ID: 955358710

View in Genome Browser
Species Human (GRCh38)
Location 3:58253745-58253767
Sequence GGCCAATGATTTCAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955358709_955358710 -8 Left 955358709 3:58253730-58253752 CCAGAAGGAGAAGCAGGCCAATG 0: 1
1: 0
2: 4
3: 27
4: 264
Right 955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 101
955358703_955358710 16 Left 955358703 3:58253706-58253728 CCCTACCCTCAAGGAGCTCTGGT 0: 1
1: 0
2: 3
3: 45
4: 438
Right 955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 101
955358706_955358710 10 Left 955358706 3:58253712-58253734 CCTCAAGGAGCTCTGGTTCCAGA 0: 1
1: 0
2: 2
3: 24
4: 262
Right 955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 101
955358705_955358710 11 Left 955358705 3:58253711-58253733 CCCTCAAGGAGCTCTGGTTCCAG 0: 1
1: 1
2: 3
3: 38
4: 332
Right 955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 101
955358704_955358710 15 Left 955358704 3:58253707-58253729 CCTACCCTCAAGGAGCTCTGGTT 0: 1
1: 0
2: 6
3: 47
4: 384
Right 955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955358710 Original CRISPR GGCCAATGATTTCAGTGTGC TGG Intronic
900861814 1:5239086-5239108 GGACAATAATGGCAGTGTGCTGG + Intergenic
902819232 1:18933383-18933405 AACCAATGTTTTCAGTGTGATGG - Intronic
907006930 1:50923689-50923711 TGCCATTGATTTCAGTTTGCTGG - Intronic
907736420 1:57116961-57116983 GGACAATGTTTGCAGAGTGCCGG - Intronic
909039402 1:70630938-70630960 ACTCAATGAGTTCAGTGTGCAGG + Intergenic
909753988 1:79200328-79200350 AGGCAATGTTTTCAGTGTCCAGG + Intergenic
911123256 1:94316685-94316707 GGCAAATGATTTCATCTTGCTGG - Intergenic
917437214 1:175033708-175033730 GGCCACTGGCTACAGTGTGCAGG + Intergenic
921545045 1:216464557-216464579 GGCCAATGATTAAAGAGTACGGG + Intergenic
921550940 1:216534959-216534981 GGTCCATCATTTCAGTTTGCAGG - Intronic
1063951770 10:11229907-11229929 CCCAAATGATTCCAGTGTGCAGG + Intronic
1078051938 11:7973100-7973122 GATCAATGAGTTCAGTGTGATGG - Intronic
1088781064 11:113134725-113134747 GGACAATCATTCCAGTGTGAGGG - Intronic
1089095046 11:115913079-115913101 GGCAGAGGATTTCAGTCTGCTGG + Intergenic
1092997906 12:13967753-13967775 GGCCAGTGATTCCAGTCTGTGGG + Intronic
1093821532 12:23625035-23625057 AGCAAATGTTTTAAGTGTGCAGG + Intronic
1094824908 12:34262446-34262468 AGCCAAAGATTGCAGTGAGCTGG + Intergenic
1097069793 12:56346547-56346569 GGCGGATGATTTCAGTCAGCGGG + Exonic
1099710655 12:86220261-86220283 GGACAATGATTTCATGGTGGAGG - Intronic
1120005871 14:79357446-79357468 GGCCAATCATTTAAGTTTTCTGG + Intronic
1121419176 14:93800369-93800391 GCCCGATGCTTTCAGTGTCCTGG + Intergenic
1127716800 15:61656089-61656111 GGCCAATGACGTCTGTGTTCTGG + Intergenic
1128333167 15:66769550-66769572 GGCCAAGGATTTGAGGGAGCTGG + Intronic
1128441723 15:67715878-67715900 GGCAAATGATTTCACTGTTGAGG - Intronic
1128636460 15:69305558-69305580 GGCCACTGACCTTAGTGTGCGGG - Intronic
1131058367 15:89389820-89389842 GGACAATGAGCTCATTGTGCAGG - Intergenic
1131197221 15:90365255-90365277 GGGCAAGGATCTCATTGTGCTGG + Intronic
1134201984 16:12206842-12206864 CCCAAATGATTCCAGTGTGCAGG + Intronic
1137274098 16:46922278-46922300 GGCCCTTGATCTCAGGGTGCAGG - Exonic
1140276260 16:73511706-73511728 GGCCAAGGATTTCACTTTGAGGG + Intergenic
1141357251 16:83358985-83359007 TGCCATTTATGTCAGTGTGCTGG + Intronic
1144484246 17:15651752-15651774 GGCCACTCATTACTGTGTGCTGG + Exonic
1147771140 17:42868352-42868374 GGCCTATGAAGTCAGTGTCCAGG + Intergenic
1149585447 17:57783194-57783216 GGCCCATGGTTTCAGGGTGTTGG - Intergenic
1150013387 17:61528101-61528123 GGCCAATGATTTTAATGTAAAGG - Intergenic
1153005443 18:494569-494591 ATCCAATCATTTCTGTGTGCTGG - Intronic
1153561631 18:6376903-6376925 ACACAATGATTTCAGTGTGAGGG - Intronic
1154162435 18:11990259-11990281 GGCCAGTCACTGCAGTGTGCAGG + Intronic
1155129131 18:22912599-22912621 GGCCAAAGATTTCTATCTGCAGG - Intronic
1156263029 18:35462285-35462307 GGCCAATGAAATCAGTTTTCTGG + Intronic
1162477969 19:10912282-10912304 GGCCACTGACCTCAGCGTGCTGG - Exonic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1165992449 19:39824403-39824425 GGCCAGTGATGTCCGCGTGCTGG + Intergenic
1167925680 19:52819505-52819527 TGCCAATCATTTCAGTGGCCAGG + Intronic
925800677 2:7597251-7597273 GTCCTATGATTTGAATGTGCTGG + Intergenic
926146474 2:10399641-10399663 GGCCAATGGTGTGAATGTGCTGG - Intronic
933874912 2:86609764-86609786 GGCAGCTGACTTCAGTGTGCTGG - Intronic
940134400 2:150419938-150419960 GGAGAATGATTTCAGTGAGATGG - Intergenic
940274933 2:151929476-151929498 GGCTAATGATTTCAAACTGCAGG - Intronic
945631271 2:212280696-212280718 TGCCAATGATTTCATTATTCTGG - Intronic
946039683 2:216773051-216773073 TGACCATGATTTCTGTGTGCTGG + Intergenic
947560548 2:231146329-231146351 GACAAGTGATTTCAGTCTGCTGG - Exonic
947917613 2:233844276-233844298 TGGCTCTGATTTCAGTGTGCAGG - Exonic
1169674511 20:8138454-8138476 GACCAATGATTTCAGTTACCAGG - Intronic
1173673488 20:44814010-44814032 GGTAAATGATTTAAGTGTACAGG - Intergenic
1174946462 20:54991647-54991669 GGAAAATGGTTTCAGTGGGCTGG - Intergenic
1177282695 21:19004219-19004241 GGCCAATGATCTGAATGAGCTGG + Intergenic
1184600429 22:45540139-45540161 GGCCACTGATTTAAGGGAGCTGG + Intronic
1184755495 22:46513579-46513601 GGCCAATTATAACAGTGTACAGG - Intronic
952745147 3:36770027-36770049 GGCTAATGATTTAAGTGGCCTGG - Intergenic
955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG + Intronic
961150419 3:124632903-124632925 GGCAAATGGTTTCTGTCTGCTGG - Intronic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
970412670 4:15824719-15824741 CATCAATGATTTCTGTGTGCAGG - Intronic
973020840 4:45204704-45204726 TGCCGTTGAATTCAGTGTGCTGG + Intergenic
975395735 4:73870946-73870968 GGCCAATGAGATCATTGTGAAGG + Exonic
976258613 4:83124794-83124816 GGAGAATGATTCCAATGTGCAGG + Intronic
984386422 4:179065538-179065560 GGCAAATGGTAGCAGTGTGCAGG + Intergenic
984509532 4:180661646-180661668 TGCCAACGTTTTCAGTGTGGAGG - Intergenic
985220093 4:187695382-187695404 GGCCCATGTTTTCACTGGGCCGG - Intergenic
995744554 5:115390245-115390267 TGCCAATGACATCATTGTGCTGG - Intergenic
996170631 5:120286283-120286305 GGCTAATCATTTCAATGTTCAGG + Intergenic
999698162 5:154204379-154204401 GGACTATGATTTCAGGGTGGAGG - Intronic
999815087 5:155168033-155168055 GGACAATGACTTCAGAGAGCAGG + Intergenic
1000555975 5:162726514-162726536 GTCGAATGATTTCAATGTGTAGG + Intergenic
1001591622 5:172869385-172869407 GGCTAGCGACTTCAGTGTGCTGG - Intronic
1003387786 6:5685050-5685072 GGCTCATGATATCAGTGTGTGGG + Intronic
1003505520 6:6737213-6737235 AGCAAATGCTTTCAGTGTGATGG - Intergenic
1014341554 6:120214044-120214066 GGCAAATGTTTTTGGTGTGCTGG - Intergenic
1018630726 6:165819662-165819684 TGCCAAGGCTGTCAGTGTGCTGG + Intronic
1023595347 7:41823532-41823554 GACCAATGATTTCAGTGGTGTGG + Intergenic
1024101457 7:46036705-46036727 GAACAATGAATTCAGTGTGGTGG - Intergenic
1025119557 7:56289033-56289055 TGCCAAGGATTACAGTCTGCTGG + Intergenic
1026625321 7:71987144-71987166 GGCCTGTGACTTCAGTGTGGAGG - Intronic
1028079798 7:86561278-86561300 AGCAAAAGAGTTCAGTGTGCAGG - Intergenic
1032011476 7:128350773-128350795 GGGGAAGGATTACAGTGTGCAGG + Exonic
1033408499 7:141093858-141093880 GGTCATTGATTTCAGTGTTGGGG + Intronic
1034934815 7:155192011-155192033 TGCAAATGATTTCAGTCTGGTGG + Intergenic
1039470432 8:37809983-37810005 GGGCACTGGTGTCAGTGTGCAGG - Intronic
1040685086 8:49862021-49862043 GGCCAGTGTTTTCAGACTGCTGG - Intergenic
1041367567 8:57124875-57124897 GTTGAATGATTTCTGTGTGCTGG - Intergenic
1041550540 8:59095794-59095816 AGCCAATGATTTAAGTGTTTAGG + Intronic
1042271409 8:66960448-66960470 GGCCAAATATTTCAGGGTGGTGG + Intronic
1044191758 8:89327270-89327292 GGCATATGTTATCAGTGTGCTGG - Intergenic
1046816829 8:118594267-118594289 GCCAAATGTTTTCAGTGTGAAGG + Intronic
1047531420 8:125680340-125680362 GTCCAAAGACTTCAGTGTGGAGG + Intergenic
1052876533 9:33571582-33571604 GGAGAATCGTTTCAGTGTGCTGG - Intronic
1053499471 9:38572771-38572793 GGAGAATCGTTTCAGTGTGCTGG + Intronic
1055069006 9:72147780-72147802 AGGGAATGTTTTCAGTGTGCTGG + Intronic
1057694877 9:97316128-97316150 AGTCAAGGATTTCAGTGTCCCGG + Intronic
1058142414 9:101371230-101371252 GGCCAATGAATTCGGTGAGGTGG - Exonic
1059530698 9:115032840-115032862 GGTCATTGGTTTCAGTTTGCAGG + Intronic
1194916057 X:99710442-99710464 TGCCAATGATTACATTGTTCTGG + Intergenic
1195780602 X:108459010-108459032 CAGCAATGTTTTCAGTGTGCAGG + Intronic