ID: 955348777

View in Genome Browser
Species Human (GRCh38)
Location 3:58179441-58179463
Sequence GTGTCATTCTCCCAATACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955348773_955348777 16 Left 955348773 3:58179402-58179424 CCAGCCAGACACTGTCCAAGTGT No data
Right 955348777 3:58179441-58179463 GTGTCATTCTCCCAATACTAAGG No data
955348772_955348777 17 Left 955348772 3:58179401-58179423 CCCAGCCAGACACTGTCCAAGTG No data
Right 955348777 3:58179441-58179463 GTGTCATTCTCCCAATACTAAGG No data
955348771_955348777 20 Left 955348771 3:58179398-58179420 CCTCCCAGCCAGACACTGTCCAA No data
Right 955348777 3:58179441-58179463 GTGTCATTCTCCCAATACTAAGG No data
955348774_955348777 12 Left 955348774 3:58179406-58179428 CCAGACACTGTCCAAGTGTTTTA No data
Right 955348777 3:58179441-58179463 GTGTCATTCTCCCAATACTAAGG No data
955348776_955348777 1 Left 955348776 3:58179417-58179439 CCAAGTGTTTTATATGCTGGTCT No data
Right 955348777 3:58179441-58179463 GTGTCATTCTCCCAATACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955348777 Original CRISPR GTGTCATTCTCCCAATACTA AGG Intergenic
No off target data available for this crispr