ID: 955353498

View in Genome Browser
Species Human (GRCh38)
Location 3:58211210-58211232
Sequence CAGCTCTGACATCTAGTCAT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955353490_955353498 11 Left 955353490 3:58211176-58211198 CCTCCACAAAGTCACTCATATCC 0: 1
1: 0
2: 1
3: 14
4: 194
Right 955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG 0: 1
1: 0
2: 0
3: 3
4: 131
955353491_955353498 8 Left 955353491 3:58211179-58211201 CCACAAAGTCACTCATATCCCAA 0: 1
1: 0
2: 1
3: 18
4: 212
Right 955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG 0: 1
1: 0
2: 0
3: 3
4: 131
955353488_955353498 28 Left 955353488 3:58211159-58211181 CCTCATTTAGGCGCCATCCTCCA 0: 1
1: 0
2: 1
3: 5
4: 73
Right 955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG 0: 1
1: 0
2: 0
3: 3
4: 131
955353494_955353498 -10 Left 955353494 3:58211197-58211219 CCCAACCGGGAGCCAGCTCTGAC 0: 1
1: 0
2: 1
3: 6
4: 94
Right 955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG 0: 1
1: 0
2: 0
3: 3
4: 131
955353489_955353498 15 Left 955353489 3:58211172-58211194 CCATCCTCCACAAAGTCACTCAT 0: 1
1: 0
2: 3
3: 31
4: 286
Right 955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG 0: 1
1: 0
2: 0
3: 3
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955353498 Original CRISPR CAGCTCTGACATCTAGTCAT CGG Exonic
909488608 1:76201539-76201561 CATCAGTGACATCTAGCCATAGG - Intronic
912405511 1:109434367-109434389 CATCTCTGAAATCTAGGCAGAGG + Intergenic
921382448 1:214538322-214538344 CAGCTCTCACAGCTAGTAAGTGG - Intronic
921819888 1:219605091-219605113 GATATCTGATATCTAGTCATAGG + Intergenic
922882329 1:228990380-228990402 CAGCTCTGACATCAAAGCAGTGG - Intergenic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1062993531 10:1843331-1843353 CAGCTCCCACATCCAGTCAATGG - Intergenic
1065403885 10:25340591-25340613 CCGCTCTTACATCTAAACATGGG - Intronic
1070499428 10:77056599-77056621 CATCTGTGTCATCTAGGCATTGG - Intronic
1070792133 10:79195769-79195791 AAGCTCTGACTGCCAGTCATGGG + Intronic
1071108628 10:82128087-82128109 CAGGTCTGCTGTCTAGTCATTGG + Intronic
1071338214 10:84619197-84619219 CAGCTCTAGCATCTGGTTATGGG - Intergenic
1072951390 10:99849489-99849511 CAGGTCTGAAATCAAGGCATTGG - Intronic
1076386646 10:130061967-130061989 CAGCTGTGACAGCAAGTCAGGGG + Intergenic
1079769733 11:24444443-24444465 CATCTCTGAAATCTAGGCAGAGG - Intergenic
1081254218 11:40872116-40872138 GAGATCTGACAACTAGGCATCGG + Intronic
1083699475 11:64466182-64466204 CTGGGCTGGCATCTAGTCATAGG - Intergenic
1084724393 11:70931480-70931502 CAGCTCTGACTTGTGGTCAAGGG - Intronic
1085244605 11:75089746-75089768 CAGCTGGAACATCTAGACATTGG + Exonic
1086606228 11:88699849-88699871 CTCCTCTGACATCGAGTCATAGG - Intronic
1090925900 11:131250205-131250227 CAGGTCTAACAGCCAGTCATGGG + Intergenic
1095395593 12:41758728-41758750 TAGCTTTGACTTATAGTCATAGG - Intergenic
1095518144 12:43029696-43029718 CTGCTCTGACTTTTACTCATGGG - Intergenic
1095946187 12:47754929-47754951 CAGCTCTGACATTCAGTGACAGG - Intronic
1096485027 12:51974249-51974271 TAGCTCTGACCTCTTGGCATGGG - Intronic
1096878880 12:54651281-54651303 AAGCTCTGTCATCTAATCGTAGG - Intergenic
1098444880 12:70556224-70556246 TAGCTCTGAGATCTAGGTATAGG + Intronic
1099633976 12:85188883-85188905 CAACTCTGAGAGCGAGTCATAGG + Intronic
1101083766 12:101214772-101214794 CATCTCTGAAATCTAGGCAGAGG - Intergenic
1107573848 13:41695569-41695591 CAGGTCTGACATCTTGACAGAGG + Intronic
1108248856 13:48544911-48544933 CTGCTCTGAAATCTAGTTAGAGG + Intergenic
1111398070 13:87693852-87693874 AAGCTCTGATATCTAGTAGTTGG - Exonic
1113538272 13:111085008-111085030 CATCACTGACATCAAGACATAGG + Intergenic
1119174316 14:72557949-72557971 CAGCTATGACATCTATGCCTTGG - Intronic
1122333536 14:100947611-100947633 CAACCCTGACATCTCTTCATAGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131722734 15:95188253-95188275 CTCCTCTGAAATCTAGTCAGAGG - Intergenic
1133882171 16:9792686-9792708 CATCCCTGACATCTAGTCTGAGG - Intronic
1139667425 16:68467484-68467506 CTCCTCTGACCTCTTGTCATCGG + Intergenic
1143792703 17:9310760-9310782 CAGCTCTAACATCGAGACCTTGG - Intronic
1146725828 17:35155096-35155118 CAGCTCTGACCTCCAGAGATGGG + Intronic
1155070665 18:22313194-22313216 CAGCTCTGAGCTGTAATCATTGG + Intergenic
1156670195 18:39459400-39459422 CAGCTCTGCCACCTAGTAACTGG + Intergenic
1157132001 18:45015849-45015871 GAGATTTGACATTTAGTCATGGG + Intronic
1158258252 18:55578077-55578099 CAGCCCTGATATTTAATCATGGG + Intronic
1159134562 18:64321933-64321955 CAAGACTGACACCTAGTCATTGG - Intergenic
1161243586 19:3236456-3236478 CAGTTCTGTAATCTAGTGATTGG - Intronic
1167096448 19:47377230-47377252 CAGCTCTCATATCTGGGCATGGG - Intronic
1167168714 19:47817040-47817062 CAGCTCTGAGAACTAGCCTTGGG - Intronic
1168390525 19:56003566-56003588 CAGCACTGATGTCTAGTAATAGG + Intronic
925171835 2:1754799-1754821 CAGCTCTGCCATGTGGTCTTTGG + Intergenic
925219023 2:2122893-2122915 CAGTTCTGTCTTCTACTCATTGG - Intronic
927040299 2:19223281-19223303 CAGCTCACACATCTAGTTATTGG + Intergenic
927227871 2:20787633-20787655 CAGCTCTGACATGTAGAACTTGG - Intronic
933545008 2:83698388-83698410 CAGATCTGACATCTGGTGAGGGG - Intergenic
936892951 2:117393348-117393370 CACCTCTGAAAGCTAGGCATGGG + Intergenic
940766250 2:157792528-157792550 CAGCTCTGACACCTGACCATAGG - Intronic
941892298 2:170595068-170595090 TGGCTCTGACATCGAGCCATGGG + Intronic
943143949 2:184018392-184018414 AACCTCTGAAATCTAGTCAGAGG - Intergenic
945869830 2:215215050-215215072 GAGCACTGAGATCAAGTCATAGG + Intergenic
945977990 2:216285475-216285497 CAGCCCTAACATCTAGTAAAGGG + Intronic
947469965 2:230392235-230392257 CAGGTCTGGCCTCTTGTCATTGG - Intronic
1168870663 20:1125505-1125527 CAGTTCTGACTTCTTATCATTGG - Exonic
1169853371 20:10077419-10077441 CAGCTATGACATCAACCCATAGG + Intergenic
1175005876 20:55682534-55682556 CAGATCTGACTTCAAGTCACAGG - Intergenic
1175720108 20:61280686-61280708 AGGCCCTGACATCTAGTGATGGG + Intronic
1177216201 21:18132361-18132383 CAGATATGACATCTAGATATGGG + Intronic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1181313321 22:21957132-21957154 CAGGGCTGACATCTTGTCCTTGG + Exonic
1181346426 22:22223204-22223226 CAGGGCTGACATCTTGTCCTTGG + Intergenic
1182259992 22:29067018-29067040 TGGCTCAGACAACTAGTCATGGG - Intergenic
952877496 3:37958916-37958938 CAGCTCTGGAATCAAGTCTTGGG + Intronic
954001778 3:47563282-47563304 CATCTTTGACCTCTAGTCAGCGG - Intronic
955353498 3:58211210-58211232 CAGCTCTGACATCTAGTCATCGG + Exonic
957878019 3:86174500-86174522 AAGCTCAGACATCTAGACCTTGG + Intergenic
958113848 3:89188783-89188805 CAGCTCTGATAAATTGTCATGGG - Intronic
959709219 3:109368160-109368182 AAACTCTGTCATCTAGTCCTGGG + Intergenic
959913311 3:111789489-111789511 CTGCTCTGACATATATACATGGG + Intronic
964954442 3:162334957-162334979 CACCTCTGAAATCTAGGCAGTGG - Intergenic
965351762 3:167620984-167621006 CAGCTCTGAAACCTAGATATTGG - Intronic
965520816 3:169666737-169666759 CAGCTCAGACATCCCGTCAGAGG - Intergenic
966514575 3:180804203-180804225 TAGCTCTGCCATTTACTCATAGG + Intronic
967633155 3:191770657-191770679 CAGCTCTCACACATTGTCATGGG - Intergenic
969984074 4:11188922-11188944 CAGGTCAGACATCTATTTATTGG - Intergenic
977169274 4:93740334-93740356 GAGCTCTGAAATACAGTCATGGG - Intronic
981136726 4:141219582-141219604 CACCTATGACATTTAGTCACTGG - Intergenic
983298033 4:165890956-165890978 CATCTCTGAAATCTAGGCAGAGG + Intronic
984089911 4:175360183-175360205 TTTCTCTGACATCTAGTTATTGG + Intergenic
987859411 5:23465395-23465417 CAACTCTGACATCTGCTAATAGG - Intergenic
993834311 5:92797936-92797958 CATTTCTGTCATCTTGTCATGGG + Intergenic
1000876055 5:166639382-166639404 AAGGTCTGACATTTTGTCATTGG + Intergenic
1002948484 6:1785498-1785520 CAGCACTGACCTCCAGACATAGG - Intronic
1003115278 6:3279750-3279772 CAGCTCTGACTTCTAAACACGGG - Intronic
1003345898 6:5266334-5266356 CAGCTCTTCCATCAGGTCATGGG - Intronic
1008206577 6:48667211-48667233 CAGTTCTGACTTCTGGTTATGGG + Intergenic
1008267164 6:49442482-49442504 CATCTGTAACATCTAGTCAGAGG + Intronic
1008355423 6:50547153-50547175 CACCTCTGGCCTCTACTCATTGG - Intergenic
1008429820 6:51402719-51402741 TAGCTCTAACTTCTACTCATAGG - Intergenic
1008983761 6:57517766-57517788 CAGCTCTCACATCTACTGGTGGG + Intronic
1009171820 6:60410675-60410697 CAGCTCTCACATCTACTGGTGGG + Intergenic
1009565751 6:65309496-65309518 GATATCTGATATCTAGTCATAGG - Intronic
1015273983 6:131365653-131365675 CTGCTCTGGCATCTATTCAAGGG + Intergenic
1015283691 6:131460818-131460840 CAGCTCTCACATCTGGGCACGGG + Intergenic
1016584728 6:145671627-145671649 CAGCTCTCTCATTTACTCATGGG - Intronic
1017050636 6:150390545-150390567 CAGCTGTGACTTCTAGTGTTGGG + Intronic
1022612814 7:31894353-31894375 CAGCTGTGACACCTAATTATGGG + Intronic
1023243270 7:38172709-38172731 TAGCTCTGATATTTAGTCTTTGG + Intergenic
1023680430 7:42680995-42681017 CAGGTCTTACATCTAGTCCTTGG - Intergenic
1024337472 7:48224161-48224183 GAGCTCAGACATCTGGTCACAGG + Intronic
1028323774 7:89496497-89496519 GAGCTCTTGCATCTAGGCATGGG + Intergenic
1028493319 7:91438307-91438329 AAACTCTGACATTTAGTGATGGG + Intergenic
1030039751 7:105439119-105439141 GAGCTCTGACATTCACTCATAGG + Intergenic
1030729071 7:112962979-112963001 CAACACTGGCATCCAGTCATAGG - Intergenic
1032713670 7:134485760-134485782 CAGCTCTGACTACAAGTCAATGG + Intergenic
1035549472 8:509394-509416 CATCTCTGAAATCTAGCCAGAGG + Intronic
1036468612 8:9028482-9028504 CAGCTCTAATATTTACTCATAGG - Intronic
1044949675 8:97423422-97423444 CAGCTCTGATATCAAGCCCTGGG + Intergenic
1045583746 8:103506884-103506906 TAGCACTGACATCAAGTTATTGG + Intronic
1047501111 8:125442224-125442246 CAGCACCAACATCTAGTCAATGG - Intergenic
1048486123 8:134849190-134849212 CAGCCCTGAAATCTGGCCATGGG + Intergenic
1049147874 8:141014948-141014970 CAGCTCTGACATCATCTCACCGG - Intergenic
1050382660 9:5046530-5046552 TAGCTCTTACATTTAGGCATTGG + Intronic
1050953563 9:11627407-11627429 CACCTCTGAAATCTAGACAGAGG - Intergenic
1052435529 9:28423274-28423296 CTGTTCTGACATGTAGTCTTAGG - Intronic
1053168293 9:35860049-35860071 CAGCTCAGACATCAGGTCACTGG - Intergenic
1055614074 9:78053213-78053235 CAGCTATGCCATCCATTCATAGG + Intergenic
1060819848 9:126654977-126654999 CAGCTGTGACACCCAGTCCTGGG + Intronic
1062300709 9:135866632-135866654 CACCTCTGACTCCTAGACATAGG + Intronic
1186440710 X:9584058-9584080 CACCTCTGACCTCTACTAATGGG - Intronic
1190480483 X:50871962-50871984 CAGCTCTCACACCTAGTCTGAGG + Intergenic
1191784014 X:64897796-64897818 ATCCTCTGACATCTAGGCATAGG + Intergenic
1198770854 X:140128597-140128619 CAGCTATGAGACCTAGTCTTTGG - Intergenic
1198817536 X:140608548-140608570 AACCTCTGAAATCTAGTCACAGG - Intergenic
1199638621 X:149837803-149837825 CAAGCCTGACACCTAGTCATAGG + Intergenic