ID: 955347705

View in Genome Browser
Species Human (GRCh38)
Location 3:58173307-58173329
Sequence GTCCCCAGATAGGCCCCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955347698_955347705 6 Left 955347698 3:58173278-58173300 CCCCTGGTGATACCGCTGTGGAA No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347697_955347705 7 Left 955347697 3:58173277-58173299 CCCCCTGGTGATACCGCTGTGGA No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347700_955347705 4 Left 955347700 3:58173280-58173302 CCTGGTGATACCGCTGTGGAAAC No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347702_955347705 -6 Left 955347702 3:58173290-58173312 CCGCTGTGGAAACAGGAGTCCCC No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347699_955347705 5 Left 955347699 3:58173279-58173301 CCCTGGTGATACCGCTGTGGAAA No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347693_955347705 25 Left 955347693 3:58173259-58173281 CCCAGGGTGCTAGCTCTACCCCC No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347692_955347705 26 Left 955347692 3:58173258-58173280 CCCCAGGGTGCTAGCTCTACCCC No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data
955347694_955347705 24 Left 955347694 3:58173260-58173282 CCAGGGTGCTAGCTCTACCCCCT No data
Right 955347705 3:58173307-58173329 GTCCCCAGATAGGCCCCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955347705 Original CRISPR GTCCCCAGATAGGCCCCGGC AGG Intergenic