ID: 955347271

View in Genome Browser
Species Human (GRCh38)
Location 3:58170444-58170466
Sequence GCCACGCTCTCCCACCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347269_955347271 9 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
955347268_955347271 14 Left 955347268 3:58170407-58170429 CCACACCGTCAGGCTCTATGAGC 0: 1
1: 0
2: 2
3: 4
4: 86
Right 955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
955347270_955347271 -8 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
955347267_955347271 15 Left 955347267 3:58170406-58170428 CCCACACCGTCAGGCTCTATGAG 0: 1
1: 0
2: 1
3: 3
4: 70
Right 955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347271 Original CRISPR GCCACGCTCTCCCACCTCTT AGG Intronic
901239675 1:7685693-7685715 GGCTCGCTCTCCCACCTACTAGG + Intronic
901758730 1:11457016-11457038 GCCATGCTCTCCCTCCCCTCTGG - Intergenic
902047357 1:13535769-13535791 CCCCCGCTCCCCCAACTCTTTGG + Intergenic
902089777 1:13893708-13893730 GTCACCTTCTCCCACGTCTTTGG + Intergenic
902642067 1:17773345-17773367 GCCAAGCTGTCTCACCTCTGTGG + Intronic
905528439 1:38657041-38657063 CAGACCCTCTCCCACCTCTTTGG - Intergenic
906597807 1:47094930-47094952 GTCATGCTCTACCACCTCCTGGG - Intronic
907287476 1:53391015-53391037 GCCACACTCTCCCATCTCCCGGG + Intergenic
911733777 1:101315651-101315673 GCCACTCTGTCCCATCTCTCAGG + Intergenic
912647182 1:111404379-111404401 CCCAGGTTCTCCCAGCTCTTGGG + Intergenic
913247044 1:116879146-116879168 GCCTCCCTCTCCCTCCTTTTTGG + Intergenic
914400605 1:147316647-147316669 ACCAAGCTGTCCCACCTCATTGG - Intergenic
916769140 1:167891277-167891299 GCCACACTCTCCTGCCTCTCTGG + Intronic
917630774 1:176889251-176889273 CCCACCCTCTCCCTCCCCTTGGG - Intronic
917755514 1:178094154-178094176 GGCTCGCCCTCCCACCTCCTCGG - Exonic
923308348 1:232709293-232709315 GCTACTCTTTGCCACCTCTTCGG - Intergenic
1062814259 10:488162-488184 GCCACCCTTTCCCACCTCCTAGG - Intronic
1064590206 10:16882603-16882625 CCCACGCCCTCCCCCCACTTTGG - Intronic
1068696305 10:59971424-59971446 GGCACTCTCTCACACCTGTTAGG + Intergenic
1070377019 10:75842729-75842751 CCCACCCTTTTCCACCTCTTTGG - Intronic
1073766446 10:106687995-106688017 CCCATGTTCTCCCATCTCTTTGG + Intronic
1078949110 11:16108752-16108774 GGCAAGCTCTCCCACCTCAGTGG - Intronic
1080643439 11:34171845-34171867 GCTACTCTCTACCATCTCTTTGG - Intronic
1082833691 11:57637895-57637917 GGAACGCTCTCCCACCGCCTTGG + Intergenic
1089113306 11:116073906-116073928 GCCACTCTCTTCCAACTCTTGGG + Intergenic
1089641341 11:119849238-119849260 GCAAGGCCCTTCCACCTCTTAGG - Intergenic
1089641418 11:119849956-119849978 GTGAGGCCCTCCCACCTCTTGGG - Intergenic
1093482842 12:19623073-19623095 GCCACACTCTCCCTTCCCTTAGG - Intronic
1093832189 12:23775882-23775904 GCCACGGTCTCCAACCTTTTTGG + Intronic
1096458668 12:51808870-51808892 GCTACCCTCACCCACCTCTGTGG - Exonic
1096661985 12:53131352-53131374 GCCTCTCTCTGCCACCTCCTTGG + Intergenic
1101286013 12:103313421-103313443 TCCAACCTCTGCCACCTCTTGGG - Intronic
1101793913 12:107955560-107955582 GCCAAGCACTCCCAGCTCTGTGG - Intergenic
1105632813 13:22188146-22188168 GCCATGCTCTAACACCTCTGTGG + Intergenic
1106561481 13:30850202-30850224 CCCACTCTTTCCCACCTTTTGGG + Intergenic
1108596554 13:51954862-51954884 GTCTCACTCTCCCACGTCTTTGG - Intronic
1110527454 13:76555410-76555432 GCCTCCCTTTCCCTCCTCTTAGG + Intergenic
1114420757 14:22580753-22580775 GCCACCCCCTACCACCTCTTGGG - Intronic
1121285129 14:92729264-92729286 GCCACACCCTCACACCTCTCTGG + Intronic
1122071629 14:99208943-99208965 GCCTCTCTCTCCCACTTCTTGGG - Intronic
1123991498 15:25687022-25687044 CCCACCCTCTCCCACCTCCCAGG - Intronic
1124647971 15:31453354-31453376 GCCACGCTCTCCTCCCCTTTAGG + Intergenic
1127225165 15:56919603-56919625 GCCAGTCTCTGCCACCTCCTCGG - Intronic
1128365216 15:66995041-66995063 GTCATCCTCTCCCACCTCTGTGG + Intergenic
1135989839 16:27211374-27211396 GTCAATCTCTCCCACCCCTTGGG + Intronic
1137492828 16:48947326-48947348 CCCAGGTTCTCCTACCTCTTTGG + Intergenic
1138497434 16:57416765-57416787 GACTCGCTCCCCCAGCTCTTAGG + Intergenic
1139667939 16:68471417-68471439 GCCAGCCTCTCCCACCTCTCTGG + Intergenic
1142256152 16:89014796-89014818 GCCGCTCTCTCCCACCTGCTGGG + Intergenic
1142340473 16:89518882-89518904 GCCAGGCTCTCCCACCACGACGG - Intronic
1146630411 17:34465458-34465480 CCCACGCTCTCTACCCTCTTTGG + Intergenic
1148369028 17:47080713-47080735 CCCATCCCCTCCCACCTCTTTGG - Intergenic
1148871951 17:50663545-50663567 TCCACCCCCTCCAACCTCTTGGG - Intronic
1150577278 17:66441402-66441424 TCCACGATCTCCCTCCACTTAGG - Intronic
1152374024 17:79908879-79908901 CCCAGGCTCTCCCAGCACTTTGG + Intergenic
1152657025 17:81524459-81524481 CCCACCCTCGCCCACCTCTGAGG - Intergenic
1156399963 18:36731389-36731411 GCCACGTTCTCCCTCCACTGTGG + Intronic
1157576035 18:48744097-48744119 GCCAAACCCTCCCACATCTTGGG - Intronic
1157599404 18:48884987-48885009 GCCACTCTCCTCCATCTCTTGGG - Intergenic
1158325875 18:56313695-56313717 GCCTCGATTTCCCACCTCTCCGG + Intergenic
1159004900 18:63003016-63003038 TCCACGCTCTCCCCCAGCTTGGG + Intergenic
1160619469 18:80160590-80160612 GCCACGCTCGGCCTCCTCTGCGG + Exonic
1162743404 19:12786139-12786161 GCCTCCCTCTCCCACCTCTGTGG - Intronic
1167597570 19:50435565-50435587 GCCAGGCTCCCTCACCCCTTTGG - Intronic
1168519985 19:57042268-57042290 CTCGAGCTCTCCCACCTCTTTGG + Intergenic
930716819 2:54601146-54601168 GCTACCATCTCCAACCTCTTAGG + Intronic
931358841 2:61560660-61560682 GCCACGGTGCCCCACCTATTTGG - Intergenic
932009501 2:67960976-67960998 GCCACCCAGTTCCACCTCTTTGG + Intergenic
933742773 2:85547789-85547811 GCCACCCTCCCCCACCACTGAGG - Exonic
933992268 2:87642365-87642387 GTCAGGCTCTCCCTCCTCTGTGG - Intergenic
935889614 2:107662106-107662128 GCCACCCTCCCACCCCTCTTTGG - Intergenic
936239637 2:110776526-110776548 GTCTCGCTCCCCCACCTCTTAGG - Intronic
936301582 2:111308474-111308496 GTCAGGCTCTCCCTCCTCTGTGG + Intergenic
937900671 2:127016675-127016697 GCCGCGCTCACCCTCCTCTCTGG + Intergenic
938146353 2:128838022-128838044 GCCCCCCTCCCCCACCTCCTAGG + Intergenic
938288855 2:130138933-130138955 GCCAGGCTCGCCCTCCTCCTCGG - Intergenic
938298117 2:130191167-130191189 GTCTCGATCTCCCACCTCATGGG + Intergenic
938458651 2:131483494-131483516 GTCTCGATCTCCCACCTCATGGG - Intronic
938467679 2:131533998-131534020 GCCAGGCTCGCCCTCCTCCTCGG + Intergenic
947703202 2:232252858-232252880 GCCACGCAATCCCAGCACTTTGG + Intronic
948462932 2:238138961-238138983 GCCTCCCCCTCCCACCTCTCCGG - Intronic
948502864 2:238407724-238407746 GCCTCCCTCTCCCACCTGCTTGG + Intergenic
948525416 2:238568068-238568090 GCCCCGCTCTCAGACCTCTAGGG - Intergenic
1170816893 20:19721304-19721326 TCCTCGCTCCCCCACCTCCTTGG + Exonic
1172010568 20:31843718-31843740 GCAAAGCCCTCCCACCTCTGGGG + Intergenic
1172698623 20:36839099-36839121 GCCAAGTTCTACCACCTCTCTGG - Intronic
1174136411 20:48382997-48383019 GCCCCACTCTCCCAGCTCTCAGG - Intergenic
1174160276 20:48545580-48545602 GCCACCCCCTCCCATCTGTTAGG + Intergenic
1175912707 20:62412448-62412470 GCCACCCTCGCCCTCCTCTGTGG + Intronic
1176177240 20:63734527-63734549 GCCACGACACCCCACCTCTTGGG - Intronic
1176412615 21:6457279-6457301 GCCACGCCCACCCACCTTCTCGG + Intergenic
1179688109 21:43065601-43065623 GCCACGCCCACCCACCTTCTCGG + Exonic
1179960551 21:44765008-44765030 GCCACCCCCGCCCACCTCTCGGG - Intergenic
1180764353 22:18234948-18234970 GCCATGCTCCACCACCCCTTAGG + Intergenic
1180771286 22:18389593-18389615 GCCATGCTCCACCACCCCTTAGG - Intergenic
1180802673 22:18639208-18639230 GCCATGCTCCACCACCCCTTAGG - Intergenic
1180853910 22:19034764-19034786 GCCATGCTCCACCACCCCTTAGG - Intergenic
1181077872 22:20393628-20393650 CCAAGGCTCTCCCACCTCTGGGG + Intergenic
1181219048 22:21356053-21356075 GCCATGCTCCACCACCCCTTAGG + Intergenic
1184393367 22:44218469-44218491 GCCTCGGTCTCCCCCCTTTTAGG + Intronic
1203233126 22_KI270731v1_random:130584-130606 GCCATGCTCCACCACCCCTTAGG - Intergenic
950183933 3:10933631-10933653 GCAACCCTCACCCACCTGTTGGG - Intronic
950677906 3:14565580-14565602 ACCCTGCTCTCCCACCTCTCCGG - Intergenic
954328981 3:49879099-49879121 GCCAGGCTCTGCCACATCTCAGG + Intergenic
955347271 3:58170444-58170466 GCCACGCTCTCCCACCTCTTAGG + Intronic
960995150 3:123335781-123335803 GCCAGGCTGTCCCACCTCCCAGG + Intronic
961315834 3:126035077-126035099 GTCTCTCTCTCCCACCTCTGTGG - Intronic
961431909 3:126889599-126889621 GCCACACTCTCCAACCACCTGGG + Intronic
961867486 3:129964250-129964272 GCCATGCTGTCCAACCTCTCAGG - Intergenic
962708777 3:138068421-138068443 GCCACTTTCTCCCTCCTCTTAGG - Intronic
970798898 4:19948364-19948386 GCCACCCTCTCCTAAGTCTTTGG - Intergenic
978479442 4:109172370-109172392 GCCTCCCACTCCCACCCCTTGGG - Intronic
986029026 5:3878315-3878337 GCCCAGCTCTTCCACCTATTAGG + Intergenic
992123078 5:73614477-73614499 CCCCAGCTCTCCCATCTCTTTGG - Intergenic
1001939164 5:175728821-175728843 CCCGCCCACTCCCACCTCTTGGG + Intergenic
1003081693 6:3026489-3026511 AACAAGCTCCCCCACCTCTTCGG + Intergenic
1011626879 6:89290387-89290409 GCCACCCTCAGCCACCTCTCAGG + Intronic
1018115087 6:160574920-160574942 GCCACGATCCCTCACCTCTTGGG + Intronic
1018632937 6:165835930-165835952 CCCACGCTGTCTCCCCTCTTTGG + Intronic
1019999651 7:4748466-4748488 GCCACACTCCCCCCGCTCTTGGG + Intronic
1020109522 7:5440187-5440209 GCCCCGCTCACCCACCTGTGCGG + Intronic
1024243500 7:47453090-47453112 ACCAGGCTCTCCCACCTGGTGGG - Intronic
1029217574 7:98962406-98962428 GCCAATCCCTCCCAGCTCTTCGG + Exonic
1029972813 7:104805696-104805718 TCCACAGTCTCCCAGCTCTTAGG + Intronic
1032075548 7:128834102-128834124 TCCACCCTCTCCCATCTCTCGGG + Intronic
1032079087 7:128849744-128849766 GCCATGCTCTCCTCCCACTTCGG - Intronic
1032487595 7:132299693-132299715 TCCACCTTCTCCCACCTTTTGGG + Intronic
1034900971 7:154907631-154907653 TCCACGTGCTCCCACCTCATGGG - Intergenic
1036592361 8:10180473-10180495 GCCCCACTCTCCAACCTCTGAGG - Intronic
1037991341 8:23323370-23323392 CCCACGCTCTCCTCCCTCTAGGG + Intronic
1039598199 8:38809744-38809766 CCCACACTCATCCACCTCTTGGG - Intronic
1043042262 8:75277725-75277747 GCCACTCTCTCCCAGCTTGTAGG - Intergenic
1043091537 8:75910869-75910891 GGCACGCTCTCCCCACTCCTTGG + Intergenic
1044699487 8:94952912-94952934 CGCAGGCTATCCCACCTCTTGGG - Intronic
1045680676 8:104656501-104656523 GCCACCCTCTTCCATCTCCTAGG - Intronic
1046504113 8:115115100-115115122 TCCAGGCTCCCCCAGCTCTTTGG + Intergenic
1049433974 8:142577760-142577782 GCCACGCTCTGCACCCTCTGTGG - Intergenic
1053285689 9:36848282-36848304 GCCAGCCACTCCCACCTCCTAGG + Intronic
1055278252 9:74643793-74643815 GCTCTGCTCTGCCACCTCTTTGG - Intronic
1056368988 9:85935552-85935574 TTCACGCTCTCCCACTTCTCTGG - Intergenic
1057862907 9:98656153-98656175 GCCATGATCACCCAGCTCTTTGG - Intronic
1061850541 9:133412424-133412446 GCCATGCTCTCCTCCCCCTTAGG + Exonic
1062499527 9:136846298-136846320 GCCACGCTCGCCCCCCGCCTCGG + Exonic
1197997060 X:132388687-132388709 TCCACAGTCTCACACCTCTTCGG - Intronic