ID: 955347705

View in Genome Browser
Species Human (GRCh38)
Location 3:58173307-58173329
Sequence GTCCCCAGATAGGCCCCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347692_955347705 26 Left 955347692 3:58173258-58173280 CCCCAGGGTGCTAGCTCTACCCC 0: 1
1: 0
2: 0
3: 15
4: 125
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347693_955347705 25 Left 955347693 3:58173259-58173281 CCCAGGGTGCTAGCTCTACCCCC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347694_955347705 24 Left 955347694 3:58173260-58173282 CCAGGGTGCTAGCTCTACCCCCT 0: 1
1: 0
2: 1
3: 11
4: 124
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347698_955347705 6 Left 955347698 3:58173278-58173300 CCCCTGGTGATACCGCTGTGGAA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347702_955347705 -6 Left 955347702 3:58173290-58173312 CCGCTGTGGAAACAGGAGTCCCC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347697_955347705 7 Left 955347697 3:58173277-58173299 CCCCCTGGTGATACCGCTGTGGA 0: 1
1: 0
2: 0
3: 7
4: 91
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347699_955347705 5 Left 955347699 3:58173279-58173301 CCCTGGTGATACCGCTGTGGAAA 0: 1
1: 0
2: 0
3: 7
4: 71
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130
955347700_955347705 4 Left 955347700 3:58173280-58173302 CCTGGTGATACCGCTGTGGAAAC 0: 1
1: 0
2: 0
3: 4
4: 67
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347705 Original CRISPR GTCCCCAGATAGGCCCCGGC AGG Intergenic
900367158 1:2315977-2315999 GTCCCCAGATGGAAGCCGGCAGG + Intergenic
900579650 1:3402726-3402748 GTCCCCTGATAGCCCTGGGCTGG + Intronic
900596064 1:3480764-3480786 GTCCCCAGAGAGGCACCCCCAGG + Exonic
900791481 1:4683814-4683836 GTCCCCAGAGAGGCCAGGGTGGG + Intronic
900807454 1:4776733-4776755 GCCCCCAGATGGGCCCCAGGTGG + Intronic
901494925 1:9615411-9615433 GTCCCCATATCAGCCCCGGATGG - Intergenic
902795122 1:18795934-18795956 GTCTCCAGAGAGGCCTGGGCAGG + Intergenic
902871378 1:19315549-19315571 CTCCCCAGCTAGTCCCTGGCTGG - Intronic
912457735 1:109808904-109808926 GTCCCCAGCTAGGCTCAGCCTGG + Intergenic
912956082 1:114154794-114154816 CTCCCGAGATAGGCCCCTGCAGG - Intergenic
913655047 1:120952556-120952578 GACCCCAGAAACGCCCCGGTCGG + Intergenic
915635650 1:157184729-157184751 GTCCCCAGCTTGGCCTCAGCTGG + Intergenic
919904746 1:202070507-202070529 GACCCCAGAGATGCCCAGGCAGG + Intergenic
920260571 1:204685381-204685403 GTCCCCAGCCCGGCCCCGGGCGG - Intronic
920649717 1:207827668-207827690 GTTCCCAGATGGTCCCCAGCAGG - Intergenic
921747193 1:218752242-218752264 GTCCCCAGAGACGCCCTGGAAGG - Intergenic
924102614 1:240620147-240620169 GTCCCCACAAAGGCACCAGCTGG - Intergenic
924784726 1:247184401-247184423 GTCACCAGATAGCCACAGGCTGG + Intergenic
1063257774 10:4347739-4347761 GGCCCCAGACAGGCCCCGGGGGG - Intergenic
1075056640 10:119223567-119223589 GTCCCCAAATAGGACTCTGCAGG + Intronic
1077302889 11:1855299-1855321 GTCCCCAGGAAGGCCCAGGCTGG + Intronic
1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG + Intergenic
1078066795 11:8083831-8083853 GTGCCCAGAAAGACCCCAGCAGG - Intronic
1078534669 11:12163387-12163409 GTCCCGGGATTGGCACCGGCTGG - Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081870810 11:46381786-46381808 GCCCCTAGATCGGCCGCGGCCGG - Intronic
1088849071 11:113690665-113690687 CTCCCCAGAAAGGCCCAAGCAGG + Intronic
1089288072 11:117420312-117420334 GTCCCCAGCTGAGCCCCGCCAGG - Intergenic
1089601093 11:119615814-119615836 CTCCCCAGATAGGCGCTGGGGGG - Intergenic
1090632725 11:128664381-128664403 GTGCTCAGATGGGCCCCTGCAGG - Intergenic
1098655544 12:73024667-73024689 GTCACCAGATATGCCCCTTCAGG + Intergenic
1099245352 12:80187352-80187374 GGCCACAGATTGGCCCCAGCAGG - Intergenic
1103415462 12:120739532-120739554 GTCCCCAGGGAGCCCCCGCCGGG - Exonic
1103994362 12:124819570-124819592 GGCCCGAGATATGTCCCGGCTGG - Intronic
1108321550 13:49295421-49295443 GTACCCAGAGAGGCCCGGGCCGG + Intergenic
1112457487 13:99575668-99575690 GTCCCCAGGATGGCCCCGGGAGG + Intergenic
1113185679 13:107683668-107683690 GTCCCCAGAGAGGCCGTGGCAGG + Intronic
1113777291 13:112955083-112955105 GTCCCCAGAGAGGCTACGCCTGG - Intronic
1116139230 14:40968438-40968460 GTCCCCAGATAGAGGCGGGCTGG + Intergenic
1118312426 14:64704000-64704022 ATCCCCAGATCGATCCCGGCTGG + Intergenic
1118613984 14:67562726-67562748 GTCCCGAGCTAGGTCCCGGGAGG + Exonic
1118804484 14:69223711-69223733 GTCTCCAGAAAGGACCAGGCAGG - Intronic
1121458694 14:94056322-94056344 GTCACCAGAAAGGCCAAGGCAGG + Intronic
1121731648 14:96191592-96191614 GTCCTCAGAAAGGCCCCCACCGG - Intergenic
1125919738 15:43518326-43518348 GTCTCCAGAGTGGCCTCGGCAGG - Intronic
1127830116 15:62743271-62743293 GTCCCCAGAAATGCCACTGCGGG + Intronic
1130911580 15:88274694-88274716 GGCCCCAGATGGGCCTTGGCTGG + Intergenic
1132483993 16:180897-180919 GTCCCCGGGAGGGCCCCGGCGGG + Intronic
1133018464 16:2955579-2955601 GTCCCCAGGAAGGCCGCAGCTGG - Intergenic
1133026919 16:2992559-2992581 GTCCCAAGCCAGGCCTCGGCTGG + Intergenic
1133130339 16:3672860-3672882 CTCCCCAGGCAGGCCCTGGCTGG + Intronic
1133465297 16:6021397-6021419 GTGACCACAGAGGCCCCGGCTGG + Intronic
1136114315 16:28085181-28085203 GTCCCCAGATAGCCTCAGGATGG + Intergenic
1137578249 16:49618011-49618033 TTCCCCAGACAGGGCCCTGCTGG + Intronic
1138582722 16:57952111-57952133 GTCCCCTGCTATGCCCAGGCAGG - Intronic
1139428937 16:66900803-66900825 GTCGCCTGATAGGCACCGGGGGG - Intergenic
1139972229 16:70783356-70783378 GCCCACAGAGAGGCCGCGGCAGG - Intronic
1140204745 16:72924595-72924617 GCCCACAGAGAGGCCGCGGCTGG + Intronic
1140819153 16:78647134-78647156 GTCCCCAGCTAGACCCAGGATGG - Intronic
1141797971 16:86287285-86287307 GGCACCAGAGGGGCCCCGGCAGG - Intergenic
1142178545 16:88656210-88656232 GCCCCCATACAGGCTCCGGCAGG + Exonic
1143009552 17:3858447-3858469 GTCACCAGAAAGACCCAGGCAGG + Intergenic
1143516241 17:7420583-7420605 GATCCCAGGTAGGCCCTGGCCGG - Intronic
1149736515 17:58999724-58999746 GTCCCCAGATTGTCCCCAGGAGG - Intronic
1152156562 17:78637566-78637588 GTCCCCACAAAGTCCCAGGCTGG + Intergenic
1152205039 17:78970091-78970113 GTCCCCAGGGAGGCACCTGCTGG - Intergenic
1152364659 17:79848645-79848667 TTCCCCAGATAGGCCCTGGCAGG + Intergenic
1152610615 17:81313513-81313535 GTCCCCACATTGGCCCTGTCTGG + Exonic
1152644696 17:81463397-81463419 GCCCCCAGAGGGTCCCCGGCAGG + Intronic
1153201994 18:2656100-2656122 GTCCCCACAGAGGCCCCACCAGG - Exonic
1157493959 18:48142350-48142372 GGCCCCAGACAAGCACCGGCTGG - Intronic
1158517587 18:58143664-58143686 GTCCCCAGAGAGGCCGTGGATGG + Intronic
1159943803 18:74428786-74428808 GTTCCCAGATAGGCTCAGGGAGG - Intergenic
1160511371 18:79455422-79455444 CTCCCCAGAGGGGCCCCGGGAGG - Intronic
1160797531 19:952879-952901 GTCCCCAGGCAGGCCCCACCTGG - Intronic
1161206063 19:3042034-3042056 GTTCCCCGACAGGCCCGGGCAGG + Intronic
1162363113 19:10231257-10231279 GTCCCCAGGGCGGCCGCGGCTGG + Exonic
1162555508 19:11383576-11383598 GGCCCCCTATCGGCCCCGGCAGG + Intronic
1163349262 19:16765052-16765074 GCCCCCAGAGATGCCCCGGCAGG - Exonic
1163608774 19:18290537-18290559 CTCCCCAGAGAGGCCCCTGTGGG - Intergenic
1164476518 19:28579737-28579759 CTCCCCAGACAGTCCCCGGCAGG - Intergenic
1165138733 19:33686784-33686806 GTCCCCAGCAAGGCCCCAGCTGG - Intronic
1165357024 19:35310651-35310673 ATCCCCAGATCAGCCCCAGCTGG - Intronic
1165898775 19:39158670-39158692 TTACCCAGCTAGGCCCAGGCTGG - Intronic
1167569181 19:50276336-50276358 GTCCCCAGCTTGACCCAGGCCGG - Intronic
1168243284 19:55097783-55097805 GTCCCCAGATGCTCCCAGGCTGG + Intronic
925043420 2:751793-751815 GTCCCCTGAGAGGTCCCTGCAGG - Intergenic
926424588 2:12729261-12729283 GTCCCCAGGAAGCCCCCAGCAGG - Intronic
937241748 2:120466378-120466400 GTCCCCAGCCACGCCCCCGCAGG - Intergenic
940775204 2:157876721-157876743 GTGCCCAGGTAGGCGCGGGCGGG + Exonic
946313667 2:218896517-218896539 GCCCCCAGCTAGCCCCTGGCAGG + Intronic
946875537 2:224126120-224126142 GTTCCCAGAAAGGCCCAGCCTGG + Intergenic
1171370787 20:24660925-24660947 GTCTCCAGGTAGGAACCGGCTGG + Intronic
1171442245 20:25174616-25174638 GCCCCCAGATGGGCCCTGTCAGG + Intergenic
1172792914 20:37518660-37518682 GTCCCCATCTAGGTCCTGGCTGG - Exonic
1176149000 20:63579397-63579419 GTCCTCAGAAAGGCCTCAGCAGG + Intergenic
1180085500 21:45506331-45506353 GTCCACAGCACGGCCCCGGCTGG + Intronic
1183096496 22:35555210-35555232 GCCCCCAGATATGCACAGGCTGG - Intergenic
1183956106 22:41381678-41381700 GTCCCCTGATTGGCGCCTGCTGG - Intronic
1184467591 22:44677924-44677946 GTTTCCAGAGAGGCCCTGGCAGG + Intronic
1185322653 22:50209064-50209086 CTCCCCAGTCAGGACCCGGCTGG - Intronic
949720501 3:6984286-6984308 GTCACCAGATAGGTGCTGGCTGG - Intronic
950345217 3:12287561-12287583 CTCCCCAGACCGGCCCTGGCCGG + Intronic
953431948 3:42847311-42847333 GTCCCCAGCCTGGCCCCCGCTGG - Intronic
955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG + Intergenic
961261223 3:125603777-125603799 GTGCCCAGAAAGCCCCTGGCAGG + Intergenic
962626430 3:137229992-137230014 GTCCCCAGATAGCTCCAGCCTGG - Intergenic
967146789 3:186613116-186613138 TGCCCCAGAGAGGCCCTGGCAGG - Exonic
968228717 3:196991898-196991920 GTAGCCAGGAAGGCCCCGGCTGG - Intronic
968603955 4:1522771-1522793 TCACCCAGATAGGCCCCAGCTGG - Intergenic
969526771 4:7707841-7707863 CTCCCCAGCCAGGCCCCTGCAGG - Intronic
969926679 4:10592048-10592070 GAGACCAGACAGGCCCCGGCAGG - Intronic
979728279 4:123991172-123991194 GTCCCCAGAGTGGCCACAGCAGG - Intergenic
981018684 4:140002905-140002927 TTCCCCAGGTAGGCACTGGCAGG + Intronic
984857177 4:184205394-184205416 TTCCCCAGAAAGGCCCAAGCTGG - Intronic
985258381 4:188091886-188091908 GTCCTCAGATAGTGCCAGGCAGG + Exonic
994415494 5:99464676-99464698 GCCCCCAGAAAGGCCCCAGTGGG - Intergenic
997581565 5:135020398-135020420 GTTCCCAGATAGGCCACAGGAGG + Intergenic
1002108623 5:176892973-176892995 GTCACCAGATAGGCCTGGTCAGG - Intronic
1007801452 6:44397153-44397175 GTCACCAGAAAGACCACGGCAGG - Intronic
1011565100 6:88665331-88665353 GTCCCCAGAGAAGCCCTGGAAGG + Intronic
1019478659 7:1256087-1256109 GACCCCAGAGAGCCCCCGGCCGG + Intergenic
1019565954 7:1679245-1679267 GTCACCAGCTAGACCCTGGCAGG - Intergenic
1024083244 7:45873092-45873114 GTCCCCACTTAGGCCCAGGTAGG + Intergenic
1026996008 7:74617218-74617240 GTCCCCAGGCAGGGCCCTGCCGG - Intergenic
1032486672 7:132292848-132292870 GTCCTCAGAGAGGCCTCCGCTGG - Intronic
1035159984 7:156943371-156943393 TTCCACAGATAGACCCAGGCTGG + Intergenic
1047217439 8:122887887-122887909 GTCCCCTGATGAGCCCTGGCCGG - Intronic
1049235565 8:141510667-141510689 CTCCCCAGAAAGGCCCTGGGGGG - Intergenic
1053414962 9:37941655-37941677 TTCCCCAGCCAGGCCCCTGCAGG - Intronic
1053440860 9:38115282-38115304 GTCCCCAGAAAGGGCCAGGTTGG + Intergenic
1054504085 9:65893547-65893569 GTCCCCAGCTAAGCCCCACCAGG - Intronic
1057877798 9:98771176-98771198 CTCCCCAGCTGGGCCCTGGCAGG - Intronic
1061954289 9:133953572-133953594 GTCCCCAGAGGGACCCTGGCAGG + Intronic
1062392236 9:136338428-136338450 GACCCCAGAGAGGCCCCAGTGGG + Intronic
1062524203 9:136971769-136971791 TGCCCCAGACTGGCCCCGGCAGG + Exonic
1062732860 9:138119355-138119377 GTTCCCAGATTGGCCTCGGAGGG - Intronic
1186486400 X:9937359-9937381 GGCCCCACATAGGGCCCAGCCGG + Exonic
1189294798 X:39910578-39910600 GTGCCCTGAGAGGCCCAGGCAGG + Intergenic
1189915504 X:45851627-45851649 GCCCCCGGCTGGGCCCCGGCGGG - Intergenic
1195308585 X:103608741-103608763 GGCCCCAGTTCGGCCCTGGCCGG - Intronic