ID: 955347274

View in Genome Browser
Species Human (GRCh38)
Location 3:58170446-58170468
Sequence CACGCTCTCCCACCTCTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 84}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347268_955347274 16 Left 955347268 3:58170407-58170429 CCACACCGTCAGGCTCTATGAGC 0: 1
1: 0
2: 2
3: 4
4: 86
Right 955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 84
955347270_955347274 -6 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 84
955347267_955347274 17 Left 955347267 3:58170406-58170428 CCCACACCGTCAGGCTCTATGAG 0: 1
1: 0
2: 1
3: 3
4: 70
Right 955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 84
955347269_955347274 11 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347274 Original CRISPR CACGCTCTCCCACCTCTTAG GGG Intronic
903345111 1:22679587-22679609 CACCCTCTCCCATCTCTCAGTGG + Intergenic
904577091 1:31511839-31511861 CACCCTCTCCCACCCCCCAGGGG - Intergenic
905381095 1:37562151-37562173 CTCGCTCTCCCGCTTCTCAGTGG - Exonic
916871410 1:168918461-168918483 CACACACTCCCACCTATTTGCGG - Intergenic
920212238 1:204336544-204336566 CACGCTCACACACCTCTTTCAGG - Intronic
921902278 1:220463374-220463396 CACCCTCTCCAACCTCAGAGTGG + Intergenic
922228988 1:223669140-223669162 CACCCTCATCAACCTCTTAGTGG - Intergenic
1065171605 10:23035774-23035796 CACCCTTTCCCAGCTCCTAGTGG + Intronic
1076256279 10:129027482-129027504 CACCCTCTCCATCCTCTGAGGGG - Intergenic
1078093963 11:8285139-8285161 CCAGCTCTCCCACTTATTAGTGG + Intergenic
1078139504 11:8682218-8682240 CCCGCTCTCACACTTCTGAGTGG - Intergenic
1083007785 11:59364701-59364723 GATGCTCTCCAACCTCTTACAGG + Exonic
1085726736 11:78961300-78961322 CATCCTGCCCCACCTCTTAGAGG + Intronic
1089632209 11:119790961-119790983 CCCTCTCTCCCTCCTCTTAAGGG - Intergenic
1091275981 11:134350488-134350510 CACCCTCTCCCATCTCCCAGCGG - Intronic
1096488119 12:51997385-51997407 CACACTCTCTCATGTCTTAGAGG + Intergenic
1096553028 12:52386060-52386082 CACACACTCCCACCTCTTTAGGG - Intergenic
1103890880 12:124238280-124238302 CAGGCTCTCTCACCTGTTACAGG - Intronic
1106584195 13:31043200-31043222 CCAGCTCTGCCACCTCCTAGGGG - Intergenic
1108208917 13:48118535-48118557 CACGCTCTGCTACCTGTGAGAGG - Intergenic
1110182643 13:72635807-72635829 CACTCTCTCCCACCTCAGGGAGG - Intergenic
1114362870 14:21994852-21994874 CACACCTTCCCAACTCTTAGCGG - Intergenic
1116130809 14:40854399-40854421 CACCCACTCCTATCTCTTAGTGG + Intergenic
1119904443 14:78288792-78288814 CAAGCTATTCCATCTCTTAGTGG - Intronic
1120215109 14:81673305-81673327 CAGGCTATGCAACCTCTTAGAGG + Intergenic
1122071626 14:99208941-99208963 CTCTCTCTCCCACTTCTTGGGGG - Intronic
1125160741 15:36640764-36640786 TACACTCTCCCAACTCTTTGAGG + Intronic
1128050577 15:64660797-64660819 CTCGCTGTCTCACCTCTTACAGG + Intronic
1128779824 15:70351985-70352007 CACGGCCTCCCACCTTCTAGTGG - Intergenic
1129491352 15:75928824-75928846 TACACTCTGCCACCTCCTAGCGG + Intronic
1130344285 15:83027456-83027478 CCAGCTCTGGCACCTCTTAGTGG - Intronic
1131648451 15:94372500-94372522 CACGATCGCTGACCTCTTAGAGG - Intronic
1132112852 15:99115042-99115064 CTCTCTCTCTCACCTCTAAGAGG - Intronic
1135802682 16:25512799-25512821 CACGCTCCTCCAAATCTTAGAGG + Intergenic
1137397159 16:48124314-48124336 CACTCTCTCCCACTTCTTAGAGG + Intronic
1141319649 16:82995351-82995373 CACGCTCACTCATGTCTTAGTGG - Intronic
1144796304 17:17893572-17893594 CATGCTCTCCCACCATTTGGAGG - Intronic
1149104409 17:52944377-52944399 CATGCTCTCCCTCCCCTCAGAGG + Intergenic
1151730694 17:75909485-75909507 CCCGCTCTCCTACCTCCCAGAGG - Exonic
1152487069 17:80601393-80601415 GCCGCTCTCCCACATCTCAGGGG + Intronic
1155174602 18:23291381-23291403 CACGCTGTCCCAAAACTTAGTGG + Intronic
1158402638 18:57134635-57134657 CAAGCTCTCCCATCTCCTAGTGG - Intergenic
1159004903 18:63003018-63003040 CACGCTCTCCCCCAGCTTGGGGG + Intergenic
1160846357 19:1167887-1167909 CACGCTCCCACTCCTTTTAGGGG + Intronic
1166968850 19:46548559-46548581 CACGCTCTTCACCTTCTTAGAGG - Intronic
1167958248 19:53085374-53085396 CACCCTCCCTCACATCTTAGTGG - Intronic
925240904 2:2326339-2326361 CACCCTCTTCCAGCTCTCAGAGG + Intronic
926697728 2:15782459-15782481 CTCCCTCTCCCACCCCTGAGGGG + Intergenic
932892642 2:75610153-75610175 CTGGCTTTCCCACCTCTTCGTGG - Intergenic
933992266 2:87642363-87642385 CAGGCTCTCCCTCCTCTGTGGGG - Intergenic
936301584 2:111308476-111308498 CAGGCTCTCCCTCCTCTGTGGGG + Intergenic
937056396 2:118940881-118940903 CAGGCTGTCCCACCTCTGAGAGG + Intergenic
938262457 2:129905611-129905633 CACACTCTCCCACCCCTCCGAGG + Intergenic
938759628 2:134412263-134412285 CACCCTCTCTCCCCTCTGAGGGG + Intronic
939791855 2:146587639-146587661 CTGGCTCACCCACCTCTTCGTGG + Intergenic
942191538 2:173475355-173475377 CTAGCTCTGCCACCTGTTAGCGG + Intergenic
948566066 2:238887142-238887164 CTCGGTGTCCCACCCCTTAGAGG + Intronic
1183059327 22:35326637-35326659 CACCCTCTCTCTCCTCCTAGTGG - Intronic
953476310 3:43208722-43208744 AAGGCTCTCCCACCCCTTCGAGG + Intergenic
955347274 3:58170446-58170468 CACGCTCTCCCACCTCTTAGGGG + Intronic
956158438 3:66323116-66323138 CATGCTCTTCCACCTCAGAGAGG - Intronic
961105133 3:124234381-124234403 CAAGCACTCCCACCTCACAGAGG + Intronic
962281646 3:134056677-134056699 CACACTCTCCCACCTTTTATAGG - Intergenic
968944698 4:3657547-3657569 CTCCCTCTCCCACCTCTCATGGG + Intergenic
979306548 4:119151292-119151314 CTCCCTCTCCCTCCTCTTAGTGG - Intronic
984373652 4:178899562-178899584 CACGCTCCCCCTCCTGTAAGGGG - Intergenic
986796319 5:11216161-11216183 AATGCTCTCTCAGCTCTTAGAGG - Intronic
990045591 5:51426655-51426677 AACACTCTCCCACTTCTCAGTGG + Intergenic
992111431 5:73498216-73498238 CGCGCTCTCCGACCCCTTTGTGG + Intergenic
1007602307 6:43090156-43090178 CACGCTCTCCTACCCCTTTCTGG - Intronic
1014740434 6:125143042-125143064 CACGCTCTCCCTCCTGCAAGAGG - Intronic
1017024519 6:150169741-150169763 CAAACTCCCCCACATCTTAGTGG + Intronic
1019409896 7:901806-901828 CCCGCCCTCCCTCCTCCTAGAGG + Intronic
1019877557 7:3827757-3827779 CATGCTCTCCCTCCCCTTTGGGG + Intronic
1019899830 7:4011548-4011570 CACGCTCTCCCATCCCTGCGAGG + Intronic
1023018034 7:35985302-35985324 CCAGCTCTCCCACCTGATAGGGG - Intergenic
1029927695 7:104334982-104335004 CAGGCTTTCCCACTTCTTACTGG + Intronic
1031612008 7:123839134-123839156 CCAGCTCTCCCACCTCTGACAGG + Intronic
1032347210 7:131127299-131127321 GACTCTTTCCCACCTGTTAGTGG - Intronic
1035736587 8:1891751-1891773 CTCCCTGTCCCACCCCTTAGTGG + Intronic
1041992144 8:64006134-64006156 CCCATTCTGCCACCTCTTAGTGG - Intergenic
1045287700 8:100806215-100806237 CACGCCCAGCCACCTCTTATTGG + Intergenic
1048549850 8:135424220-135424242 CATGATATCCCAGCTCTTAGTGG - Intergenic
1049987148 9:962224-962246 CACGCTTGCTCACCTCTGAGAGG + Intronic
1057056987 9:91970915-91970937 CAGGCTGTCCCACGTCTAAGGGG + Intergenic
1057710622 9:97439594-97439616 CTTACTCTCTCACCTCTTAGGGG + Intronic
1059308768 9:113374276-113374298 CAGGCTCCGCCACCCCTTAGGGG - Exonic
1059348571 9:113648862-113648884 CTCGCTCTGCCACCTCCTAGTGG - Intergenic
1059397835 9:114049648-114049670 CAAGCTCTGCCACCTCTTCCTGG + Exonic
1186031800 X:5376431-5376453 CATGCTCTCCCTCCTATAAGGGG + Intergenic
1186056418 X:5654410-5654432 CATGCTCTCCCACCTGTAAAGGG - Intergenic
1190300976 X:49057474-49057496 CAGCCTCTCCCACCTCTTATGGG - Intronic
1198510020 X:137341077-137341099 CACCCTCTCCCACCTCCTGCTGG - Intergenic