ID: 955347278

View in Genome Browser
Species Human (GRCh38)
Location 3:58170463-58170485
Sequence TAGGGGCCCCAGCATTATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347270_955347278 11 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32
955347272_955347278 -5 Left 955347272 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32
955347269_955347278 28 Left 955347269 3:58170412-58170434 CCGTCAGGCTCTATGAGCCTCTG 0: 1
1: 0
2: 0
3: 32
4: 255
Right 955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347278 Original CRISPR TAGGGGCCCCAGCATTATCG TGG Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
1070799840 10:79238925-79238947 TAGGGGCCCAAGCAGGATCCTGG - Intronic
1081582254 11:44360394-44360416 CAGGGGTCCCAGCATGATCAGGG - Intergenic
1086141709 11:83506739-83506761 TAGTGTCCCCAGCTTTATCAGGG + Intronic
1089963849 11:122639060-122639082 TAGGGGCTCCAGCAATGTAGAGG + Intergenic
1092451506 12:8606645-8606667 TAGGGTGCCCAGCATTACTGGGG + Intronic
1104356642 12:128092633-128092655 TATGGGCCCCAGAATAATCCTGG + Intergenic
1113767161 13:112888734-112888756 TGGGAGCCCCAGCATCAGCGCGG - Intergenic
1116528070 14:45932201-45932223 CATGGGCTCCAGCATAATCGTGG + Intergenic
1117898052 14:60508099-60508121 TCTGGGCCCCCGCATTGTCGTGG + Intronic
1129206185 15:74038268-74038290 GAGGGACCCCAGCAATATTGGGG + Intronic
1133139962 16:3736369-3736391 TAGGGGCTCCAGCACTGTGGTGG - Intronic
1144307039 17:13978175-13978197 TGGGGGCCCCAGCATAGTCTTGG + Intergenic
1146705199 17:34996102-34996124 TGGGGGCCACAGCATGATCTTGG + Exonic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1157381939 18:47226445-47226467 GAGGGGCCCCACCATTATCAAGG - Intronic
1160202759 18:76808952-76808974 TAGCAGCCCCAGCATTACCAAGG - Intronic
1169966485 20:11223443-11223465 AAGGGGGCCCACCATTATGGTGG + Intergenic
1173570362 20:44071819-44071841 TGGGTGCCCCAGCCTTGTCGTGG + Intergenic
1175660672 20:60809313-60809335 AAGGGGCCCCGGCATTGCCGAGG + Intergenic
953243751 3:41172183-41172205 TAGGGGCCCCAGCACAGTCGGGG - Intergenic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
962846286 3:139276571-139276593 TTGAGGCCCCAGCATTATGCAGG - Intronic
966767930 3:183479137-183479159 TAGCAGCCCCAGCATCATCCAGG + Intergenic
967795395 3:193593432-193593454 AAGAGGCCCCAGAATTAACGGGG - Intronic
987163354 5:15168432-15168454 TTGGGGTCCCAGCTTTATGGGGG + Intergenic
988307985 5:29518483-29518505 TACTGCCCCCAGCATTATCTAGG + Intergenic
991554506 5:67880519-67880541 TAGGGGCCCCAGCAGTCTACTGG - Intergenic
1004122661 6:12839581-12839603 TAGGGGTACCAGGATTATCTTGG + Intronic
1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG + Intergenic
1020106386 7:5424048-5424070 TAGGGGCTCCAGCAGTTTCCAGG + Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG + Intergenic
1061905521 9:133694708-133694730 TAGGAGCCCCAGAATGAACGGGG - Intronic
1199263736 X:145805940-145805962 TAGGGACCCCAGCATGTTCTGGG + Intergenic
1201376047 Y:13320972-13320994 TAGGAGCCCCAATATTATCTTGG + Intronic