ID: 955348090

View in Genome Browser
Species Human (GRCh38)
Location 3:58175612-58175634
Sequence TTGGACTCGCTTATCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955348088_955348090 -5 Left 955348088 3:58175594-58175616 CCAAGGGTGTTTTGTATTTTGGA No data
Right 955348090 3:58175612-58175634 TTGGACTCGCTTATCTCCCCGGG No data
955348086_955348090 3 Left 955348086 3:58175586-58175608 CCACATATCCAAGGGTGTTTTGT No data
Right 955348090 3:58175612-58175634 TTGGACTCGCTTATCTCCCCGGG No data
955348083_955348090 22 Left 955348083 3:58175567-58175589 CCTGACTTGTGGCACGGATCCAC No data
Right 955348090 3:58175612-58175634 TTGGACTCGCTTATCTCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955348090 Original CRISPR TTGGACTCGCTTATCTCCCC GGG Intergenic
No off target data available for this crispr