ID: 955348771

View in Genome Browser
Species Human (GRCh38)
Location 3:58179398-58179420
Sequence TTGGACAGTGTCTGGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955348771_955348777 20 Left 955348771 3:58179398-58179420 CCTCCCAGCCAGACACTGTCCAA No data
Right 955348777 3:58179441-58179463 GTGTCATTCTCCCAATACTAAGG No data
955348771_955348775 -7 Left 955348771 3:58179398-58179420 CCTCCCAGCCAGACACTGTCCAA No data
Right 955348775 3:58179414-58179436 TGTCCAAGTGTTTTATATGCTGG No data
955348771_955348778 21 Left 955348771 3:58179398-58179420 CCTCCCAGCCAGACACTGTCCAA No data
Right 955348778 3:58179442-58179464 TGTCATTCTCCCAATACTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955348771 Original CRISPR TTGGACAGTGTCTGGCTGGG AGG (reversed) Intergenic
No off target data available for this crispr