ID: 955350145

View in Genome Browser
Species Human (GRCh38)
Location 3:58187709-58187731
Sequence CACTCACTTGAGGCTGTCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955350145_955350150 -1 Left 955350145 3:58187709-58187731 CCAACGACAGCCTCAAGTGAGTG No data
Right 955350150 3:58187731-58187753 GTGGAGTTGGCTCCCTGGCCTGG No data
955350145_955350154 20 Left 955350145 3:58187709-58187731 CCAACGACAGCCTCAAGTGAGTG No data
Right 955350154 3:58187752-58187774 GGCTTCACCACTGCTGAGTGTGG No data
955350145_955350149 -6 Left 955350145 3:58187709-58187731 CCAACGACAGCCTCAAGTGAGTG No data
Right 955350149 3:58187726-58187748 TGAGTGTGGAGTTGGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955350145 Original CRISPR CACTCACTTGAGGCTGTCGT TGG (reversed) Intergenic
No off target data available for this crispr