ID: 955351506

View in Genome Browser
Species Human (GRCh38)
Location 3:58196759-58196781
Sequence CCTTCAATGGGGACAGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 228}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955351506_955351515 12 Left 955351506 3:58196759-58196781 CCCCCCTCTGTCCCCATTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 955351515 3:58196794-58196816 AGCTGTTTGAAAATCCCTGAAGG 0: 1
1: 0
2: 1
3: 19
4: 190
955351506_955351516 13 Left 955351506 3:58196759-58196781 CCCCCCTCTGTCCCCATTGAAGG 0: 1
1: 0
2: 1
3: 21
4: 228
Right 955351516 3:58196795-58196817 GCTGTTTGAAAATCCCTGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955351506 Original CRISPR CCTTCAATGGGGACAGAGGG GGG (reversed) Intronic
901064212 1:6486954-6486976 GGTTCCATGGGGAAAGAGGGTGG + Intronic
903257339 1:22111705-22111727 GCTTCAACTGGGAAAGAGGGAGG - Intergenic
903934838 1:26888313-26888335 CCTTCTGTGAGGACAGAAGGAGG + Intronic
904353423 1:29923564-29923586 CCTGCCTTGGGGACAGGGGGAGG - Intergenic
906013793 1:42554739-42554761 CCTTCAATGGTTAGAGAGTGTGG - Intronic
906801120 1:48737861-48737883 GCCTCTGTGGGGACAGAGGGCGG + Intronic
907437737 1:54460159-54460181 CCTTGGATGGGGAAGGAGGGAGG + Intergenic
908587597 1:65588599-65588621 CATTCCCTGGGGACAGAGGTGGG - Intronic
909877009 1:80819129-80819151 TCTTCATTGAGGAGAGAGGGAGG - Intergenic
910464651 1:87485316-87485338 CCTTCTGAGGTGACAGAGGGAGG - Intergenic
911107090 1:94142270-94142292 CCTTCTATCAGCACAGAGGGAGG - Intergenic
912491542 1:110065245-110065267 CCAAGAATGGGGGCAGAGGGCGG + Intronic
912659788 1:111517067-111517089 CCTGCACTTGGGACAGAGGGAGG - Intronic
914359425 1:146920028-146920050 CCTTCTGAGGTGACAGAGGGAGG - Intergenic
914494324 1:148179847-148179869 CCTTCTGAGGTGACAGAGGGAGG + Intergenic
918936222 1:190925277-190925299 ACTTGAATGGGGGCAGAAGGTGG + Intergenic
922469755 1:225868821-225868843 CCATCTCTGGGGACACAGGGAGG - Intronic
922986383 1:229869132-229869154 CATTTGATGAGGACAGAGGGTGG + Intergenic
923109294 1:230878418-230878440 TCTTCCCTGGAGACAGAGGGAGG + Intergenic
924399881 1:243667772-243667794 ACTTCAGTGGGGTCAGTGGGAGG - Intronic
924495563 1:244585383-244585405 CCTGCAGTGGGCACAGAGGATGG - Intronic
1062814793 10:491531-491553 CCTGCACTGGGGACAGGGGCAGG + Intronic
1066233759 10:33465348-33465370 TCTTCAATGGGTAGTGAGGGGGG + Intergenic
1067521514 10:47010623-47010645 CCTACAGTGGGGAGAGAGGGAGG - Intergenic
1069822308 10:71235467-71235489 GCTGGGATGGGGACAGAGGGTGG + Intronic
1070219251 10:74423318-74423340 CCACCACTGGGGACAGAGGAAGG - Intronic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070956297 10:80465619-80465641 CCTACAGTGGGAACAGAGAGAGG + Intronic
1071531111 10:86390910-86390932 CCTTCACAGGGGACAGCGGCCGG - Intergenic
1074955687 10:118386648-118386670 TAATCAATGGGGACAGAGGAAGG - Intergenic
1075008288 10:118846153-118846175 CATTCCATGGGGAAAAAGGGAGG + Intergenic
1075747517 10:124737962-124737984 CCTTCAATCTGGAAAGAAGGTGG + Intronic
1075842544 10:125517404-125517426 CCTCCAATGGGGCCTGAGAGAGG - Intergenic
1076070001 10:127481832-127481854 CCTTCATGGGGTACAGAGAGTGG - Intergenic
1076641762 10:131921506-131921528 CCTGCAAAGGGGAGAGAGGGTGG + Intronic
1076943798 10:133629202-133629224 CCTTCCAGAGGGACAGAGTGAGG - Intergenic
1077390175 11:2297148-2297170 CCCTCACTGGGGACACAGGGGGG + Intronic
1078641758 11:13103448-13103470 ACTTCACTGGGGAAAGGGGGTGG - Intergenic
1079250788 11:18786012-18786034 GCTTCAATGGGGACAAAGGAAGG + Intronic
1079356347 11:19733089-19733111 CCTCCAATGGGAACAGAAGCAGG + Intronic
1080012005 11:27469562-27469584 CCTTCCCTGGGGACAGGGGTGGG - Intronic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1084184207 11:67463114-67463136 CCTTGAATGGGGGATGAGGGTGG + Exonic
1084553500 11:69862894-69862916 CCTTCTATGGGGGCAGAGGTGGG + Intergenic
1087773674 11:102238434-102238456 CCTGCAGTGGGGCCAGAGGTAGG - Intergenic
1089096979 11:115927422-115927444 CCTTCCATGGGGACAAAGAGGGG + Intergenic
1092077311 12:5684466-5684488 CCTTCTCTGGGGGCAGTGGGAGG + Intronic
1092194556 12:6541464-6541486 CCTTCCAGGGGGACACAGCGGGG - Intronic
1093618949 12:21264472-21264494 CCTTCAAAGGGGAGAAAGGCTGG - Intergenic
1095334894 12:41012481-41012503 CCATCAGTGGGGACAGAGGCTGG + Intronic
1096866408 12:54566246-54566268 GCTTCAGTGGGGACAGAGGCAGG + Intronic
1097324804 12:58264289-58264311 CCTGCAATGGCGACAGGGGTGGG - Intergenic
1098956636 12:76695558-76695580 ACTTCAGTGGGGCCAGATGGAGG + Intergenic
1100210655 12:92395224-92395246 TGTTCAATAGGGACAGAGGGAGG - Intergenic
1102170627 12:110839753-110839775 CCATCAAAGGGCACAGAGAGAGG + Intergenic
1102246994 12:111362230-111362252 CCTTCAGGGTGGACAGAGGGAGG - Exonic
1103080982 12:118023741-118023763 CCTTCTATGGGCAGGGAGGGCGG - Intronic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1107414286 13:40187051-40187073 CCTTACCTGGGGACAGAGAGAGG - Intergenic
1107414318 13:40187185-40187207 CCTTCATAGGGGCCAGTGGGTGG - Intergenic
1111759199 13:92440248-92440270 ACTACAATGGAGAGAGAGGGAGG - Intronic
1114188410 14:20421410-20421432 CCCTCAAAGGGGCCAGAGAGTGG + Intergenic
1114303829 14:21402721-21402743 AGTTCAATGGGGACACAGGTGGG + Intronic
1114938252 14:27572751-27572773 TATTCAGTGTGGACAGAGGGAGG + Intergenic
1117515053 14:56492462-56492484 CCTTGAAGGAGGCCAGAGGGGGG - Intronic
1118325842 14:64779849-64779871 CCTTCAATGGGAGAGGAGGGAGG - Exonic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118709874 14:68510341-68510363 CCTTCCCTGGAGACAGAGGCCGG - Intronic
1121021867 14:90585139-90585161 CCTTCAATGAGGCCAGAGCCTGG - Intronic
1121562554 14:94885903-94885925 CCAGAAATGGGGACACAGGGAGG + Intergenic
1122792675 14:104190931-104190953 CCTGCCCTGGGGGCAGAGGGTGG + Intergenic
1122891933 14:104736041-104736063 CATTCAATGTGAGCAGAGGGAGG + Intronic
1123933281 15:25182131-25182153 CCCTCCATGGGGGCAGAAGGTGG - Intergenic
1123936336 15:25195901-25195923 CCTTCATTGTGGACAGGTGGCGG + Intergenic
1125864923 15:43037439-43037461 CCTTCAATTAAGACAGATGGTGG + Intronic
1128719233 15:69934017-69934039 GATTCAATTGTGACAGAGGGTGG + Intergenic
1129107716 15:73320808-73320830 ACTTCAACAGGGAGAGAGGGAGG - Exonic
1129680381 15:77655514-77655536 CATCCACTGGGGACACAGGGAGG - Intronic
1131717692 15:95131285-95131307 CCTTCACTGTGGACACAGGAAGG - Intergenic
1132173788 15:99691184-99691206 CCTCCAACAGAGACAGAGGGAGG + Intronic
1132925539 16:2427469-2427491 CCTTCAGTGGAGGCAGAGAGGGG - Intergenic
1133406347 16:5527621-5527643 CCTCCAATGGGAAGACAGGGAGG - Intergenic
1134609077 16:15593407-15593429 CCAGCAATGGGGACAGCAGGTGG + Intronic
1134682383 16:16135315-16135337 CCATAAGTGGGGACAGATGGAGG - Intronic
1138199695 16:55079548-55079570 CCTCCAATGGGGACATAAGCTGG - Intergenic
1139700107 16:68703055-68703077 CCTCCAGTGGGGACAGAGATGGG + Intronic
1140042353 16:71416460-71416482 ACTTGAATGGGGACAGAGTATGG - Intergenic
1142617890 17:1147185-1147207 CCTCCAAGGGTCACAGAGGGAGG - Intronic
1142755532 17:2014393-2014415 CCTTGAATGGGGAGAGTGGGGGG - Intronic
1143253596 17:5539836-5539858 TCATCAATGTGGACAGAGTGAGG - Intronic
1144599755 17:16601289-16601311 TCTTCCATGGAGACAGAGAGAGG - Intergenic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1147615248 17:41823516-41823538 CATTCAATGGGGACAATTGGAGG - Intergenic
1150914377 17:69421984-69422006 CCATCAAAGGAGACAGAGTGGGG - Intronic
1151252211 17:72845001-72845023 CCTTCAATCGGGACCCAGGAAGG + Intronic
1152140795 17:78535195-78535217 CCTGCTTTGGGGACAGTGGGAGG + Intronic
1153653723 18:7263709-7263731 CCATGAATGGGGACAGAGTCCGG + Intergenic
1156204751 18:34873466-34873488 CCCTCAATGGAGACAGACGCTGG - Intronic
1156432252 18:37087961-37087983 CATACAATGGGGACAGATAGAGG + Intronic
1157204517 18:45687240-45687262 CCTGGAATGGGGGCAGAAGGTGG + Intergenic
1157680305 18:49600252-49600274 TGTTCAATGGGGGCAGAGGTGGG + Intergenic
1158248477 18:55459049-55459071 CTTTCACTGGGAACAGTGGGTGG + Intronic
1158760867 18:60385086-60385108 CCTTCACTGGAGAGAGAAGGTGG + Intergenic
1160548756 18:79679932-79679954 CCTCCATCGCGGACAGAGGGCGG - Exonic
1161135906 19:2619718-2619740 CCATCCATGGGGACAGGGAGGGG + Intronic
1161416540 19:4150247-4150269 CCCTGAATGGGGAAGGAGGGAGG + Intergenic
1161943217 19:7418778-7418800 GATTCAAGGGGGAGAGAGGGAGG + Intronic
1162819207 19:13212522-13212544 CCTGCATGGGGGACAGAGGCCGG + Exonic
1163223122 19:15935683-15935705 CCTTAGAGGGGGACAGAGGAGGG + Intergenic
1163578897 19:18126460-18126482 CTTTCAATGGGGACAGTGGCAGG - Intronic
1164591195 19:29508048-29508070 GCTCCAATGGGGAGAGAAGGTGG + Intergenic
1166317664 19:41998120-41998142 CCTTCTCTCAGGACAGAGGGAGG - Intergenic
1166328831 19:42067191-42067213 CCTTCCATGGGGACTGAGTGGGG - Intronic
1166837533 19:45676816-45676838 CATTCACTGGGGACACAGAGTGG + Intronic
1167518936 19:49940483-49940505 CCTCCAGTGGTGACAGAGGCAGG - Intronic
1168104992 19:54161079-54161101 CACTGAATGGGGAGAGAGGGAGG + Intronic
1168160502 19:54507554-54507576 CTTTCTAGAGGGACAGAGGGTGG - Intronic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
927745221 2:25613392-25613414 GCTAGAGTGGGGACAGAGGGAGG - Intronic
932327126 2:70870741-70870763 CCTTCACATGGGACAGAGAGTGG + Intergenic
934503842 2:94877323-94877345 CTGTCATTGGGGACAGAGAGGGG - Intergenic
937152325 2:119694587-119694609 CCTTCAAAGGGGCCAGGAGGAGG - Intergenic
937639768 2:124198563-124198585 CCTAGAGTGGGGAGAGAGGGAGG - Intronic
938646477 2:133336069-133336091 CCTTCAATCAGGACAGAGGGTGG + Intronic
939551063 2:143616623-143616645 CCTTGAATTACGACAGAGGGAGG - Intronic
940696464 2:156985240-156985262 CCTGTCAGGGGGACAGAGGGAGG - Intergenic
941754824 2:169173843-169173865 ACTTCCATGGGGACTGAGAGAGG - Intronic
942541272 2:177017767-177017789 CCATCCCTGGGGACAGAGGGTGG + Intergenic
945043583 2:205763051-205763073 CCTTCAAACAGAACAGAGGGTGG - Intronic
948421479 2:237863122-237863144 CCTCCACTGGGGACCCAGGGAGG + Intronic
948907837 2:240988218-240988240 CCTACAAGGAGGACAGACGGTGG + Intronic
1170264638 20:14451558-14451580 CCTTCAATGGACAGAGAGGCTGG + Intronic
1172186767 20:33035811-33035833 CCTCCCATCGGGACAGTGGGGGG - Intronic
1172307998 20:33895366-33895388 CCTTAAATGAAGACACAGGGTGG + Intergenic
1172888995 20:38250596-38250618 CCCTGTATGGAGACAGAGGGAGG + Intronic
1173245392 20:41334265-41334287 TCAACAATGTGGACAGAGGGAGG + Intergenic
1175050157 20:56147916-56147938 CCCTCAGTGGGGACGGAAGGGGG - Intergenic
1175137445 20:56835090-56835112 CCTTCATCTGGCACAGAGGGTGG - Intergenic
1179157527 21:38863163-38863185 CCCTCCATGTAGACAGAGGGGGG - Intergenic
1179924856 21:44528810-44528832 CTTTCAGAGTGGACAGAGGGTGG - Intronic
1181396859 22:22629116-22629138 CCTTCTATGGAGTCAGACGGTGG + Intergenic
1181499554 22:23308166-23308188 CCTTCTATGGAGTCAGACGGTGG + Intronic
1182058500 22:27379886-27379908 CATTAGATGGGGACCGAGGGAGG + Intergenic
1182351716 22:29703537-29703559 CCTTCCATGGGAAAAGAGGAGGG - Intergenic
1183608297 22:38879930-38879952 TCATCTATGGGGAGAGAGGGTGG - Intergenic
1183837445 22:40467247-40467269 CCTTCAATGGTTACAAAGAGGGG + Intronic
1185317953 22:50186730-50186752 CCTTCAATTGGAGCAGAGCGGGG + Intronic
949125025 3:436811-436833 GCTTTAATGGGGAAAGACGGAGG + Intergenic
949871858 3:8595912-8595934 ATTTTAATGGGGACAGATGGTGG + Intergenic
950524408 3:13515770-13515792 CCTACACTGGGGACAGCTGGGGG - Intergenic
950868001 3:16204819-16204841 CCTTCAAAGGGCAGAGTGGGAGG - Intronic
953877959 3:46677022-46677044 CCTGCGATGGGGATGGAGGGTGG + Exonic
954030197 3:47813758-47813780 CATTGAATGGGGCCAGAAGGAGG + Intronic
954937083 3:54336288-54336310 TCTTCCTTGGGCACAGAGGGAGG + Intronic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
955997180 3:64688817-64688839 CCATGAATGGTGACAGAGGTTGG - Intergenic
956793184 3:72695515-72695537 CCTTCAGGGTGGACAGATGGAGG - Intergenic
958015385 3:87934347-87934369 GTTGGAATGGGGACAGAGGGTGG - Intergenic
961206631 3:125087630-125087652 TATTGAAAGGGGACAGAGGGTGG + Intronic
962091481 3:132248670-132248692 CCTTCACTGTGGACAGAGCCTGG + Intronic
962333304 3:134500340-134500362 CCATCAATGGGTACATAGGTTGG + Intronic
963202302 3:142598018-142598040 ACTTCAATACGGAAAGAGGGAGG - Intronic
963637173 3:147812757-147812779 TGTTCATTAGGGACAGAGGGGGG + Intergenic
965402672 3:168231645-168231667 CCTTCAATAGGGATATATGGAGG - Intergenic
965477339 3:169173385-169173407 CCAGCATTGGGGAGAGAGGGAGG - Intronic
968394123 4:217586-217608 CCTTCAAAGGTTACAGAGGCTGG - Intergenic
968411216 4:392168-392190 CCTTCAAAGGTTACAGAGGCTGG - Intergenic
969388322 4:6871812-6871834 CATGCACTGGGGACACAGGGAGG + Intronic
969472737 4:7399248-7399270 CCTCAAATGCAGACAGAGGGTGG - Intronic
979303372 4:119113210-119113232 CTCTCAGTGGGGACAGTGGGGGG + Intergenic
981078113 4:140611001-140611023 CCATCAACTGAGACAGAGGGTGG + Intergenic
981134224 4:141191782-141191804 CCTTCAATGGGCACAAAGCCAGG - Intronic
985447153 4:190029664-190029686 CCTTCCAGAGGGACAGAGTGAGG - Intergenic
985789078 5:1915763-1915785 CATTCAGTGGGGGCAGAGTGGGG + Intergenic
988109576 5:26800794-26800816 CCTTCAATGGACATGGAGGGTGG - Intergenic
990485895 5:56258838-56258860 CATGCAAAGGGGAGAGAGGGAGG + Intergenic
992636282 5:78728642-78728664 CAGTCACTGGGGACAGAGGAGGG - Intronic
993582164 5:89676720-89676742 CCTTTCATGGGGACTGATGGTGG - Intergenic
993849654 5:92990906-92990928 CTCTCAATGGGGACAAAGGGAGG + Intergenic
994636007 5:102344914-102344936 CCTTCAAAGCTGACAGAAGGAGG + Intergenic
996507670 5:124286551-124286573 TCTTCAATGGGGAGAGAGAAAGG + Intergenic
997242282 5:132316115-132316137 CCTTCCTTAGGGCCAGAGGGTGG - Intronic
998919694 5:147054525-147054547 CCTTGAATTGAGACTGAGGGTGG - Intronic
1001199060 5:169699432-169699454 CCTCCAAGGGGGACAGTGGAGGG + Exonic
1001400295 5:171442364-171442386 CCTTCAGTGGGGAAGGAGGGAGG + Intronic
1003208842 6:4040762-4040784 CTTTAAATAGGGACAGAGGTCGG + Exonic
1003521750 6:6863920-6863942 TCTTCAATGGGGAAGGAGTGTGG - Intergenic
1004597606 6:17115144-17115166 ACGTGAATGGGGGCAGAGGGAGG - Intronic
1007234423 6:40380023-40380045 CCTTCAAAGGGGGAAGTGGGAGG - Intergenic
1009853809 6:69233268-69233290 CCTGCAAAGGGGAGTGAGGGGGG - Exonic
1013274579 6:108571966-108571988 CCTGCAGTGAGGACAGAGGGAGG + Intronic
1017333213 6:153223899-153223921 CCTTGAATGAGGTCATAGGGTGG + Intergenic
1018934935 6:168267799-168267821 CTGTCAGAGGGGACAGAGGGAGG - Intergenic
1020430673 7:8113493-8113515 CCTCCAAGGGGGACAGAGGCTGG + Exonic
1020740792 7:12014618-12014640 CCTTCCAGTGGGACAGAGTGTGG - Intergenic
1022466474 7:30655882-30655904 CCCACAATGGGGACAGGAGGAGG - Intronic
1022502490 7:30891531-30891553 GAAACAATGGGGACAGAGGGTGG - Intronic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1023852753 7:44159322-44159344 CCTGCCATGGGGTCAGAGGCAGG + Intronic
1024328332 7:48131425-48131447 CCCTGAATGGGCACAGAGAGTGG - Intergenic
1025943143 7:66087920-66087942 CCTTAAATGGGTAAAGTGGGTGG + Intronic
1026121931 7:67545318-67545340 CCTTCAGTGGTGGAAGAGGGAGG + Intergenic
1026841315 7:73671277-73671299 CCTTCAGTGGGGGCACTGGGCGG - Exonic
1027173820 7:75890733-75890755 CCTTCCATGGAAAGAGAGGGGGG + Intergenic
1028671657 7:93407642-93407664 GCTTTAATGGGGACAGTTGGAGG + Intergenic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1032079906 7:128853693-128853715 CCTGAAGTGGGGACAAAGGGTGG - Exonic
1033308172 7:140239868-140239890 CTATGAATGGGGACAGAAGGAGG + Intergenic
1034220954 7:149445783-149445805 CCTGCAGTAGGGACTGAGGGAGG + Intronic
1034391346 7:150790027-150790049 TCTTTACTGGGGACTGAGGGAGG + Intergenic
1035250251 7:157592636-157592658 CCTTCACACAGGACAGAGGGTGG + Intronic
1035496236 7:159329218-159329240 TCATCACTGGGGACACAGGGAGG + Intergenic
1035994885 8:4534583-4534605 ACTAGAATGGGGAAAGAGGGAGG - Intronic
1037513167 8:19604025-19604047 CCTTCACTGGAAAAAGAGGGAGG - Intronic
1037856365 8:22374163-22374185 CCCTCAATGGTGACAGCAGGTGG + Intronic
1039971327 8:42323936-42323958 CCTTCAAGGGGCACAGACAGAGG + Intronic
1040434953 8:47381177-47381199 GGTACAATGGGTACAGAGGGAGG - Intronic
1041178693 8:55225543-55225565 CCTCCTATGGAGACAGATGGTGG + Intronic
1041219441 8:55634030-55634052 CATTCCATGGGGCCAAAGGGAGG - Intergenic
1041313838 8:56541732-56541754 CTTTCTCTGGGGACAGAGGGAGG + Intergenic
1041629042 8:60064130-60064152 ACTTCCATGTGGACAGGGGGTGG + Intergenic
1043027823 8:75093138-75093160 CTGTCAAGGGGGACACAGGGAGG - Intergenic
1043158336 8:76814956-76814978 CCTGTAATGGAGAAAGAGGGTGG + Intronic
1048780235 8:137991499-137991521 ACTTCAGTGGGGCCAGATGGAGG - Intergenic
1049581289 8:143412307-143412329 CCCTTAATGGGGACAAGGGGTGG + Intergenic
1057171250 9:92964680-92964702 CCTTCGATGGGGACACGGGCAGG - Intronic
1059956597 9:119522421-119522443 ACTTCAATGGGGAGAGAAGCAGG - Intronic
1060416204 9:123432491-123432513 CCTACAGTGGGCACAGAGGCCGG + Intronic
1060719083 9:125962272-125962294 ACTTCCATGGGGTCAGAGGAAGG - Intronic
1060901795 9:127264427-127264449 AATTAAAGGGGGACAGAGGGTGG + Intronic
1062299730 9:135858922-135858944 CCTTCAATGTGGGCAGAAGAGGG - Intronic
1062573997 9:137198149-137198171 CCTTTCCTGGGGACTGAGGGGGG - Intronic
1203745382 Un_GL000218v1:38269-38291 CTGTCATTGGGGACAGAGAGGGG + Intergenic
1203564726 Un_KI270744v1:81215-81237 CTGTCATTGGGGACAGAGAGGGG - Intergenic
1186139201 X:6553280-6553302 CCTAGAACGGGGAGAGAGGGAGG + Intergenic
1186750343 X:12615084-12615106 CCTTCAATGTTAACAGAGAGTGG - Intronic
1186855998 X:13626575-13626597 CCTTAAATGGGTCCAGAGTGTGG - Intronic
1187473659 X:19590600-19590622 TCCTCCATGAGGACAGAGGGTGG + Intronic
1188762010 X:34044004-34044026 CTTTCAAGGGAGGCAGAGGGAGG + Intergenic
1189104282 X:38220607-38220629 CCTTCGCTCGGGATAGAGGGAGG - Intronic
1189196458 X:39157825-39157847 TCTTTGATGGGGGCAGAGGGAGG - Intergenic
1189444537 X:41068241-41068263 GCTTGAAGGTGGACAGAGGGAGG - Intergenic
1193364508 X:80615551-80615573 CCTGTCAGGGGGACAGAGGGAGG - Intergenic
1193364641 X:80617323-80617345 CCTGTCAGGGGGACAGAGGGAGG - Intergenic
1194642033 X:96413673-96413695 CCATCAAAGGGGACGGAGGGGGG + Intergenic
1195248261 X:103016936-103016958 CCTTCAATTCAGACAGAGGCTGG + Intergenic
1198691946 X:139293933-139293955 CCTTCACTGGGCACTGAGGTTGG + Intergenic
1198879429 X:141263418-141263440 CCAGTAATAGGGACAGAGGGCGG - Intergenic
1200133441 X:153863544-153863566 CCTTCACTGGAGACACAGAGAGG + Exonic
1202296313 Y:23361310-23361332 CCTCCAATGGGGGAAAAGGGTGG - Intergenic
1202574494 Y:26309286-26309308 CCTCCAATGGGGGAAAAGGGTGG + Intergenic