ID: 955347272

View in Genome Browser
Species Human (GRCh38)
Location 3:58170445-58170467
Sequence CCCTAAGAGGTGGGAGAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347272_955347282 12 Left 955347272 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49
955347272_955347278 -5 Left 955347272 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347272 Original CRISPR CCCTAAGAGGTGGGAGAGCG TGG (reversed) Intronic
900251824 1:1674962-1674984 CATTAAGAGGTGGGAGAGGCAGG + Intronic
900262231 1:1737818-1737840 CATTAAGAGGTGGGAGAGGCAGG + Intronic
902047358 1:13535770-13535792 GCCAAAGAGTTGGGGGAGCGGGG - Intergenic
902053735 1:13583775-13583797 CCCGAGGAGGCGGGGGAGCGGGG - Exonic
902678903 1:18029394-18029416 CACTGAGAGGTGAGAGAGAGAGG - Intergenic
903185473 1:21626526-21626548 CCCCAAGAGGAGGGAGAGGAGGG + Intronic
904389079 1:30168985-30169007 TTCTAAGAGGTGTGAGATCGAGG - Intergenic
904592675 1:31623741-31623763 CCTTAAGAGGTGAGAGCACGGGG + Exonic
909563963 1:77034527-77034549 CCCTTAGAGGTGGGACAGTCAGG - Intronic
913240507 1:116825881-116825903 CCCTGAGAGGTGGGAGAAGAGGG - Intergenic
914684219 1:149964208-149964230 AATAAAGAGGTGGGAGAGCGTGG - Exonic
915148197 1:153808114-153808136 CTGTAAGTGGTGGGAGAGGGAGG - Exonic
915537778 1:156547890-156547912 AGCTAAGAGGTGGTAGAGCTGGG + Intronic
915624837 1:157108085-157108107 CCCAAAGAGGTGGGGGTGCAAGG - Intergenic
919569973 1:199236046-199236068 CCCTAAGGATTGGGAGAGAGTGG - Intergenic
922732952 1:227961516-227961538 CCCTAAGAGGGGACAGAGCGAGG + Intergenic
1062814258 10:488161-488183 ACCTAGGAGGTGGGAAAGGGTGG + Intronic
1067386109 10:45818903-45818925 TCATAGGAGGTGGGAGAGAGAGG - Intergenic
1070377018 10:75842728-75842750 CCCAAAGAGGTGGAAAAGGGTGG + Intronic
1070811856 10:79302099-79302121 CACGAAGAGGTGGGACTGCGGGG - Exonic
1072925573 10:99613648-99613670 CCCAAAGAGTTGGGAAAGTGGGG + Intronic
1074729911 10:116360308-116360330 CCATAAGTGGGGGGAGAGCTGGG - Intronic
1077198145 11:1291701-1291723 CCCTCAGAGGGGGGTCAGCGAGG - Intronic
1077287135 11:1772707-1772729 CCCTAAGAGGAGGGAGGGGCAGG - Intergenic
1078093961 11:8285138-8285160 CACTAATAAGTGGGAGAGCTGGG - Intergenic
1083850556 11:65363842-65363864 TCCTAAGAGGTGGGATAGAAAGG + Intergenic
1084441922 11:69179462-69179484 CTCCAAGAGGTGGGAGAGTAGGG - Intergenic
1087182999 11:95157936-95157958 CCCCAACAGGTGGGAGGGCCAGG - Intergenic
1088717100 11:112558503-112558525 CCCTAGGACATGGGAGAGCTTGG - Intergenic
1089113307 11:116073907-116073929 CCCCAAGAGTTGGAAGAGAGTGG - Intergenic
1090161696 11:124502033-124502055 TCCTAGGAAGTGGGAGTGCGGGG - Intergenic
1092939173 12:13391316-13391338 CCATGGGAGGTGGGAGAGAGGGG + Intergenic
1094198177 12:27770910-27770932 CCCTAGGGTGTGGGAGAGAGAGG - Intronic
1095766339 12:45899779-45899801 CCCTTGGAGGTGGGAGGGGGGGG - Intronic
1096105391 12:48994716-48994738 CCATAAGTGGTTTGAGAGCGGGG + Intergenic
1100318928 12:93471650-93471672 CCCTAAAAAATGGGAGAGTGGGG - Intronic
1100321829 12:93502007-93502029 CCCAAACAAGTGGGAGAGCCAGG + Exonic
1100326368 12:93543496-93543518 CTCTCAGAGGTGGAAGAGCAAGG - Intergenic
1102253754 12:111405016-111405038 CCCCAACATGTGGGAGGGCGGGG - Intergenic
1106584198 13:31043201-31043223 CCCTAGGAGGTGGCAGAGCTGGG + Intergenic
1108114436 13:47111314-47111336 CCCCAGGACGTGGGAGACCGGGG - Intergenic
1108680068 13:52772397-52772419 ACCTAAGGGGTGGGGGAGCTGGG - Intergenic
1110527455 13:76555411-76555433 CCCTAAGAGGAGGGAAAGGGAGG - Intergenic
1112640483 13:101268385-101268407 CCATAAGAGCTGGGGGAGCTGGG - Intronic
1120064176 14:80020285-80020307 CCCTAAGAGGTGGGGAAAGGAGG + Intergenic
1120789303 14:88564060-88564082 CCCTAGGTGCTGGGAGTGCGGGG + Intronic
1122071628 14:99208942-99208964 CCCCAAGAAGTGGGAGAGAGAGG + Intronic
1122315723 14:100825162-100825184 CCCTAACAGGTGGGAGCCCTCGG - Intergenic
1122899769 14:104777627-104777649 CCCTGAGAGGTGTGAGTGAGTGG + Intronic
1122907043 14:104806371-104806393 CCCTGAGAGCTGGGACAGCCAGG - Intergenic
1123991497 15:25687021-25687043 GCCTGGGAGGTGGGAGAGGGTGG + Intronic
1130169728 15:81498841-81498863 CCCTAAGGTGTGGGACAGCAGGG - Intergenic
1131051027 15:89347993-89348015 TACTAAGAAGTGGTAGAGCGAGG - Intergenic
1131847120 15:96500050-96500072 CCCTAAAAGGTGGTATAGTGTGG + Intergenic
1132112853 15:99115043-99115065 CTCTTAGAGGTGAGAGAGAGAGG + Intronic
1135843223 16:25895221-25895243 CCCTAAGACTTGGGAGAACAAGG + Intronic
1136244061 16:28963303-28963325 ATCTAATAGGTGGGAGAGCCTGG + Intronic
1139215139 16:65120590-65120612 CCCTAAGGGATGGGAGTGGGGGG - Intronic
1141912876 16:87071962-87071984 CCCAAAGTGCTGGGAGAGCTGGG + Intergenic
1142256153 16:89014797-89014819 CCCCAGCAGGTGGGAGAGAGCGG - Intergenic
1142758970 17:2032202-2032224 CCTCAGGAGGTGGGAGAGGGGGG + Intronic
1143195187 17:5070924-5070946 CCCTATGATGTGGGAGACCCTGG + Intergenic
1145093974 17:20009199-20009221 CACTGAGAGCTGGGAGAGAGGGG + Intergenic
1146380172 17:32322231-32322253 CCGTGAGAGGTGGCAGACCGTGG + Exonic
1146543548 17:33718705-33718727 CCCAAAGAGGTGGGAGGTGGGGG + Intronic
1146596707 17:34175687-34175709 CACCAAGAGGTGGGAGTGGGTGG + Intergenic
1147253280 17:39166118-39166140 CACTCAGAGGAGGGAGAGCTGGG - Intronic
1147447085 17:40480991-40481013 ATCTAAGAGGTGGGGGGGCGAGG - Intronic
1150577277 17:66441401-66441423 TCCTAAGTGGAGGGAGATCGTGG + Intronic
1150753365 17:67887755-67887777 ACCTAAAAGGTGAGAGAGAGAGG - Intronic
1151730696 17:75909486-75909508 CTCTGGGAGGTAGGAGAGCGGGG + Exonic
1152374025 17:79908880-79908902 CCCAAAGTGCTGGGAGAGCCTGG - Intergenic
1152657024 17:81524458-81524480 GCCTCAGAGGTGGGCGAGGGTGG + Intergenic
1154349123 18:13568393-13568415 CACTAAGTGCTGGGAGAGTGGGG - Intronic
1156463701 18:37335733-37335755 CTCTAAGGGGTAGGAGAGTGGGG - Intronic
1156851030 18:41726403-41726425 CCCTAAGAAGTGGGTGAGGTGGG - Intergenic
1157617204 18:48994110-48994132 CCAGAAGAGATGGGGGAGCGGGG - Intergenic
1158402639 18:57134636-57134658 CACTAGGAGATGGGAGAGCTTGG + Intergenic
1158414925 18:57241891-57241913 TCCTATGAGGAGGGAGAGCAGGG + Intergenic
1159004901 18:63003017-63003039 CCCCAAGCTGGGGGAGAGCGTGG - Intergenic
1161399751 19:4062015-4062037 CCCTCAGGGGAGGGAGAGAGAGG - Intronic
1161461811 19:4402345-4402367 CCCTAAGAGGAGGGAGGCCCAGG - Intergenic
1161512561 19:4679664-4679686 CCCTGGGAGCTGGGAGGGCGGGG + Intronic
1161531258 19:4791571-4791593 CCCTGAGAGCTGTGAGCGCGCGG - Intergenic
1162145860 19:8611634-8611656 CCCTGAGAGCTCGGAGAGGGCGG - Intergenic
1162743403 19:12786138-12786160 ACCACAGAGGTGGGAGAGGGAGG + Intronic
1163567861 19:18062274-18062296 ACTTCTGAGGTGGGAGAGCGTGG + Exonic
1164767442 19:30782526-30782548 CCATAAGTGGTGGGAGAGGCAGG - Intergenic
1165310936 19:35029302-35029324 CCCAAAGTGCTGGGATAGCGGGG + Intergenic
1167600233 19:50450808-50450830 ACCTAAGGGGTGGGGGAGCAGGG - Exonic
926697726 2:15782458-15782480 CCCTCAGGGGTGGGAGAGGGAGG - Intergenic
927502856 2:23593825-23593847 ACATAAGAGGTGGGAGGGCCAGG + Intronic
927966862 2:27275769-27275791 CCCTCAGAGGTGGGACAGTGGGG - Intronic
928208317 2:29303876-29303898 CTCTAAAAGGTGGGAGAGTAGGG + Intronic
930204295 2:48572853-48572875 CCCTCAGAGCAGGGAGAGCAGGG - Intronic
932495267 2:72143061-72143083 CCCTGAGCGGTGGCAGACCGGGG - Intronic
934939809 2:98492567-98492589 CTCAAAGGGGTGAGAGAGCGGGG + Intronic
937056395 2:118940880-118940902 CTCTCAGAGGTGGGACAGCCTGG - Intergenic
937264748 2:120608524-120608546 CCCTCAGGGGTGGGAGTGCTAGG - Intergenic
937444270 2:121943536-121943558 TCCTCAGAGGTTGGAGAGTGGGG + Intergenic
938146354 2:128838023-128838045 TCCTAGGAGGTGGGGGAGGGGGG - Intergenic
944159474 2:196643225-196643247 CCCTAAGAAGGGGGAGATTGAGG - Intronic
945813662 2:214577461-214577483 CCCTAAGGAGTGGGAGTGAGGGG + Exonic
946187119 2:217987450-217987472 CCAAAAGAGGTGGGAAAGAGAGG - Intronic
948460665 2:238128571-238128593 CCCTGAGAGGAGGGACAGTGGGG - Intronic
948525415 2:238568067-238568089 CCCCTAGAGGTCTGAGAGCGGGG + Intergenic
1170816894 20:19721305-19721327 CCCAAGGAGGTGGGGGAGCGAGG - Exonic
1174136410 20:48382996-48383018 GCCTGAGAGCTGGGAGAGTGGGG + Intergenic
1176428391 21:6562335-6562357 CACTGAGAGGTGGGAGAGGGGGG + Intergenic
1178235138 21:30833383-30833405 GCATAAGAGGTGGGAGAGGCTGG - Intergenic
1179703881 21:43170651-43170673 CACTGAGAGGTGGGAGAGGGGGG + Intronic
1182641154 22:31768793-31768815 ACCTAAGAGGAGGGGGAGAGAGG - Exonic
1182806306 22:33073528-33073550 ATCTAAGAGGTGGGAGAGAATGG - Intergenic
1183206040 22:36419644-36419666 CCCTAGGAGGTGACAGAGCCAGG - Intergenic
1183303303 22:37069122-37069144 CTCGAAGAAGTGGGAGCGCGCGG + Exonic
1183383916 22:37504172-37504194 CCCTAAGAGGTGAGATGGCTGGG - Exonic
1184393368 22:44218470-44218492 CCCTAAAAGGGGGGAGACCGAGG - Intronic
1184414847 22:44346289-44346311 CCCTAAGAGGTGGTAGGATGAGG - Intergenic
949337416 3:2991210-2991232 TCCTAATAGGTGAGAGAACGAGG + Intronic
949522779 3:4871978-4872000 GCCTAAAAGGTGGGAGAGGAAGG - Intronic
950457792 3:13102973-13102995 CCGTCAGAGGTGGCAGAGAGGGG + Intergenic
950677905 3:14565579-14565601 CCCGGAGAGGTGGGAGAGCAGGG + Intergenic
955347272 3:58170445-58170467 CCCTAAGAGGTGGGAGAGCGTGG - Intronic
955500755 3:59580278-59580300 CACTAAGTGCTGGGAGAGCTGGG - Intergenic
957272961 3:78055172-78055194 AGCTAAGTGGTGGGAGAGAGGGG + Intergenic
961867485 3:129964249-129964271 CCCTGAGAGGTTGGACAGCATGG + Intergenic
962708776 3:138068420-138068442 GCCTAAGAGGAGGGAGAAAGTGG + Intronic
969436506 4:7192321-7192343 CGGGAAGAGGTGGGAGAGCCGGG + Intergenic
969459078 4:7318247-7318269 AGCTAAGAGGTGGCAGAGCTAGG + Intronic
986029027 5:3878316-3878338 ACCTAATAGGTGGAAGAGCTGGG - Intergenic
986089261 5:4487977-4487999 CCCTAAAAAGTGGAAGAGAGAGG + Intergenic
991927451 5:71719243-71719265 CTATAAAAGGTGGGAGCGCGTGG + Exonic
992111430 5:73498215-73498237 CACAAAGGGGTCGGAGAGCGCGG - Intergenic
992123077 5:73614476-73614498 ACCAAAGAGATGGGAGAGCTGGG + Intergenic
993094992 5:83471505-83471527 CGCCAAGAGGTGGGAGTGCCTGG + Exonic
994606518 5:101973967-101973989 CCCTACTAGTTGGGAGACCGAGG - Intergenic
995856814 5:116601168-116601190 CCCTCAGAGGAGGGAGAGGAGGG - Intergenic
998382210 5:141733787-141733809 CCCTAGGAGGTGGGAATGGGGGG + Intergenic
1001939165 5:175728822-175728844 GCCCAAGAGGTGGGAGTGGGCGG - Intergenic
1001969852 5:175946879-175946901 CCCAGAGAGGGAGGAGAGCGAGG - Intronic
1002247586 5:177896889-177896911 CCCAGAGAGGGAGGAGAGCGAGG + Intergenic
1002394465 5:178942048-178942070 CCCGAAAAGGTGGGAGCGCTGGG - Intronic
1002637223 5:180614422-180614444 CCCTGAGAGCTGGGAGGGAGAGG - Intronic
1003005822 6:2380559-2380581 AACTAAAAGGTGGGAGGGCGAGG + Intergenic
1004927702 6:20431695-20431717 TCCTAGGAGGAGGGAGAGTGAGG - Intronic
1005013423 6:21357019-21357041 CCATAACATGTGGCAGAGCGGGG - Intergenic
1006713133 6:36093269-36093291 CCAGCAGAGGTGGGAGAGAGAGG + Intronic
1007257903 6:40541475-40541497 CCCTAAGAGGTGATAGGGCCTGG + Intronic
1008911123 6:56734508-56734530 CCTTAAAAGGTGGGAGAAAGGGG + Intronic
1018327893 6:162693488-162693510 CCCTAACAGATGTGAGGGCGGGG + Intronic
1019009724 6:168834351-168834373 CCCTAAGATGGGGGAGAGGAGGG - Intergenic
1019189871 6:170245672-170245694 CACCACGGGGTGGGAGAGCGAGG + Intergenic
1019381201 7:724771-724793 CCCTAAGATCTGGGAGAGCAGGG + Intronic
1019409894 7:901805-901827 CTCTAGGAGGAGGGAGGGCGGGG - Intronic
1019633909 7:2065301-2065323 CCCTCAGTGATGGGAGAGTGTGG - Intronic
1019949269 7:4358137-4358159 CCCTGCGAGGTTGGAAAGCGAGG - Intergenic
1020109523 7:5440188-5440210 CCCGCACAGGTGGGTGAGCGGGG - Intronic
1020347685 7:7182871-7182893 CCCGGAGAGGGGGGAGGGCGAGG - Intronic
1022333612 7:29402166-29402188 CCCTGAGAGGGAGGAGGGCGGGG + Intronic
1023018037 7:35985303-35985325 CCCTATCAGGTGGGAGAGCTGGG + Intergenic
1024871425 7:53966500-53966522 CTCTAAGAGGTGAGTGAGCTGGG + Intergenic
1025635912 7:63318633-63318655 CCCTTAGACGTGGGATAGAGGGG + Intergenic
1025646784 7:63429547-63429569 CCCTTAGACGTGGGATAGAGGGG - Intergenic
1027497908 7:78911165-78911187 CCCTAAGAGGTGAGATACAGTGG + Intronic
1028248668 7:88513770-88513792 CCTTGAGAGGTGGGAGAAAGAGG - Intergenic
1028945340 7:96573595-96573617 CCCTAAAAGGTAGAAGAGAGGGG - Intronic
1029972814 7:104805697-104805719 TCCTAAGAGCTGGGAGACTGTGG - Intronic
1030216224 7:107045432-107045454 CCTCTAGAGGTGGGAGAGCTGGG + Intronic
1031612006 7:123839133-123839155 CTGTCAGAGGTGGGAGAGCTGGG - Intronic
1034900970 7:154907630-154907652 CCCCATGAGGTGGGAGCACGTGG + Intergenic
1036592360 8:10180472-10180494 TCCTCAGAGGTTGGAGAGTGGGG + Intronic
1036633174 8:10529714-10529736 CCCTGAGAGGTGGCAGTGGGAGG - Intronic
1039598198 8:38809743-38809765 CCCCAAGAGGTGGATGAGTGTGG + Intronic
1041992146 8:64006135-64006157 CACTAAGAGGTGGCAGAATGGGG + Intergenic
1043042261 8:75277724-75277746 CCCTACAAGCTGGGAGAGAGTGG + Intergenic
1046051372 8:109026512-109026534 TTCTAAGAGATGGGAGAGTGTGG + Intergenic
1048499179 8:134960316-134960338 TCCTGAGAGGTGGGAGAAAGGGG - Intergenic
1049586060 8:143432857-143432879 CTCTGAGAGGTGGGAGAAGGTGG + Intergenic
1052946259 9:34170698-34170720 CCCTAAGAGGTTGCAGTGCCAGG - Intergenic
1053280819 9:36818986-36819008 GCCTAGGGGGTGGGAGAGAGAGG - Intergenic
1053470365 9:38341986-38342008 CCTTTAGATGTGGGAGAGGGAGG - Intergenic
1055018053 9:71640355-71640377 TGTTAAGAGGTGGGAGAGAGGGG - Intergenic
1056239597 9:84631276-84631298 CCCTGGGAGGTGGGAGAGTCAGG - Intergenic
1057710620 9:97439593-97439615 CCCTAAGAGGTGAGAGAGTAAGG - Intronic
1059348572 9:113648863-113648885 CACTAGGAGGTGGCAGAGCGAGG + Intergenic
1061850542 9:133412425-133412447 CCCTAAGGGGGAGGAGAGCATGG - Exonic
1061918748 9:133770568-133770590 AACCAAGAGGTGGGAGAGGGAGG - Intronic
1185712105 X:2312771-2312793 ACCTCAGACGTGGGAGAGCTAGG + Intronic
1189021972 X:37350034-37350056 CCCTGGGGGATGGGAGAGCGGGG + Intronic
1190528892 X:51355120-51355142 GCCTAAGAGGTAGGTGAGGGAGG - Intergenic