ID: 955347282

View in Genome Browser
Species Human (GRCh38)
Location 3:58170480-58170502
Sequence TCGTGGAAGCACCTTACCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347275_955347282 3 Left 955347275 3:58170454-58170476 CCCACCTCTTAGGGGCCCCAGCA 0: 1
1: 0
2: 1
3: 13
4: 175
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49
955347276_955347282 2 Left 955347276 3:58170455-58170477 CCACCTCTTAGGGGCCCCAGCAT 0: 1
1: 0
2: 0
3: 10
4: 149
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49
955347277_955347282 -1 Left 955347277 3:58170458-58170480 CCTCTTAGGGGCCCCAGCATTAT 0: 1
1: 0
2: 0
3: 6
4: 69
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49
955347272_955347282 12 Left 955347272 3:58170445-58170467 CCACGCTCTCCCACCTCTTAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49
955347270_955347282 28 Left 955347270 3:58170429-58170451 CCTCTGCTTGTAATTGCCACGCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG 0: 1
1: 0
2: 1
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347282 Original CRISPR TCGTGGAAGCACCTTACCTT TGG Intronic
1064013073 10:11751298-11751320 TCTTGGAAGCCCCTAACCCTTGG + Intronic
1068591739 10:58860007-58860029 CCTTGGAAGCACCTATCCTTTGG + Intergenic
1070855458 10:79605031-79605053 TACTGGATGCCCCTTACCTTTGG + Intergenic
1075022252 10:118960450-118960472 TCTTGGCAGGGCCTTACCTTGGG - Intergenic
1076707721 10:132310798-132310820 TCGTGGGACCACTTTAGCTTGGG + Intronic
1077925971 11:6682474-6682496 GTGTGGATGGACCTTACCTTTGG - Intronic
1079106910 11:17577658-17577680 TCCTGGAAGCGCTTTTCCTTTGG + Intronic
1079109645 11:17597763-17597785 TCGTGCAAGCACCTCACCTTGGG + Intronic
1088453975 11:110014336-110014358 TGGTGGAAGAAACTTTCCTTGGG - Intergenic
1090171759 11:124611732-124611754 TCTTGGAAGCAACTTACCAGAGG - Exonic
1098478116 12:70928890-70928912 TCTTGGAAGTACTTTACTTTAGG + Intergenic
1100456500 12:94756641-94756663 TCGTGGAACTATCTTACATTAGG - Intergenic
1102861936 12:116343663-116343685 TCTTGGAAGCCACTAACCTTGGG + Intergenic
1107352203 13:39527321-39527343 TAGTTGAAGCACATCACCTTAGG - Intronic
1111803195 13:93005467-93005489 TGGTGGAAGGAACTTGCCTTGGG - Intergenic
1132981638 16:2741260-2741282 TAGTGGAAGAGCCTTCCCTTGGG + Intergenic
1134004453 16:10808911-10808933 TCATGGAAGCCCATGACCTTTGG + Intronic
1138405341 16:56788382-56788404 TTGTAGAAGCAACTTTCCTTTGG - Intronic
1140816312 16:78624222-78624244 TCGTGGAATCATGTTCCCTTCGG + Intronic
1143271160 17:5675792-5675814 TCATGGGAGCTCATTACCTTTGG + Intergenic
1145863472 17:28226251-28226273 GGGTGGGAGCACCTGACCTTGGG - Intergenic
1151937831 17:77274173-77274195 TCTTAGAAGCAACTTACCGTGGG + Intergenic
1161756102 19:6135567-6135589 TCCTGGAAGCAGCTTCCCCTAGG + Intronic
929699908 2:44153003-44153025 TCCTTGAGGCACCTTTCCTTTGG + Intergenic
934512260 2:94954772-94954794 TGTTGGAAGCACCTTTCTTTGGG - Intergenic
940683018 2:156809945-156809967 TTGTGGAAGCACATTACAATGGG - Intergenic
1172777855 20:37417643-37417665 TCCTGGAAGCCCCTTCCCTCAGG - Intergenic
1177113054 21:17051649-17051671 TCTTGGAAACACCTTGGCTTTGG - Intergenic
1182078763 22:27514020-27514042 TTGTGGAAGCAACTAACCTAAGG - Intergenic
1203258777 22_KI270733v1_random:160787-160809 TCGAGGAATCACCTAACCCTGGG + Intergenic
951693334 3:25419696-25419718 CCCTGGAAGCACCATGCCTTGGG + Intronic
955347282 3:58170480-58170502 TCGTGGAAGCACCTTACCTTTGG + Intronic
968864250 4:3197694-3197716 CCTTGGATGCACCTTACCTGGGG - Intronic
975135361 4:70869152-70869174 TAGTGGAAGCATCCTACTTTGGG + Intergenic
976272983 4:83248867-83248889 TCCTGGACTCACCTTACCCTGGG + Intergenic
977438652 4:97034827-97034849 TGAAGGAAGCATCTTACCTTAGG - Intergenic
985671560 5:1209434-1209456 TCCAGGAAGCACCTGCCCTTCGG + Intronic
994790472 5:104219578-104219600 ACATGGAAGCACTTTACATTTGG + Intergenic
995814901 5:116157242-116157264 TTGTGGCAGGACCTTACCTTTGG + Intronic
1007357099 6:41329026-41329048 TCGGAGAAGCCCCTTACCTTAGG + Intergenic
1008095395 6:47334634-47334656 TATTGCAAGTACCTTACCTTGGG - Intergenic
1010382144 6:75237506-75237528 TAGTGGAAGCAGATTATCTTTGG - Intergenic
1012859181 6:104538886-104538908 TCTTGGAACCACTTTACCTCAGG + Intergenic
1017642990 6:156512497-156512519 TCCTGTAATCACCTTTCCTTGGG + Intergenic
1024615557 7:51108747-51108769 TGGGGGAAGCAGCTTTCCTTTGG - Intronic
1034889795 7:154829768-154829790 TGGAGGAAGCATCTTACCTATGG - Intronic
1043573379 8:81630192-81630214 TAGGGGAAGATCCTTACCTTGGG + Intergenic
1045364905 8:101466997-101467019 TTGTGGAAGGAACTTACATTTGG - Intergenic
1045395197 8:101753863-101753885 TCCTGGAAGCACTCTACCTCTGG + Intronic
1047847411 8:128822638-128822660 TCCTGGAAGAGCCTTTCCTTTGG + Intergenic
1051811508 9:21054701-21054723 TAGTGGAACCCCTTTACCTTAGG + Intergenic
1185970835 X:4661486-4661508 TCATGGAAGCAGCATATCTTTGG - Intergenic
1196144176 X:112298492-112298514 TCATGGGAGCAACTTACTTTAGG + Intergenic