ID: 955348775

View in Genome Browser
Species Human (GRCh38)
Location 3:58179414-58179436
Sequence TGTCCAAGTGTTTTATATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955348771_955348775 -7 Left 955348771 3:58179398-58179420 CCTCCCAGCCAGACACTGTCCAA No data
Right 955348775 3:58179414-58179436 TGTCCAAGTGTTTTATATGCTGG No data
955348772_955348775 -10 Left 955348772 3:58179401-58179423 CCCAGCCAGACACTGTCCAAGTG No data
Right 955348775 3:58179414-58179436 TGTCCAAGTGTTTTATATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955348775 Original CRISPR TGTCCAAGTGTTTTATATGC TGG Intergenic
No off target data available for this crispr