ID: 955347273

View in Genome Browser
Species Human (GRCh38)
Location 3:58170445-58170467
Sequence CCACGCTCTCCCACCTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347269_955347273 10 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 122
955347268_955347273 15 Left 955347268 3:58170407-58170429 CCACACCGTCAGGCTCTATGAGC 0: 1
1: 0
2: 2
3: 4
4: 86
Right 955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 122
955347267_955347273 16 Left 955347267 3:58170406-58170428 CCCACACCGTCAGGCTCTATGAG 0: 1
1: 0
2: 1
3: 3
4: 70
Right 955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 122
955347270_955347273 -7 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 3
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347273 Original CRISPR CCACGCTCTCCCACCTCTTA GGG Intronic
901239676 1:7685694-7685716 GCTCGCTCTCCCACCTACTAGGG + Intronic
901433670 1:9233614-9233636 CCAGACGCTCCCACCTCTAATGG + Intergenic
904592674 1:31623741-31623763 CCCCGTGCTCTCACCTCTTAAGG - Exonic
906184946 1:43854924-43854946 CCAACCTCTCCCACCTCTGCAGG + Intronic
917930109 1:179817156-179817178 CCACGCTCTCCCTGCTCCCACGG + Intergenic
919569974 1:199236046-199236068 CCACTCTCTCCCAATCCTTAGGG + Intergenic
919922356 1:202174201-202174223 CAACCCTGTCACACCTCTTAGGG - Intergenic
920034356 1:203056291-203056313 CCATGCTCCGCCACCTCTTCTGG + Intronic
922466097 1:225846271-225846293 CCAGCCTCTCTCACCTCTTCAGG - Exonic
922732951 1:227961516-227961538 CCTCGCTCTGTCCCCTCTTAGGG - Intergenic
1070377017 10:75842728-75842750 CCACCCTTTTCCACCTCTTTGGG - Intronic
1072896112 10:99368231-99368253 CCAAGCTCTCCCAGCTCCCATGG - Intronic
1074729912 10:116360308-116360330 CCCAGCTCTCCCCCCACTTATGG + Intronic
1075934988 10:126332724-126332746 CCACGCTCTGCCTCATTTTACGG - Intronic
1076052834 10:127349080-127349102 CCACCCCCTCTCACCTCTTTAGG + Intronic
1076535903 10:131177598-131177620 CCACGCTGTCTCCCCTTTTACGG + Intronic
1084694634 11:70746244-70746266 CCACACTCTCCCGCCTCTCCAGG + Intronic
1084694666 11:70746343-70746365 CCACACTCTCCCGCCTCTCCAGG + Intronic
1084694697 11:70746442-70746464 CCACACTCTCCCGCCTCTCCAGG + Intronic
1087119936 11:94563141-94563163 CCACATTCTCCCACCCCTTTTGG + Intronic
1088717101 11:112558503-112558525 CCAAGCTCTCCCATGTCCTAGGG + Intergenic
1089113308 11:116073907-116073929 CCACTCTCTTCCAACTCTTGGGG + Intergenic
1089292765 11:117448267-117448289 CTACCCTCTCCCACCAATTAAGG + Intronic
1089632211 11:119790962-119790984 GCCCTCTCTCCCTCCTCTTAAGG - Intergenic
1089641340 11:119849237-119849259 CAAGGCCCTTCCACCTCTTAGGG - Intergenic
1090901359 11:131034754-131034776 CCATTCTCTCCAACCTCTTCTGG + Intergenic
1091170498 11:133516102-133516124 CCAAGCTCTCCCAGATCTCATGG - Intronic
1092147724 12:6226267-6226289 CCAGGCTCCCCCTCCTCTGAAGG - Intronic
1092939172 12:13391316-13391338 CCCCTCTCTCCCACCTCCCATGG - Intergenic
1096105390 12:48994716-48994738 CCCCGCTCTCAAACCACTTATGG - Intergenic
1096553029 12:52386061-52386083 GCACACACTCCCACCTCTTTAGG - Intergenic
1101904855 12:108816935-108816957 CAGCCCTCTCCCACCTCTGATGG + Intronic
1102730259 12:115102818-115102840 CCACCCTCACCCTCCTCTTCTGG - Intergenic
1106584197 13:31043201-31043223 CCCAGCTCTGCCACCTCCTAGGG - Intergenic
1106719795 13:32426581-32426603 CCAGGCTGTCCCTCCTCCTAAGG + Intronic
1107067605 13:36232231-36232253 CAACCCTATTCCACCTCTTATGG - Intronic
1107815303 13:44239311-44239333 CACCCCTCTCCCACCTCTTCTGG - Intergenic
1110527456 13:76555411-76555433 CCTCCCTTTCCCTCCTCTTAGGG + Intergenic
1112640484 13:101268385-101268407 CCCAGCTCCCCCAGCTCTTATGG + Intronic
1122071627 14:99208942-99208964 CCTCTCTCTCCCACTTCTTGGGG - Intronic
1122310650 14:100792140-100792162 CCACCCTCGCCAGCCTCTTATGG + Intergenic
1122899768 14:104777627-104777649 CCACTCACTCACACCTCTCAGGG - Intronic
1131847119 15:96500050-96500072 CCACACTATACCACCTTTTAGGG - Intergenic
1138497435 16:57416766-57416788 ACTCGCTCCCCCAGCTCTTAGGG + Intergenic
1138539958 16:57682140-57682162 GCACTCACTCCCACCTCTTCTGG - Intronic
1142758969 17:2032202-2032224 CCCCCCTCTCCCACCTCCTGAGG - Intronic
1143195186 17:5070924-5070946 CCAGGGTCTCCCACATCATAGGG - Intergenic
1146380171 17:32322231-32322253 CCACGGTCTGCCACCTCTCACGG - Exonic
1149955432 17:61044157-61044179 CACCGCGCCCCCACCTCTTAAGG - Intronic
1152374026 17:79908880-79908902 CCAGGCTCTCCCAGCACTTTGGG + Intergenic
1155419534 18:25640018-25640040 CCACACTCTACCATATCTTAAGG - Intergenic
1157617205 18:48994110-48994132 CCCCGCTCCCCCATCTCTTCTGG + Intergenic
1159004902 18:63003017-63003039 CCACGCTCTCCCCCAGCTTGGGG + Intergenic
1160025651 18:75212964-75212986 CAACTCTCTCCAAGCTCTTAGGG + Intronic
1164767443 19:30782526-30782548 CCTGCCTCTCCCACCACTTATGG + Intergenic
1166385917 19:42380960-42380982 CCAGGCTCTTCCACCTCCCAAGG + Intergenic
1166748882 19:45155405-45155427 CCACCCAGACCCACCTCTTAAGG - Intronic
925466077 2:4108471-4108493 CCACCCTCTTCCAGCTCTCAAGG + Intergenic
925890585 2:8430936-8430958 CAAAGCTTTTCCACCTCTTATGG - Intergenic
926697727 2:15782458-15782480 CCTCCCTCTCCCACCCCTGAGGG + Intergenic
926937348 2:18099596-18099618 CCACTCTCTCCCTCTTCTTCTGG + Intronic
927966863 2:27275769-27275791 CCCCACTGTCCCACCTCTGAGGG + Intronic
928096145 2:28406360-28406382 CCACGCTCTCCATTCTCTTCTGG + Intronic
929924313 2:46196330-46196352 CCACTCTCTCCCACCTGTGCAGG + Intergenic
946187120 2:217987450-217987472 CCTCTCTTTCCCACCTCTTTTGG + Intronic
946805923 2:223471293-223471315 CCACTCTTTTGCACCTCTTAAGG - Intergenic
1169705669 20:8501502-8501524 CAACCCTCTCCCACCTCCTGTGG + Intronic
1170816895 20:19721305-19721327 CCTCGCTCCCCCACCTCCTTGGG + Exonic
1171308933 20:24130321-24130343 CCAAGATATCCCACCTCTTTAGG - Intergenic
1175163245 20:57024230-57024252 CCACACTTTCCCTCCTCTCATGG - Intergenic
1184393369 22:44218470-44218492 CCTCGGTCTCCCCCCTTTTAGGG + Intronic
950452270 3:13072124-13072146 CCATGCTCTCTAACCTCCTAAGG + Intronic
950457791 3:13102973-13102995 CCCCTCTCTGCCACCTCTGACGG - Intergenic
950677904 3:14565579-14565601 CCCTGCTCTCCCACCTCTCCGGG - Intergenic
955347273 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG + Intronic
956170993 3:66433068-66433090 CCACTCTCACCCACCTGTTTAGG - Intronic
961867484 3:129964249-129964271 CCATGCTGTCCAACCTCTCAGGG - Intergenic
967378232 3:188829247-188829269 CCATACCTTCCCACCTCTTACGG + Intronic
968944697 4:3657546-3657568 GCTCCCTCTCCCACCTCTCATGG + Intergenic
969581950 4:8070969-8070991 CCACTCCCGCCCACCTCTTCAGG + Intronic
979571648 4:122233621-122233643 TCAAGCTCTCCCTCATCTTAAGG + Intronic
988919101 5:35924479-35924501 TCAGGCTGTCCCACCTCTTGAGG + Intronic
998536917 5:142941457-142941479 CCATGCTCACCCACCCCTGATGG + Intronic
998939464 5:147265344-147265366 CCATTCTCTCCCATCTCTGAAGG + Intronic
1002374852 5:178781337-178781359 CCACGCCCACACACCTCTCACGG + Intergenic
1003081694 6:3026490-3026512 ACAAGCTCCCCCACCTCTTCGGG + Intergenic
1005013424 6:21357019-21357041 CCCCGCTCTGCCACATGTTATGG + Intergenic
1006713132 6:36093269-36093291 CCTCTCTCTCCCACCTCTGCTGG - Intronic
1007099657 6:39237176-39237198 CCACCCTCTCCCACCCATTGTGG + Intergenic
1007257902 6:40541475-40541497 CCAGGCCCTATCACCTCTTAGGG - Intronic
1008911122 6:56734508-56734530 CCCCTTTCTCCCACCTTTTAAGG - Intronic
1009588856 6:65639949-65639971 CTAAGCTCTCCCACATCTTATGG + Intronic
1012635933 6:101541591-101541613 CCAGCCTCTCCCACATCCTATGG + Intronic
1014709239 6:124787054-124787076 TCAAGCCCTCCCACCTCTCAAGG + Intronic
1016237300 6:141883479-141883501 CCACCCACTCTCTCCTCTTATGG - Intergenic
1016533935 6:145090315-145090337 CCACGTGCTCAAACCTCTTATGG + Intergenic
1019381200 7:724771-724793 CCCTGCTCTCCCAGATCTTAGGG - Intronic
1019633910 7:2065301-2065323 CCACACTCTCCCATCACTGAGGG + Intronic
1020017767 7:4841452-4841474 CCAAGCTCTCCCAGCGCTTGTGG - Intronic
1022229296 7:28398171-28398193 CCAGGCTCTACCACCTTTAATGG + Intronic
1023018036 7:35985303-35985325 CCCAGCTCTCCCACCTGATAGGG - Intergenic
1027497907 7:78911165-78911187 CCACTGTATCTCACCTCTTAGGG - Intronic
1028248669 7:88513770-88513792 CCTCTTTCTCCCACCTCTCAAGG + Intergenic
1030216223 7:107045432-107045454 CCCAGCTCTCCCACCTCTAGAGG - Intronic
1032423632 7:131802835-131802857 CCACCATCTACCACCTCTTGAGG - Intergenic
1034900969 7:154907630-154907652 CCACGTGCTCCCACCTCATGGGG - Intergenic
1038789503 8:30656355-30656377 CCACGCTTTCCCTCCTCCCAAGG - Intronic
1039598197 8:38809743-38809765 CCACACTCATCCACCTCTTGGGG - Intronic
1043042260 8:75277724-75277746 CCACTCTCTCCCAGCTTGTAGGG - Intergenic
1044699486 8:94952911-94952933 GCAGGCTATCCCACCTCTTGGGG - Intronic
1046104954 8:109653909-109653931 CCATTCTTTCCCATCTCTTAAGG + Intronic
1050709593 9:8446069-8446091 CCACACTCTCCAACCTCACAAGG + Intronic
1053470366 9:38341986-38342008 CCTCCCTCTCCCACATCTAAAGG + Intergenic
1057271285 9:93653067-93653089 CCACGCTCTCTCACCACCTGCGG - Intronic
1057710621 9:97439593-97439615 CCTTACTCTCTCACCTCTTAGGG + Intronic
1058674646 9:107389879-107389901 TCTCTCTCTCTCACCTCTTATGG + Intergenic
1058814749 9:108672708-108672730 CCACGCTCTCCGTCCTCTGTTGG - Intergenic
1061850543 9:133412425-133412447 CCATGCTCTCCTCCCCCTTAGGG + Exonic
1062513390 9:136920359-136920381 CCAGGCTCTCGCACCTCTGCAGG - Exonic
1185836185 X:3347170-3347192 CCACGCCCTCCCGCCTCTCCAGG + Intergenic
1186056419 X:5654411-5654433 GCATGCTCTCCCACCTGTAAAGG - Intergenic
1190286322 X:48963668-48963690 ACACTATCTCCCACCTCATAGGG + Intronic
1190300977 X:49057475-49057497 ACAGCCTCTCCCACCTCTTATGG - Intronic
1198583438 X:138093439-138093461 CCACTCTCTCCCACTTCTACTGG + Intergenic
1201858102 Y:18567693-18567715 TCATGCTCTACCACCTCATAAGG - Intronic
1201875219 Y:18752688-18752710 TCATGCTCTACCACCTCATAAGG + Intronic