ID: 955359282

View in Genome Browser
Species Human (GRCh38)
Location 3:58259026-58259048
Sequence CCTTGACGAGGCCATGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955359282 Original CRISPR CCTTGACGAGGCCATGAGAA GGG (reversed) Intronic
900771891 1:4552016-4552038 CTTTGACAATGCCACGAGAAAGG + Intergenic
901617649 1:10554475-10554497 CCTTGAAGAGGCAGGGAGAAGGG + Intronic
906528461 1:46509980-46510002 CCTTGACTAGACCTTGAGATGGG + Intronic
908030583 1:59995049-59995071 TAGTGAAGAGGCCATGAGAAAGG + Intronic
916293728 1:163193802-163193824 CCTTGAGGATGGGATGAGAAGGG - Intronic
923108378 1:230871348-230871370 ACTAGATGAGGTCATGAGAATGG - Intergenic
1063974804 10:11406665-11406687 CCTTGAGGAGGCCATGATCTCGG + Intergenic
1064032186 10:11889877-11889899 CCTTGAATAGGCTATGAGAGTGG + Intergenic
1072747787 10:97953576-97953598 AGATGACGAGGCCATGAGAATGG - Intronic
1073542579 10:104325564-104325586 CCTTGCAGAGGCCATGGGGAAGG - Intronic
1073963536 10:108961829-108961851 GCTTGAAGATGTCATGAGAAAGG - Intergenic
1075572335 10:123555459-123555481 CCTTGATGTGGCCTTGAGCAGGG - Intergenic
1076521940 10:131086703-131086725 CCTTGCCATGGCCATGACAAAGG - Intergenic
1076978970 11:195339-195361 CCCTGACAAGGCCAAGAAAAAGG + Intronic
1080171852 11:29313398-29313420 CTTTGAGGTGGGCATGAGAATGG + Intergenic
1080868818 11:36218528-36218550 CCTGGATGTGGCCATGAGAATGG + Intronic
1083574007 11:63776157-63776179 CTTTGACAAGACCATGAGCAAGG + Intergenic
1083601204 11:63949231-63949253 TCCTGACAAGTCCATGAGAAAGG - Intronic
1085777766 11:79381903-79381925 CCTTGAACAGGCCTTGACAATGG + Intronic
1091308442 11:134555899-134555921 CCTTGTCCAGGCCGTGAGGAAGG + Intergenic
1091353099 11:134913409-134913431 CCTGGACGGGGCCCTCAGAAAGG + Intergenic
1096878870 12:54651151-54651173 TCTTGATGAGGGAATGAGAAGGG - Intergenic
1099705411 12:86146580-86146602 CCTTGAAGAGGCCATTAGATCGG - Intronic
1101822608 12:108195639-108195661 CTTGGCTGAGGCCATGAGAAAGG - Exonic
1102704849 12:114871979-114872001 CATTGACTATGCCATTAGAAAGG - Intergenic
1103244430 12:119444376-119444398 CAGTGACGAGACTATGAGAAAGG - Intronic
1104806154 12:131590756-131590778 CCTGGAGGAGGGGATGAGAAAGG + Intergenic
1104811842 12:131624107-131624129 CATCGCCCAGGCCATGAGAATGG + Intergenic
1104811860 12:131624182-131624204 CATTGCCCAGGCCATGAGAATGG + Intergenic
1107401781 13:40076615-40076637 CCTGGAACAGGCAATGAGAAGGG - Intergenic
1114317624 14:21523021-21523043 CCTGCAGGAGGCAATGAGAAAGG - Exonic
1114765246 14:25363154-25363176 CCTTGACCAGGCCACCTGAATGG - Intergenic
1116108926 14:40550347-40550369 TTTTGAGGAGGCTATGAGAAAGG + Intergenic
1118431636 14:65724881-65724903 CTTAGATGAGGTCATGAGAATGG - Intronic
1123464525 15:20505730-20505752 CGCTGACGAGACCTTGAGAATGG + Intergenic
1123653589 15:22495311-22495333 CGCTGACGAGACCTTGAGAATGG - Intergenic
1123744009 15:23304169-23304191 CGCTGACGAGACCTTGAGAATGG - Intergenic
1124275254 15:28321694-28321716 CGCTGACGAGACCTTGAGAATGG + Intronic
1124307446 15:28589899-28589921 CGCTGACGAGACCTTGAGAATGG - Intergenic
1125729994 15:41887749-41887771 CCTAGACAATGCCATGAGATTGG - Intronic
1127370097 15:58331231-58331253 CATACACGAGGCCAGGAGAAGGG + Intronic
1129248668 15:74295983-74296005 CAGTGATGAGGCCATGGGAAGGG + Intronic
1134597061 16:15504190-15504212 CCTTGAAGAGGGCAAGAGAGGGG - Intronic
1135825336 16:25722311-25722333 CCTTGGAGACTCCATGAGAAGGG + Intronic
1142466460 17:140157-140179 CCCTGACAAGGCCAAGAAAAAGG + Intergenic
1142861025 17:2761597-2761619 CCTTGACGATATGATGAGAATGG - Intergenic
1143112805 17:4562059-4562081 TCGTGAAGAGGCCATGAGAAAGG - Intergenic
1145721113 17:27073806-27073828 CCTTCAAGAGGCCAAGAAAATGG - Intergenic
1151591322 17:75046827-75046849 CCTTGACGGGGGCGTGACAAGGG + Intronic
1151667075 17:75551106-75551128 CCTGGACAGGGCCAAGAGAATGG - Intronic
1158008061 18:52695850-52695872 CCTTTTTGTGGCCATGAGAAAGG + Intronic
1158432526 18:57402197-57402219 CGTAGACTAGTCCATGAGAAAGG + Intergenic
1160312350 18:77807533-77807555 CCTTCACCAGGCCATAAAAAGGG - Intergenic
1162890650 19:13730766-13730788 CCTGGCCGAGGGCATGAGAATGG - Intergenic
1163182847 19:15616346-15616368 CCTAGACAAGGAGATGAGAAAGG - Intronic
1163646742 19:18493783-18493805 CCTTTCCCGGGCCATGAGAAAGG - Intronic
925432133 2:3803813-3803835 CAGTGCTGAGGCCATGAGAAGGG - Intronic
927513001 2:23656251-23656273 CTTTGAGGAGGCCATGCGATGGG + Intronic
928888336 2:36175937-36175959 CCTTGAGGAGGCAATGACAAGGG - Intergenic
929011660 2:37451248-37451270 CCTTGATGAGGCTATTAGCATGG + Intergenic
930858052 2:56040194-56040216 ACTTGAGCATGCCATGAGAAAGG + Intergenic
934605912 2:95694944-95694966 GCTTGTGGAGGACATGAGAAGGG + Intergenic
936539321 2:113337147-113337169 GCTTGTGGAGGACATGAGAAGGG + Intergenic
937718651 2:125064404-125064426 ACTTCAAGAGGCAATGAGAAGGG - Intergenic
938402197 2:131003177-131003199 CCATGACGAGGCCAGGGGAATGG + Intronic
944694406 2:202188163-202188185 GATTAACGAGGCCAAGAGAAAGG + Exonic
947186570 2:227460677-227460699 GCTGGACGAGGCGATGTGAATGG + Intergenic
947955661 2:234188350-234188372 CCTTGACAAGACCCTGAGAAGGG - Intergenic
1169224597 20:3848069-3848091 CCTGGCTGATGCCATGAGAAAGG + Intronic
1172915341 20:38439335-38439357 CTCTGAAGAGCCCATGAGAAAGG + Intergenic
1172961949 20:38806034-38806056 CCTTGACGAGGCCAGGGGAGGGG + Intronic
1175699874 20:61129163-61129185 CCCTGATAATGCCATGAGAATGG + Intergenic
1176194996 20:63832651-63832673 CCTTGGCGAGGGGATGGGAACGG - Intergenic
1180161683 21:46001085-46001107 CCTTTACGGGGCCATGGGAGGGG + Intronic
1183274319 22:36882995-36883017 CCATGGGGAGGCCATGAGATAGG + Intergenic
1184428184 22:44425325-44425347 GCTTCACGAGGCCAAGAGCATGG + Intergenic
950557684 3:13705230-13705252 CATTGAGGAGGCCATGTGAAGGG + Intergenic
952276462 3:31882110-31882132 CCTTGCCGGGGCCATAAGTAGGG - Intronic
953977830 3:47395671-47395693 CCTTTCCCAGGCCAGGAGAATGG + Intronic
954543226 3:51410165-51410187 CCTTTACCAGGCCCTGAGGAAGG + Intronic
955359282 3:58259026-58259048 CCTTGACGAGGCCATGAGAAGGG - Intronic
955791750 3:62595238-62595260 CATGGAGGAGGCCATGAGATAGG + Intronic
959313231 3:104768345-104768367 CCTTGACCAATTCATGAGAATGG + Intergenic
960966055 3:123105453-123105475 CCTTGACAAGGGACTGAGAAAGG + Intronic
962751497 3:138437327-138437349 CCTTGACAAGGACCTGGGAAAGG + Intronic
969781179 4:9405604-9405626 CCTTGAAGAGGGCATGAAAGAGG + Intergenic
970511573 4:16786924-16786946 CCCTGAGGAGGCCAGAAGAAAGG - Intronic
972785632 4:42324173-42324195 CCATGATGAAGCCATGACAAAGG + Intergenic
974504744 4:62754613-62754635 ACATGAAGAGGCCATGAGAAGGG + Intergenic
978513165 4:109543422-109543444 CCATAAGGAGGCAATGAGAATGG - Intergenic
978865407 4:113503149-113503171 CCCTGGCGAGGCCATGAGATAGG + Intronic
986328999 5:6703690-6703712 CCTTGAAGACACCTTGAGAAAGG - Intergenic
987091149 5:14508839-14508861 CCTAGACAAGGCCATGGGAGTGG - Exonic
988560473 5:32276374-32276396 ACTGGAAGAGGCCATTAGAATGG + Intronic
990396826 5:55390624-55390646 TCATGACGTGGCCATGATAAGGG - Intronic
992080321 5:73230499-73230521 CCTTCACGAGGCCCAGAGAGAGG - Intergenic
995347330 5:111135543-111135565 CAGAGATGAGGCCATGAGAAAGG + Intergenic
996265485 5:121534728-121534750 CCTTGAAGAGCTCTTGAGAAAGG + Intergenic
997640232 5:135444157-135444179 CCATGACCGGGCCGTGAGAAGGG - Intergenic
1002022315 5:176371724-176371746 CCTGAGCGAGGCCATGAGTATGG + Exonic
1003167912 6:3697474-3697496 CTTTGACTTGGCCATGAGCAGGG + Intergenic
1007249118 6:40483698-40483720 CCATGATGTGGGCATGAGAAGGG + Intronic
1009242063 6:61195879-61195901 CATTGTCAAGGCCATGAAAAGGG - Intergenic
1011374639 6:86675993-86676015 CCCTGACAAAGCCATCAGAAAGG - Intergenic
1013692027 6:112657118-112657140 CCTTTAGGAGGTCATGTGAATGG + Intergenic
1015706175 6:136090197-136090219 CCTTCACGTGGCTATGAGAAAGG + Intronic
1017132533 6:151120079-151120101 TCTTGAGGAGGCCATGAGGGTGG + Intergenic
1018090652 6:160345083-160345105 CCTTGAGGAGGTCAGGAGTAGGG - Intergenic
1019034275 6:169041474-169041496 CCACGACGAGGCCTTGTGAAGGG - Intergenic
1021905320 7:25327691-25327713 CCTTCACGAGGGGATGAGCACGG - Intergenic
1024584179 7:50826858-50826880 CCGAGGCGAGGCAATGAGAAGGG - Intergenic
1030361603 7:108600909-108600931 CCTTGACTAGGGCATGTCAAAGG - Intergenic
1033526790 7:142223893-142223915 ACTTGACCAGGACATGAGAGTGG - Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1036278612 8:7379522-7379544 CCTTGAAGAGGGCATGAAAGAGG + Intronic
1036421487 8:8600081-8600103 CCTGGACTAGGCCATCTGAACGG + Intergenic
1036838251 8:12093102-12093124 CCTTGAAGAGGGCATGAAAGAGG - Intergenic
1036860041 8:12339350-12339372 CCTTGAAGAGGGCATGAAAGAGG - Intergenic
1039723221 8:40187258-40187280 TCTTGACAAGGCTATTAGAATGG - Intergenic
1040551647 8:48442377-48442399 CCTTGACGAGCTCCTGAGACTGG - Intergenic
1041437525 8:57858844-57858866 CCATGAGAAGGCCATGGGAATGG + Intergenic
1047992448 8:130300238-130300260 CAGTGATCAGGCCATGAGAATGG + Intronic
1048091446 8:131245194-131245216 CCTTGACAAGAACATGGGAATGG - Intergenic
1049269808 8:141688716-141688738 CCTTGAAGTGGCTTTGAGAATGG - Intergenic
1049457420 8:142700711-142700733 CCCCGACCAGGCCGTGAGAACGG + Intronic
1049797879 8:144504818-144504840 CCCTGACGATGCCAAGAAAAGGG + Exonic
1049803796 8:144530004-144530026 CCAGGACGAGGACAGGAGAAAGG + Exonic
1057599826 9:96448739-96448761 CCTTAGCGTGGCCATGAGGATGG - Intergenic
1059903496 9:118955045-118955067 CTTTGACCATGCCAGGAGAAGGG + Intergenic
1187195208 X:17077289-17077311 CATAGAAGAGGCCATGAAAAGGG + Exonic
1190540729 X:51475263-51475285 CCCTGTCTAGTCCATGAGAATGG + Intergenic
1194404980 X:93485545-93485567 CTTTGATGAGGTCATGAGCATGG + Intergenic
1195129847 X:101841104-101841126 TCTTGAAGAAGCCAAGAGAAGGG + Exonic
1195176389 X:102318719-102318741 TCTTGAAGAAGCCAAGAGAAGGG - Exonic
1195182475 X:102368374-102368396 TCTTGAAGAAGCCAAGAGAAGGG + Exonic
1199548867 X:149036403-149036425 CCTTGAGGAAGCCAGGAGAGGGG - Intergenic