ID: 955354935

View in Genome Browser
Species Human (GRCh38)
Location 3:58223424-58223446
Sequence ATTCAACTCTGGGCCCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955354935_955354940 -1 Left 955354935 3:58223424-58223446 CCCTTGAGGGCCCAGAGTTGAAT No data
Right 955354940 3:58223446-58223468 TAATTAGTTGGACTTACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955354935 Original CRISPR ATTCAACTCTGGGCCCTCAA GGG (reversed) Intergenic
No off target data available for this crispr