAGG + Intergenic
936337995 2:111607315-111607337 AGCGAAGCAAATAAAAGCAGTGG + Intergenic
940402476 2:153263671-153263693 AGCCTGACAAAAACAAGCAGTGG + Intergenic
940879868 2:158935819-158935841 AGCATTGCAATTACATGCTGAGG + Intergenic
941388834 2:164886268-164886290 AGTGTTGCAATTACAGGCATGGG + Intergenic
1171087209 20:22248698-22248720 AGTTTGGCATTTACCAGCAGTGG - Intergenic
1178452350 21:32714389-32714411 GGCGTGGTAAGTAGAAGCAGAGG + Intronic
1182782712 22:32880881-32880903 AGCATGGCAATTGCACCCAGGGG + Intronic
1182789074 22:32933741-32933763 AGTGTGGCAGTTAAAAGCACAGG - Intronic
950618651 3:14184150-14184172 AGCATAGCAATTAAAAGCAAGGG + Intronic
952829431 3:37552033-37552055 TGGGTGGGAATCACAAGCAGGGG + Intronic
953193569 3:40711940-40711962 AGCTTGCTAATTACTAGCAGTGG - Intergenic
955132291 3:56182697-56182719 AGGGAGGCAATTAGGAGCAGTGG - Intronic
955347270 3:58170429-58170451 AGCGTGGCAATTACAAGCAGAGG - Intronic
955991771 3:64635271-64635293 AGCTTTGCAGTTACAAGCTGGGG + Intronic
962673697 3:137735982-137736004 AGCCAGGAAATTACAGGCAGTGG + Intergenic
964136682 3:153352310-153352332 AGCATAGCAATTACAAGAAAAGG + Intergenic
967363567 3:188659879-188659901 ACAGTAACAATTACAAGCAGAGG - Intronic
969137993 4:5046240-5046262 AACGTGACAAAAACAAGCAGTGG + Intergenic
970586841 4:17522727-17522749 AGCGTGGGGATTTCAAACAGCGG - Intronic
984090569 4:175369279-175369301 AGCTAGGCAATTGCAAGTAGAGG + Intergenic
984218347 4:176942307-176942329 AGCGTTGAAATTACAGGCATGGG + Intergenic
985915484 5:2915270-2915292 AGGGTGGCATTTGGAAGCAGAGG + Intergenic
986283251 5:6340655-6340677 AGTGTGCCAGATACAAGCAGAGG + Intergenic
987653550 5:20776054-20776076 AGCCTGTCAATAACAAGCAATGG + Intergenic
988742024 5:34085422-34085444 AGCCTGTCAATAACAAGCAATGG - Intronic
990198902 5:53348968-53348990 AGGATGGAAATAACAAGCAGAGG + Intergenic
990546359 5:56825704-56825726 AGAGTGGCAATAACAAGAACTGG - Intronic
991132078 5:63133948-63133970 AGAGTGGTAATTAAGAGCAGGGG - Intergenic
991893613 5:71366311-71366333 AGCATGGCAATGTGAAGCAGTGG - Intergenic
993719855 5:91311543-91311565 AGGGTGGCATTTACCAGCTGAGG - Intergenic
995907608 5:117144378-117144400 AGCTTGGAAATTAAAAGAAGGGG + Intergenic
999497031 5:152109114-152109136 AGCTTGGCAGTTTCCAGCAGTGG + Intergenic
1004980063 6:21013166-21013188 AGCATAGCAATTACAAGCATTGG - Intronic
1005355537 6:24979759-24979781 AGCATGACAATTAAAAGCACAGG + Intronic
1005799344 6:29404621-29404643 AGTGTGGCTCTTACAAGCACAGG + Intronic
1021675686 7:23078536-23078558 AGCATTTCAATTACAAGCTGTGG + Intergenic
1024868496 7:53933049-53933071 AACCTGACAATAACAAGCAGTGG + Intergenic
1028240565 7:88415030-88415052 AGAGTGGCAAGTAAAAGCACTGG + Intergenic
1029725043 7:102397277-102397299 AGCGCTGAAATTACAGGCAGGGG - Intronic
1030760375 7:113342736-113342758 AGGGTGGCATTTACAAGGAAAGG - Intergenic
1031943265 7:127812111-127812133 AGCATAGCAATTAAAAGCATTGG - Intronic
1034886100 7:154800154-154800176 AGCATGGTATTTAAAAGCAGAGG - Intronic
1043684397 8:83068398-83068420 AGAGTGGCCATTACAAGATGTGG + Intergenic
1044086544 8:87949357-87949379 AAGGTGGCAATAACAAGCAATGG + Intergenic
1044693373 8:94900135-94900157 AGCCTGGCAGAGACAAGCAGGGG - Intronic
1044799966 8:95944079-95944101 AGGGTGGGCATTGCAAGCAGAGG + Intergenic
1047863177 8:128991502-128991524 AGCGTGTCAATTGCAAACAGAGG + Intergenic
1048652360 8:136492491-136492513 AGGGTGGGAATTAGAAACAGAGG - Intergenic
1050963416 9:11766390-11766412 TGCCTGGCTATTACCAGCAGAGG - Intergenic
1055744031 9:79423043-79423065 AACCTGGCAAAAACAAGCAGTGG - Intergenic
1058413457 9:104760844-104760866 ATGGTGGGAATTACAAGAAGTGG - Intergenic
1060371646 9:123079116-123079138 AGTGAGGCAAATTCAAGCAGAGG - Intronic
1060374024 9:123102590-123102612 ACAGTGGCAATTCCAGGCAGAGG + Intronic
1060427381 9:123517697-123517719 AGTGAGGCAAATTCAAGCAGAGG + Intronic
1190030030 X:46963159-46963181 AGCGTGGCACCTGCAACCAGTGG - Intronic
1191987041 X:66993206-66993228 AACCTGGCAATAACAAGCAATGG - Intergenic
1194135826 X:90139822-90139844 AACATGGCAACTACAAACAGGGG + Intergenic