ID: 955359943

View in Genome Browser
Species Human (GRCh38)
Location 3:58265029-58265051
Sequence AGCTGGGGGTAGGGGAGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1751
Summary {0: 1, 1: 0, 2: 17, 3: 187, 4: 1546}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955359943_955359951 -5 Left 955359943 3:58265029-58265051 CCACTTCTCCCCTACCCCCAGCT 0: 1
1: 0
2: 17
3: 187
4: 1546
Right 955359951 3:58265047-58265069 CAGCTACTCATCTCAGCCTCTGG 0: 1
1: 0
2: 5
3: 85
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955359943 Original CRISPR AGCTGGGGGTAGGGGAGAAG TGG (reversed) Intronic
900187154 1:1337864-1337886 AGCTGGGGGTGGAGCAGCAGCGG + Intronic
900338984 1:2178936-2178958 AGCTGGGGATAGGCAAGGAGGGG - Intronic
900395249 1:2450718-2450740 AGCGGGGGGTAGGCGGGGAGCGG - Intronic
900478556 1:2887447-2887469 AGGTGGGGGTGGGGAAGAAGAGG + Intergenic
900497152 1:2980921-2980943 AGCTGGGGGTGGGGGCGGGGGGG + Intergenic
900764853 1:4497979-4498001 GCCTGGAGGGAGGGGAGAAGGGG - Intergenic
900778747 1:4603513-4603535 ATTTGGGTGTAGGGGAGAACTGG - Intergenic
900970808 1:5991770-5991792 AGCCGGGGGGCGGGGAGGAGGGG + Intronic
900991473 1:6100210-6100232 GGCTGGGGCGAGGGGAGGAGGGG + Exonic
901010967 1:6201921-6201943 AGGTGGGGGTGAGGGTGAAGAGG - Intronic
901208865 1:7513172-7513194 AGCTGTGGGGTGGGGAGAAGCGG + Intronic
901292455 1:8134799-8134821 AGTTGGTGGTCGGGGAGAAGTGG + Intergenic
901295161 1:8155773-8155795 AGGTGGAGGAAGGGGAGGAGGGG + Intergenic
901512446 1:9724255-9724277 AGCTGAGGGGAGGGGAGAGGAGG - Exonic
901650775 1:10741980-10742002 GGCTGGGGGCACGTGAGAAGCGG - Intronic
901683819 1:10932254-10932276 AGCTGCGGGCAGGGGGGAATAGG + Intergenic
901876443 1:12169455-12169477 AGCTGGGGGCCGGGGAGCTGGGG + Intronic
902163395 1:14550753-14550775 AGTAGGGGGAAGGGGAGAGGGGG - Intergenic
902179448 1:14676788-14676810 AGCTATGGGGAGGGGAGAATGGG + Intronic
902275139 1:15334263-15334285 TGCAGGGGGTGGGGGTGAAGGGG - Intronic
902355728 1:15898362-15898384 GGCTGGGGGAAAGGGAGAATTGG - Intronic
902382942 1:16061159-16061181 AGATGGGGGTACGGAAGAAAGGG + Intronic
902518040 1:17000311-17000333 TGCTGTGGGCAGGGGACAAGAGG + Exonic
902568853 1:17333620-17333642 AGCTGGAGATGGGGCAGAAGAGG - Intronic
902604494 1:17561326-17561348 AGCTGGAGATGGGGCAGAAGCGG + Intronic
902773198 1:18658206-18658228 AGGTGGGGGCAGGGAAGAGGAGG - Intronic
902792497 1:18778662-18778684 AGCTGGAGGTATGGGGGCAGGGG + Intergenic
902809574 1:18880463-18880485 AGATGGGGGATGTGGAGAAGGGG - Intronic
902919552 1:19657797-19657819 TGGTGGGGGAAGGGGAGGAGGGG + Exonic
903027668 1:20441191-20441213 AGCTGGGGGCTCGGGAGAGGTGG - Intergenic
903043952 1:20552444-20552466 GCGTGGGGGGAGGGGAGAAGAGG + Exonic
903065028 1:20694815-20694837 AGCAGGGGGCAGTGGAGGAGAGG - Intronic
903136634 1:21313556-21313578 AGGTGGGAGTGGGGGAGCAGGGG + Intronic
903172459 1:21562769-21562791 AGCAAGGGGTTGGGGAGCAGGGG - Intronic
903255156 1:22092591-22092613 AGCTGGGGGTAGGGTGGGGGTGG + Exonic
903335082 1:22619254-22619276 AGGTGAGGAGAGGGGAGAAGAGG - Intergenic
903374935 1:22859926-22859948 GGCTGGGGATAGGGGAGCAGGGG - Intronic
903550321 1:24153430-24153452 GGCGGAGGGTAGGGGAGGAGGGG - Intergenic
903623957 1:24717997-24718019 AGCTGGAGGGAGGGGGGAGGTGG + Intergenic
903734333 1:25520757-25520779 AGTAGAGGGTTGGGGAGAAGGGG - Intergenic
903814653 1:26056069-26056091 AGCTGAGGTTGGGGGACAAGGGG - Intronic
904044202 1:27600493-27600515 ACCTGGGGGTGGGACAGAAGAGG + Intronic
904054141 1:27659249-27659271 AGCTGGGGGGTGGGGAGCATGGG + Intergenic
904246873 1:29194217-29194239 AGCTGGGGCTTGGTGAGATGTGG + Intronic
904289429 1:29474673-29474695 ATCTGGGAGGAGGGGAGAAAGGG + Intergenic
904469545 1:30727949-30727971 AGATGGTGGGAGGGGAGGAGAGG - Intergenic
904715200 1:32462727-32462749 AACTGGGGATAGGGTAGAGGTGG - Intergenic
904927110 1:34057907-34057929 AGCTGGGGGTTGGGGTGAGGAGG + Intronic
904970409 1:34414922-34414944 AGCTGTGGGTCTTGGAGAAGAGG + Intergenic
905168352 1:36096662-36096684 AGCAGGTGGAAGGGGAGAAAGGG + Exonic
905199374 1:36306121-36306143 AGCTGAGGGAAAGGGAGAGGCGG + Intergenic
905277719 1:36829739-36829761 AGCTGGGGGTGTGGTAGAATGGG - Intronic
905462908 1:38133229-38133251 AACTGGGGATGGGGAAGAAGGGG + Intergenic
905491407 1:38346793-38346815 AGGTAGGGGAAGGTGAGAAGGGG + Intergenic
905591896 1:39171431-39171453 TGCCAGGGGTTGGGGAGAAGGGG - Intronic
905679890 1:39862122-39862144 AGCTGGGGAGAGGGGAAAATAGG + Intronic
905798904 1:40831020-40831042 AGCTGGGGGTGGGGGTGAGTGGG - Intronic
905932527 1:41799794-41799816 TGCTTGGGGTTGGGGGGAAGGGG - Intronic
906031123 1:42720947-42720969 CCATGGGGTTAGGGGAGAAGGGG - Intergenic
906102820 1:43274025-43274047 GGCTTGGGGTAGGGGAGGAAGGG - Intergenic
906126427 1:43429851-43429873 AGCTTGGGTGAGGGTAGAAGAGG + Intronic
906127805 1:43438220-43438242 AGCTTGGGGAAGGGGAGCTGGGG + Intronic
906191931 1:43904548-43904570 ATCTGGGGGTAGAGGAGCAATGG - Intronic
906197379 1:43937272-43937294 AGCAGGGGGTTGGGAAGAAGAGG + Intergenic
906291356 1:44621574-44621596 AGTGGGGGACAGGGGAGAAGGGG - Intronic
906395238 1:45457312-45457334 GGCTGGGGGTAGAGGTGAGGTGG + Intronic
906460914 1:46034715-46034737 TGTTGGGGGTGGGGGAGAAGGGG - Exonic
906545695 1:46617743-46617765 AGATGCGGGTAGGGGAGAGCTGG + Intergenic
906576647 1:46897129-46897151 GGCTGGGGGGAGGGGAAAATGGG + Intergenic
906595271 1:47070456-47070478 GGCTGGGGGGAGGGGAAAATGGG - Intronic
906688288 1:47776818-47776840 CCATGGGGGTAGGGGAGGAGAGG - Intronic
906688393 1:47777215-47777237 GGCTGGGGTGAGGGGAGAGGAGG + Intronic
906812515 1:48843010-48843032 AGCTGGGGGAAGGGGAAAAAGGG + Intronic
906836944 1:49094217-49094239 TGGTGGGGGTAGGGGAGTGGGGG - Intronic
906958228 1:50395370-50395392 AGCTGAAGGGAGGGGAAAAGAGG - Intergenic
907328899 1:53658760-53658782 AGCAGGAGGTAGGGGTGTAGAGG + Intronic
907540760 1:55214522-55214544 AGCTGTGGGTTGGGGTGAGGAGG - Intronic
907585722 1:55616046-55616068 TGCAGGGGGTAGGGGAGAGAGGG + Intergenic
907604921 1:55806783-55806805 TGCTGGGGCTAGGGGAGAGGTGG - Intergenic
907864909 1:58390227-58390249 GGCTGGGGGTAGGGGTGGGGTGG - Intronic
908148057 1:61268397-61268419 GGGTGGGGGCAGGGGAGTAGAGG - Intronic
908249971 1:62257740-62257762 AGAAGGGGGTTGGGGAGAATGGG - Intronic
908375281 1:63531146-63531168 CTCTGGGGGTAGGGGAGGATGGG - Intronic
908440951 1:64153738-64153760 GGCTGGGGGAAGGGGGGAAATGG + Intronic
908695254 1:66832525-66832547 AGTTGGGGGTAGGGCAGTGGTGG + Intronic
908958977 1:69671455-69671477 GCCTGGGGTTAGAGGAGAAGTGG + Intronic
909053448 1:70795534-70795556 TGTTGGGGGTAGGGGGCAAGGGG - Intergenic
909195503 1:72616819-72616841 TGCGGGGGGGAGGGGGGAAGAGG - Intergenic
909953972 1:81754462-81754484 AGGGGAGGGGAGGGGAGAAGGGG - Intronic
909970256 1:81975640-81975662 TGGTGGGGGCGGGGGAGAAGGGG + Intronic
910013557 1:82494731-82494753 AGCTGGGAGTAGGGAAGAAGAGG - Intergenic
910059600 1:83073376-83073398 ATCTGGGGTTAAGGAAGAAGGGG - Intergenic
910088348 1:83431307-83431329 AGGTGGGGGCAGGAGGGAAGTGG - Intergenic
910547850 1:88439307-88439329 AGCAGGGGGAAGTGGGGAAGTGG + Intergenic
910625298 1:89300374-89300396 ATCAGGGGGTGGGGGACAAGAGG + Intergenic
910661555 1:89679122-89679144 ACAAGGGGGTCGGGGAGAAGAGG + Intronic
910731049 1:90397131-90397153 AGATGAGGGCAGGAGAGAAGCGG - Intergenic
911001751 1:93173040-93173062 AGCTGGGGGTGGGGGACTTGGGG + Intronic
911319762 1:96399008-96399030 AGCTGGGGGAAAAGGAGAAAGGG + Intergenic
911532619 1:99063336-99063358 AGCAGGGGGGTGAGGAGAAGGGG + Intergenic
911614520 1:99994448-99994470 GGCTGTGGGTAAGGGAGAATGGG - Intronic
911664542 1:100538803-100538825 GGCTGGGGGAGGGGGAGAAAGGG - Intronic
912260763 1:108109927-108109949 TGCTGGTGGTGGGGGAGGAGGGG - Intergenic
912381543 1:109250375-109250397 AGCTGGTGGTAGGGGAATATGGG - Exonic
912503370 1:110137326-110137348 AGCTGGGAGTAGGGGTGGGGGGG - Intergenic
912520290 1:110240407-110240429 AGCTGAGGGGAGGGGAGCTGAGG - Intronic
912635915 1:111292739-111292761 AGCTGGGGGAGGGGGAAATGGGG - Intronic
912756570 1:112329494-112329516 AGATGGGGAGAGGGGAGGAGAGG - Intergenic
912811041 1:112794786-112794808 AGCTGGGGGTAGTGGGGTGGAGG - Intergenic
912903547 1:113679247-113679269 AGATGGGGGGAGGGAAGGAGAGG - Intronic
912955027 1:114149355-114149377 GGCTGGGGGGAGGGGAGCAGAGG + Intronic
912971723 1:114289994-114290016 AGCTGGGAGTAGGGCAGAGCCGG + Intergenic
913049683 1:115106258-115106280 GGCTGGGGGCAGGTGGGAAGAGG + Intergenic
913494198 1:119412793-119412815 AGCTGGGGGCTGGGAATAAGAGG + Intergenic
913698552 1:121351947-121351969 AGCTGGGGGAAGGAGAGATGGGG + Intronic
914138995 1:144928088-144928110 AGCTGGGGGAAGGAGAGATGGGG - Intronic
914794323 1:150907328-150907350 AGCTGGAGGTGGGGGATGAGGGG - Intergenic
914859258 1:151372740-151372762 AGCTGGGGGTGGGGCAGAGAAGG + Intergenic
915034844 1:152912956-152912978 TGATGGGGGTAGGGAAGAGGAGG - Intergenic
915120918 1:153629138-153629160 ACTTGGGGGCAGGGGAGATGGGG - Intronic
915172170 1:153985798-153985820 TGGTGGGGGTAGGGGAAGAGGGG + Intronic
915426744 1:155833692-155833714 AGGTGAGGGAAGGGGATAAGAGG + Intronic
915458714 1:156056755-156056777 TGCAGGGGGTAGGGGAGAGTAGG - Intronic
915497253 1:156290897-156290919 GGGTGGGGGTGGGGGAGAATAGG + Intronic
915509323 1:156377969-156377991 TGCTGGGGATGGGGCAGAAGTGG - Exonic
915559474 1:156678169-156678191 GGCAGGGGGTGCGGGAGAAGGGG - Intergenic
915570858 1:156744444-156744466 GGGTGGGGGTGGGGGAGAGGCGG - Intronic
915903412 1:159862128-159862150 AGCTGGAGGTGGGGTAGGAGAGG - Intronic
915910540 1:159912442-159912464 AGCTGGGGGTAGGTCTGAAGGGG - Intergenic
915951030 1:160190196-160190218 AGCTGGGGCTGGGGGAGGGGAGG - Intergenic
916118728 1:161510092-161510114 AGATGTAGGGAGGGGAGAAGAGG + Intronic
916128440 1:161591416-161591438 AGATGTAGGGAGGGGAGAAGAGG + Intronic
916443173 1:164847271-164847293 AGCTGGGGCTAGGAAGGAAGAGG - Exonic
916573652 1:166048607-166048629 AGCTGGGGCAAGGGGAGGAAGGG + Intergenic
916887238 1:169081790-169081812 AGCTGGGGGAGAGGGAAAAGAGG + Intergenic
917216820 1:172687620-172687642 AGGTGGGAGTAGTGGAGTAGAGG + Intergenic
917386614 1:174483262-174483284 GGCAGGGGGTGGGAGAGAAGTGG - Intronic
917534085 1:175862197-175862219 AGCTGGGGGGAGGGAGGAACGGG - Intergenic
917737549 1:177934293-177934315 GCCTGGGGGAAGGGGAGATGGGG - Intronic
918210828 1:182349557-182349579 CCCTGAGGGAAGGGGAGAAGGGG - Intergenic
918295678 1:183154145-183154167 ATCTGGGGAGAGGAGAGAAGAGG - Intergenic
918389604 1:184044742-184044764 GGATGGGGGTAGGGGAAATGGGG + Intergenic
918452585 1:184673839-184673861 AGCTGGGGGCTGGGGAAATGGGG - Intergenic
918543541 1:185657617-185657639 AGGGGTGGGGAGGGGAGAAGGGG - Intergenic
918543553 1:185657642-185657664 AGGGGAGGGTAGGGGAGGAGAGG - Intergenic
918733104 1:188022957-188022979 AGGGGAGGGGAGGGGAGAAGGGG + Intergenic
918733121 1:188022998-188023020 AGGGGAGGGGAGGGGAGAAGGGG + Intergenic
919587017 1:199451443-199451465 AACTTGGGGGTGGGGAGAAGAGG + Intergenic
919794208 1:201311422-201311444 AGCTGGGCGTGTGGGTGAAGGGG + Intronic
919879963 1:201894893-201894915 ACCTTGGGTGAGGGGAGAAGGGG + Intergenic
920059679 1:203218650-203218672 GGCTGGGGAGATGGGAGAAGGGG - Intronic
920295783 1:204955353-204955375 AGAAGGGATTAGGGGAGAAGAGG + Intronic
920305655 1:205016572-205016594 AAGTGGGAGGAGGGGAGAAGGGG + Exonic
920356057 1:205373686-205373708 AGGTAGGGGTAGGGGAGGAAAGG + Intergenic
920375524 1:205505888-205505910 GGCTAGGGGTGGGGAAGAAGGGG - Intronic
920397527 1:205658153-205658175 AGTTGGGGGTAGGGGAAAGTTGG + Exonic
920455977 1:206101440-206101462 AACTGGGGTGTGGGGAGAAGAGG - Intronic
920485957 1:206370587-206370609 AGCTGGGGGAAGGAGAGATGGGG + Intronic
920696265 1:208183386-208183408 AGCAGGGGATGGGGGAGTAGAGG + Intronic
920994059 1:210970260-210970282 TGTTGGGGGTGGGGGACAAGGGG - Intronic
921002124 1:211055193-211055215 TGCTGGGGATAGGGGAGGGGTGG - Intronic
921218718 1:212958296-212958318 AGCTGGGGGCAGGGCAGTGGCGG - Intronic
921725919 1:218523246-218523268 GGCTAGGGGGAGGGGAGAAATGG + Intergenic
921807642 1:219474261-219474283 AGCTGGGCAGAGGGGAAAAGGGG + Intergenic
922178487 1:223215452-223215474 AGGTGGGGGAAGGGGATGAGAGG - Intergenic
922216493 1:223524154-223524176 ATCTGAGGGAAGGGGATAAGGGG + Intergenic
922563743 1:226587683-226587705 AGCTGAGGCTAAGGGAGAAGTGG + Intronic
922675710 1:227547730-227547752 AGGTGGGTGCAGGGGAGACGAGG - Intergenic
922686728 1:227644801-227644823 ACCTGTGGGGAGGGTAGAAGTGG - Intronic
922793806 1:228327555-228327577 GGCTGGGGGAATGGGAGAATGGG - Intronic
922862863 1:228834306-228834328 GGCTGGGGTTTGGGGAGGAGAGG - Intergenic
922999273 1:229992909-229992931 AGCTGAGGGTGGGGCAGATGGGG + Intergenic
923016734 1:230132273-230132295 AGATAGGGGTAGGGGAGACCAGG + Intronic
923051751 1:230394997-230395019 AGCTCGGGGATGGGGAGGAGTGG - Intronic
923125242 1:231028801-231028823 AGCTCTGGGCATGGGAGAAGAGG - Intronic
923194777 1:231654616-231654638 GGCTGGGGCAAGGGTAGAAGTGG - Intronic
923271470 1:232358895-232358917 AACTGGGAGTAGGGGAGCTGGGG + Intergenic
923373902 1:233340608-233340630 AGATGGTGCTAGGGGTGAAGGGG + Intronic
923482369 1:234397295-234397317 AGGAGGGGGAAGGGGAGAAAGGG + Intronic
923544653 1:234915253-234915275 AGTTGTGGGGAGGAGAGAAGAGG - Intergenic
923691361 1:236196608-236196630 ACCTGGGGGAAGGGTGGAAGAGG - Intronic
923776944 1:236987256-236987278 AGCTGGGAATAGGGGAGAATGGG - Intergenic
923981275 1:239326883-239326905 AGCTGGGAGAAAGGGATAAGAGG + Intergenic
924232381 1:241972916-241972938 AGCTGGGGCTGGGGGTGGAGGGG + Intergenic
924496082 1:244590588-244590610 GGCTGGGGGAAAGGGAGAATGGG - Intronic
924583890 1:245345226-245345248 AGCTGCGGGTAGGGCAGGGGTGG - Intronic
924648640 1:245903614-245903636 TGCTGGGGGTCAGGGAGAGGTGG - Intronic
1063074260 10:2699428-2699450 GGCTGGGGGCAGGGGAGCAGGGG + Intergenic
1063096706 10:2915239-2915261 AGGTGGGAGTAGAGGAGTAGAGG - Intergenic
1063121293 10:3106865-3106887 AGGAGGGGGCAGGGGTGAAGGGG - Intronic
1063157329 10:3391686-3391708 AGGAGAGGGTAGGGGAGGAGGGG + Intergenic
1063232417 10:4078260-4078282 AGGTGGGGGGAGGGGAGGGGAGG + Intergenic
1063361481 10:5463010-5463032 AGTTTGGGGTAGGGTAGAATGGG - Intergenic
1063499021 10:6536600-6536622 GGCTGGAGGAAGAGGAGAAGGGG - Intronic
1064225812 10:13483819-13483841 TGCTGGGGGTACGGGAGGAAGGG + Intronic
1064328146 10:14369982-14370004 TGCTGGGGAAAGGGGAGAAGAGG - Intronic
1064883113 10:20079779-20079801 GTCAGGGGGTAGGGGACAAGGGG + Intronic
1064885356 10:20105639-20105661 AGGTGGGGGTAGGGGGCAGGAGG - Intronic
1065091924 10:22244085-22244107 AGGAGGGGGTAGGGGAGAGGTGG - Intergenic
1065242599 10:23722177-23722199 GGCTGGGGGAAGGGGAAATGTGG + Intronic
1065287992 10:24203549-24203571 AGGTGGGGGTTGGGGGGTAGGGG - Intronic
1065421941 10:25554741-25554763 AGTTGGGGTTCGGGGTGAAGTGG + Intronic
1066039874 10:31538039-31538061 GCCTGGGGATAGGAGAGAAGGGG - Intergenic
1066133431 10:32417407-32417429 AGCTGAGGGTAGGGAGGAATGGG - Intergenic
1066244766 10:33571702-33571724 AGCAGGGGTGAGGGGAGCAGTGG - Intergenic
1066401648 10:35082387-35082409 TGCTGGGGGAAGGGGAAATGGGG + Intronic
1066588392 10:36963878-36963900 GTCAGGGGGTAGGGGACAAGGGG + Intergenic
1067059069 10:43068549-43068571 AGCAGGGGGTGGGGGATCAGGGG - Intergenic
1067157700 10:43795839-43795861 GGCTGGGGGTTGGGGAGACATGG + Intergenic
1067416347 10:46106217-46106239 AGCTGGGGCCAGGGGAGCGGGGG + Intergenic
1067436486 10:46282710-46282732 AGCTGGGGCGAGGGGAGCGGAGG + Intergenic
1067772746 10:49139027-49139049 ACCCGAGGGCAGGGGAGAAGTGG + Intergenic
1068246495 10:54378000-54378022 AGCTTGGGGTTGGGGAGTGGAGG - Intronic
1068681263 10:59822942-59822964 AGCTGGAGGTTGGAGAGAAGCGG + Intronic
1068859520 10:61833128-61833150 ATCTGGGGGACGGGGAGAATGGG - Intergenic
1068915695 10:62428859-62428881 CGCTTGGGAGAGGGGAGAAGTGG + Intronic
1069034019 10:63629812-63629834 AGTTGGGGGAGGGGGAGAAGTGG - Intergenic
1069238828 10:66112624-66112646 AGCTGAGGGGAGGGGAAATGAGG - Intronic
1069380257 10:67836194-67836216 GTCGGGGGGTGGGGGAGAAGGGG + Intronic
1069422435 10:68259481-68259503 AGCTAGGAAAAGGGGAGAAGAGG - Intergenic
1069588892 10:69630109-69630131 TGCTGGGGGTCGGGGAGATGGGG - Intergenic
1069627633 10:69878081-69878103 GGCTGGGTGCAGGGCAGAAGGGG - Intronic
1069698426 10:70404623-70404645 AGCTGGGGGCGGGGGCGAAGCGG - Intronic
1069764862 10:70847944-70847966 AGCCTGGGGTAGAGGAGAAGTGG + Intronic
1069767877 10:70877100-70877122 AGCTAGGACTCGGGGAGAAGGGG + Intronic
1069807761 10:71136623-71136645 TGCTGGGAGTAGGGGAGAGAGGG - Intergenic
1069830375 10:71279129-71279151 GGGTGGGGGTTGGGAAGAAGAGG + Intronic
1069847694 10:71384218-71384240 GGCTGAGGATAGGGGAGCAGCGG + Intergenic
1069930629 10:71879255-71879277 GGCTGGGGGTAAGGGGGATGGGG - Intergenic
1069942291 10:71964187-71964209 AGCTGGCGGGAGAGGAGAGGAGG - Intergenic
1070483842 10:76911025-76911047 CGGTGGGGGGATGGGAGAAGGGG + Intronic
1070756440 10:78996526-78996548 CGCTGGGGGTGGGGGCGGAGGGG - Intergenic
1070771556 10:79085328-79085350 AGCTGGGGGTGGGGGTCAAGGGG + Intronic
1071255800 10:83870549-83870571 TGCTGGGGGTTGGGGAGACCTGG - Intergenic
1072042873 10:91626086-91626108 GGCTGGGGGTGTTGGAGAAGGGG + Intergenic
1072079256 10:92012190-92012212 AGGGGAGGGGAGGGGAGAAGGGG - Intronic
1072303423 10:94084374-94084396 AGTTTGGGGTAGGGAAGAACTGG + Intronic
1072507526 10:96083634-96083656 AGGTGGGACTTGGGGAGAAGAGG + Intergenic
1072546144 10:96441021-96441043 CGCTGGGGGTAGGGTTGAGGGGG + Intronic
1072673346 10:97447573-97447595 AGATGTGTGTAGGGGAGAAGGGG - Intronic
1072677923 10:97482512-97482534 TGCTGGGGGTTGGGAAGAAGAGG + Intronic
1072800642 10:98390322-98390344 TGCTGGGGCTGGGGAAGAAGAGG - Intronic
1073098975 10:100997317-100997339 AGCTAGGGGTTGGGGTGAGGAGG + Intronic
1073105399 10:101029934-101029956 GGGTGGGGGTAGGGGACAATGGG - Intronic
1073109243 10:101050929-101050951 AGGTGGGGGGAGGAGAGAGGAGG - Intergenic
1073252998 10:102133373-102133395 TGCTGGGGGTAGGCGGGCAGAGG + Intronic
1073297476 10:102450015-102450037 AGGCGGGGGTAGGGGAGCGGTGG + Exonic
1073523333 10:104155533-104155555 TGAAGGGGGTAGGGGAGGAGAGG + Intronic
1073544552 10:104337601-104337623 GGGTGGGGTTAGGGGTGAAGGGG + Intronic
1073559767 10:104486859-104486881 TGCTGTGGGTTGGGGAGAGGAGG + Intergenic
1073805912 10:107097573-107097595 GGCTGGGGCTAGGGGTGGAGTGG - Intronic
1073816186 10:107209965-107209987 AGAGCGGGGTGGGGGAGAAGAGG + Intergenic
1074110963 10:110422675-110422697 AGCTTGGGGAAGGGCAGGAGAGG + Intergenic
1074149238 10:110743499-110743521 GGCTGGGAGAAGGTGAGAAGAGG - Intronic
1074182441 10:111076774-111076796 GGTGGGGGGTAGGGGAGGAGCGG - Intergenic
1074416359 10:113270336-113270358 GGCTGAGGGGAAGGGAGAAGGGG + Intergenic
1074737808 10:116453931-116453953 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1074764055 10:116687462-116687484 AGCTGAGGAGAGGTGAGAAGAGG + Intronic
1074950041 10:118324674-118324696 GGCTGGGTGGAGGGGAGAATGGG + Intronic
1075128018 10:119716244-119716266 GGCTGGGGTTGGGGGGGAAGAGG - Intergenic
1075185915 10:120257007-120257029 TGTTGGGGGTCGGGGAAAAGGGG - Intergenic
1075420036 10:122293964-122293986 AGGTGGGGGGAGGGGAAAGGAGG - Intronic
1075576417 10:123580858-123580880 AGGGGCAGGTAGGGGAGAAGAGG - Intergenic
1075879371 10:125837184-125837206 AGCTTTGGGTAGGGGAGAGAGGG + Intronic
1075955998 10:126523729-126523751 GGCTGGGGGAAGGTGGGAAGGGG - Intronic
1076152233 10:128172006-128172028 AGGAGAGGGGAGGGGAGAAGAGG - Intergenic
1076318932 10:129564344-129564366 AGGAGGAGGAAGGGGAGAAGAGG - Intronic
1076369835 10:129945137-129945159 AGGGGAGGGGAGGGGAGAAGAGG + Intronic
1076379575 10:130015796-130015818 GGCTGGGGATTGGGGAGCAGGGG + Intergenic
1076760832 10:132605171-132605193 GGCTGGGGATGGGGAAGAAGTGG + Intronic
1076760853 10:132605219-132605241 GGCTGGGGATGGGGAAGAAGTGG + Intronic
1076871188 10:133195889-133195911 AGCTGGGGGTGGAGGAGCACGGG + Intronic
1076988682 11:257685-257707 ACCTGGGGGTGGCGGGGAAGAGG - Intergenic
1076993058 11:285514-285536 TGGTGGGGCTGGGGGAGAAGGGG - Intergenic
1076996871 11:301660-301682 AGCTGGGGGTGGGGGGGGTGGGG + Intergenic
1077107475 11:848393-848415 CGCTGGGGGAAGGGGACAGGGGG - Intronic
1077176954 11:1195418-1195440 GGGTGGGTGTTGGGGAGAAGTGG + Intronic
1077304742 11:1864041-1864063 AGCGGGGGAGAGGGGAGGAGGGG + Intronic
1077317329 11:1925334-1925356 ATGTGGGGGTGGGGGAGAGGGGG + Intronic
1077333076 11:1991805-1991827 AGCTCGGGGTCGGGGAGAGGGGG + Intergenic
1077425694 11:2475139-2475161 AGCTGGGGGCATGGGGGAAAGGG - Intronic
1078055326 11:8004405-8004427 ACTGGGGGGTAGAGGAGAAGGGG + Intergenic
1078141891 11:8699171-8699193 AGCTGGGGGGAAGGGTGGAGGGG - Intronic
1078190433 11:9089591-9089613 GGCTGGGGGAAAGGGAGAGGAGG + Intronic
1078285356 11:9948252-9948274 AGCTGGGGGCAGGGGGAAACGGG + Intronic
1079128833 11:17735891-17735913 GGCTGGGGGGAGGGGGGAAGAGG + Exonic
1079451694 11:20604208-20604230 AGCGGGGGGGAGGGTGGAAGGGG + Intronic
1079486709 11:20942463-20942485 GGTTGGGAGTAGGGGAGTAGGGG + Intronic
1079712721 11:23707401-23707423 TGCTGAGGGTGGGGGGGAAGTGG - Intergenic
1080048012 11:27829631-27829653 AGCAGGGGGGAGATGAGAAGTGG + Intergenic
1080480814 11:32647999-32648021 AGCTGAGGTTTGGGGGGAAGGGG - Intronic
1081063897 11:38515205-38515227 GTCAGGGGGTAGGGGACAAGGGG + Intergenic
1081185344 11:40035669-40035691 AGCGGGAGGCAGGGAAGAAGGGG - Intergenic
1081654600 11:44849137-44849159 AGCAGGGGGCAGGGGGGCAGTGG + Intronic
1081747846 11:45485491-45485513 AGCAGGGGGCAGGGGAGGACAGG - Intergenic
1081847707 11:46252607-46252629 AGCTGGGGCTGGGGCAGGAGAGG + Intergenic
1081879043 11:46432319-46432341 AGCTGGAGATAGGGGACAGGAGG + Intronic
1082063994 11:47883938-47883960 GGCTGGGGGAAGTGGAGAATGGG + Intergenic
1082628362 11:55511802-55511824 AGGGGAGGGGAGGGGAGAAGAGG - Intergenic
1082795636 11:57376393-57376415 AGGTGGGGGGATGGGAGTAGGGG - Intergenic
1082795671 11:57376480-57376502 AGGTGGGGGGATGGGAGTAGGGG - Intergenic
1082797587 11:57389196-57389218 AGCTGGAGGAAGAGGAGGAGTGG - Exonic
1082972938 11:59042831-59042853 AGGTTGGGGTATGGGAGTAGGGG + Intronic
1082977342 11:59086401-59086423 AGGTTGGGGTATGGGAGTAGGGG + Intergenic
1083048692 11:59757880-59757902 GGCTGGGGAGAGGGGATAAGAGG - Intronic
1083228432 11:61299704-61299726 AGTTGTGGGTAGTGGGGAAGAGG - Exonic
1083331999 11:61903045-61903067 GACTGGGGGGAGGAGAGAAGAGG - Intronic
1083345222 11:61984861-61984883 AGCTGAGGGGAGGGGAAATGGGG - Intergenic
1083399672 11:62414947-62414969 TGCTGGTGGTTGGGGTGAAGCGG - Intronic
1083414259 11:62515096-62515118 ATGTGGGGGTGGGGGAGGAGTGG - Intronic
1083525874 11:63364462-63364484 AGCTGGAGGTAGGGGGAAATGGG - Intronic
1083542939 11:63527166-63527188 TGCTGTGGGGTGGGGAGAAGGGG + Intergenic
1083747393 11:64743652-64743674 AGCCGGGGATAGGGAGGAAGAGG - Intronic
1083756906 11:64796784-64796806 AGGTGGGGGCAGGGAGGAAGCGG - Intronic
1083919418 11:65773924-65773946 AGTTGGGGGCAGGGGAGGCGGGG + Intergenic
1084275497 11:68049249-68049271 TGCTGGGGCTGTGGGAGAAGAGG - Exonic
1084379638 11:68803345-68803367 AGGTGGGGGGAGGGAAGAATGGG + Intronic
1084595081 11:70112062-70112084 AGCTGGGGGTAGGGGAGCCCAGG - Intronic
1084891957 11:72241013-72241035 ACCTGGGGGTAGGGGAATACAGG - Intronic
1084908637 11:72369411-72369433 GGATGGGGGTGGGGGAGGAGGGG - Intronic
1084973880 11:72785881-72785903 AGGAGGGGGTGGGGGAGAAGGGG - Intronic
1085062828 11:73463595-73463617 AGCTGAGGCTAAGGGAGAAACGG + Intronic
1085077752 11:73606824-73606846 ATCTGGGGGCAGGGGACAGGAGG + Intergenic
1085106964 11:73853104-73853126 AGTGGGGGCTGGGGGAGAAGTGG + Intronic
1085242344 11:75068556-75068578 AGCTGAGGGGAGAGGAGAATGGG - Intergenic
1085765299 11:79276896-79276918 AGTTGGGGGGATGGGGGAAGGGG - Intronic
1085832116 11:79912479-79912501 TGTTGGGGGTCGGGGATAAGGGG - Intergenic
1085870382 11:80342534-80342556 AGCTGTGGGACGGGAAGAAGAGG - Intergenic
1086014075 11:82143179-82143201 AGCCGGGGGGAGGGGAGGAGAGG + Intergenic
1086096598 11:83056175-83056197 AGCTGGGGGCAGGAGAGAAGTGG - Intronic
1086286177 11:85253934-85253956 AGCTGGATGTTGGAGAGAAGTGG - Intronic
1086300286 11:85420527-85420549 ACCTGGGGGAAGGGGGGATGTGG - Intronic
1086307140 11:85493712-85493734 AGGGGAGGGTAGGAGAGAAGAGG + Intronic
1086453402 11:86938731-86938753 GGCTGGGGGTAGGGGTGGGGTGG + Intronic
1086461565 11:87010934-87010956 GGCTGGGGGCAGGGGAAATGGGG + Intergenic
1086725957 11:90184695-90184717 AACTGGGTGTAGGGGGCAAGGGG - Intronic
1086998165 11:93383455-93383477 AGCTGGAGGAAGGGGAAAATGGG + Intronic
1087014462 11:93542736-93542758 GCCTGGGGGTCGGGGAGTAGAGG - Intronic
1087120977 11:94573911-94573933 AGCTGGAGGGAGGGGGGAATGGG - Intronic
1087559666 11:99771637-99771659 AGCTGGCGGTGGGGGAAATGAGG + Intronic
1088158639 11:106841192-106841214 AGCTGGGGGCAGTAGAGATGAGG - Intronic
1088531360 11:110813517-110813539 GGCTGGGGGAAGGGGATAATGGG - Intergenic
1088850815 11:113701948-113701970 GACTGGGGGTGGGGGACAAGGGG - Intronic
1089169999 11:116505192-116505214 AGCAGGGGCTGGGGGAGAACAGG - Intergenic
1089194287 11:116684059-116684081 AGGTGGGGGTGGGGGTGGAGGGG - Intergenic
1089239987 11:117069333-117069355 TGCTGGGGGAAAGGAAGAAGTGG - Intronic
1089345266 11:117786931-117786953 AGCAGGGGGCAGGGGACAGGAGG + Intronic
1089406584 11:118202739-118202761 GGCTGGGGGTGGGGAAGATGGGG - Intronic
1089461805 11:118658259-118658281 AGCTGGGGCCAGGTGAGGAGAGG + Exonic
1089466183 11:118688003-118688025 AGCTGGGGCCAGGTGAGGAGGGG + Intergenic
1089500654 11:118929554-118929576 CGGAGGGGGTAGAGGAGAAGGGG - Intronic
1089585905 11:119509347-119509369 GGGTGGGGGTGGGGGGGAAGAGG + Intergenic
1089666310 11:120022343-120022365 AGCTGAGTGCAGGGGAGAGGTGG - Intergenic
1089718470 11:120388094-120388116 ACCTGGGGATAGGTGAGGAGGGG - Intronic
1089775385 11:120832041-120832063 AGCAGGGGGTGGGGGAGAGAGGG - Intronic
1089927711 11:122276216-122276238 AGAAGGGGGGAGAGGAGAAGAGG + Intergenic
1090039905 11:123281613-123281635 GTCGGGGGGTAGGGGACAAGGGG + Intergenic
1090136498 11:124204484-124204506 TGCTGGGGGTGGGGGAGGAGTGG + Intergenic
1090170502 11:124598498-124598520 AGCTGGGGGAAGAGAGGAAGTGG - Intergenic
1090184085 11:124725024-124725046 AGCTGGGGAGAGGGGAGGAGAGG - Intergenic
1090339972 11:126009213-126009235 AGCTGGAGGCGGAGGAGAAGTGG - Intronic
1090373155 11:126270814-126270836 AGCAGGGGGTAGGATGGAAGCGG + Intronic
1090639231 11:128716361-128716383 AGCTGGGGGTGGGGGTGCTGTGG + Intronic
1090922605 11:131219808-131219830 AGCTGGGGGAAGGGGGAATGGGG - Intergenic
1091027828 11:132157946-132157968 AGCTTGGGAGAGGGCAGAAGAGG - Intronic
1091107023 11:132932143-132932165 AGCTGGGGGGAGGGAAGAATGGG + Intronic
1091180866 11:133603357-133603379 AGCAGGGGGTGGAGGGGAAGAGG + Intergenic
1091223972 11:133946763-133946785 AGCTGGGGGTGGGGTGGAGGAGG - Intronic
1091358004 11:134953039-134953061 AGCTGGGGGTAGGAGAAACAGGG + Intergenic
1202816059 11_KI270721v1_random:46983-47005 AGCTCGGGGTCGGGGAGAGGGGG + Intergenic
1091443705 12:530994-531016 AGCTGGTGCTCTGGGAGAAGAGG + Intronic
1091622477 12:2099798-2099820 TGCTGGGGGTAATGGGGAAGCGG - Intronic
1092114790 12:5992348-5992370 AGCTGAGGGAAGGAGGGAAGAGG - Intronic
1092161716 12:6318724-6318746 AGCTGGGGGTGGGGGCGTAGGGG - Exonic
1092264090 12:6968020-6968042 ACCTGAGGGCAGGGGTGAAGAGG + Exonic
1092294819 12:7189685-7189707 GGCTTGGGGGAGGGGAGAAGAGG - Exonic
1092529385 12:9331900-9331922 GGCTGGGGGGAGAGGAGCAGAGG + Intergenic
1092776724 12:11950155-11950177 AGCTGGGAGCAGGGGAGACTTGG - Intergenic
1093297484 12:17409044-17409066 AGCTGGGGGTTGGAGAGATCGGG + Intergenic
1093894539 12:24562116-24562138 GGCTGGGGGTGGCGGAGAGGTGG - Intergenic
1093942548 12:25070271-25070293 AGCTGGGGGTTGGGGACAGGAGG - Intronic
1094108900 12:26839964-26839986 CGGTAGGGGTTGGGGAGAAGAGG + Intergenic
1094356980 12:29588425-29588447 AGCTGGGGCTAGAGGAACAGGGG - Intronic
1094444099 12:30510734-30510756 GGGTGGAGGTAGGGGAGAATGGG - Intergenic
1094558352 12:31525507-31525529 AGCTGAGTGAAGGGGAGAATGGG + Intronic
1095557386 12:43523456-43523478 AGGTGGGGGTGGGGGGCAAGTGG + Intronic
1095670092 12:44848533-44848555 GGATGGGGGTGGGGAAGAAGAGG - Intronic
1095787461 12:46125446-46125468 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1095829641 12:46570222-46570244 AGATGGGGGTGAGGGAGATGAGG + Intergenic
1095894987 12:47271019-47271041 AGTTCGGGGTTGGGGAAAAGAGG - Intergenic
1096103599 12:48983962-48983984 AGGAGGGAATAGGGGAGAAGGGG - Intergenic
1096256360 12:50064431-50064453 GGCTGGGGTCTGGGGAGAAGGGG - Intronic
1096606286 12:52768739-52768761 AGCTCGTGGTCTGGGAGAAGCGG + Exonic
1096647107 12:53044894-53044916 ATGTGGGGATAGTGGAGAAGGGG - Intergenic
1096665892 12:53164579-53164601 AGCGGGAGGGAGGGGAGAAAAGG + Intronic
1096693077 12:53332989-53333011 AGCTGTGGGGAGGGAAGGAGGGG + Intronic
1096782375 12:53998675-53998697 GGCTGGGGGGTGGGGAGAAAGGG - Intronic
1096977574 12:55708114-55708136 GGATGGGGTTGGGGGAGAAGGGG - Intronic
1097066253 12:56322835-56322857 AGTTGGGGGTATGGGGGATGGGG + Intronic
1097174865 12:57136639-57136661 AGCCTTGGGTGGGGGAGAAGGGG + Intronic
1097287885 12:57891674-57891696 AGCTGGGGAGAGGGGAGAAAGGG - Intergenic
1097578813 12:61428479-61428501 TGCTGGGGGTAGGGTGGGAGGGG + Intergenic
1097791671 12:63821918-63821940 AGCTGGGGGAAGGTGAGCGGGGG - Intergenic
1097842210 12:64332668-64332690 AGCTGTGGCTAGGGCAGGAGCGG - Intronic
1097882105 12:64695538-64695560 AGTTAGGGGTAGTGGAGAAAGGG + Exonic
1098691596 12:73496090-73496112 AGCTGGGGGAATGGGAGAGATGG + Intergenic
1098824595 12:75279243-75279265 AGCAGGGGGCAGGGAAGGAGTGG - Intronic
1099180373 12:79468691-79468713 ATCCGGGGGTGGGGGGGAAGAGG + Intergenic
1099251109 12:80256242-80256264 AGATGGGAGAAAGGGAGAAGGGG - Intronic
1099974052 12:89527938-89527960 GGCTGGGGGTAAGGGAGACTGGG + Intergenic
1100142374 12:91634216-91634238 GGGTGGGGGTAGGGGAGAAGAGG - Intergenic
1100244910 12:92747885-92747907 GGCTGGGAAGAGGGGAGAAGGGG + Intronic
1100256339 12:92886636-92886658 GGAAGGGGGAAGGGGAGAAGGGG + Intronic
1100583655 12:95959614-95959636 ATCTGGGGGTATGGGGGAGGAGG - Intronic
1100964953 12:100002493-100002515 AGCTGGGGGTGGGGGATGACTGG - Intergenic
1101065864 12:101019666-101019688 AGCCTGAGGTAGGAGAGAAGAGG + Intronic
1101111384 12:101489896-101489918 AGCTGGAGGAGGGGGAGATGGGG + Intergenic
1101238504 12:102814128-102814150 GGCAGGGGGTTGGGGAGGAGAGG - Intergenic
1101495705 12:105252151-105252173 AGCTGGAGGGAGGAGGGAAGGGG + Intronic
1101745949 12:107541757-107541779 ACCTGAGGGTAGGGGATGAGGGG + Intronic
1101766041 12:107700342-107700364 GGCTGGGGGTGGGGGAAATGGGG - Intronic
1101829524 12:108246521-108246543 AGCTGGGGAAAGTGCAGAAGGGG - Intronic
1101909204 12:108849960-108849982 AGCATGGGGGAGGGGAGATGGGG + Intronic
1102219998 12:111187815-111187837 TGCTGGGGGCAGGGGTGATGGGG + Intronic
1102675377 12:114654525-114654547 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1102763184 12:115407466-115407488 AGGTGGGGGTGGAGGAGAAGAGG + Intergenic
1102803776 12:115761320-115761342 AGCTGGGGGTGGAGGAGAAAAGG - Intergenic
1102997493 12:117361365-117361387 AGTGGGGGCTAGGGGAGAGGGGG - Intronic
1103086008 12:118061831-118061853 AGCTGGGCTTAGGGGAAAATGGG + Intronic
1103896621 12:124277689-124277711 AGAGGGGAGAAGGGGAGAAGGGG - Intronic
1103992596 12:124809223-124809245 ACCTGGGTGAAGGGGAGACGGGG + Intronic
1104092850 12:125530330-125530352 AGTTGGGGGTCGGGGAGTGGAGG - Intronic
1104123872 12:125825249-125825271 ATTTGGGGGTAGGGGAGGGGAGG + Intergenic
1105028811 12:132868772-132868794 GGCTGGGGGGAGGGGACATGGGG + Intronic
1105480400 13:20770296-20770318 GGCTGGGGGGAGGGGAGAATAGG + Intronic
1105541743 13:21321783-21321805 AGCTGGGGGCAGTGGGGAATAGG + Intergenic
1105589958 13:21783228-21783250 AGCTGGGGGTAAGGGAGTGAGGG + Intergenic
1105962688 13:25356275-25356297 TCCTGGGGGCAGGGGAGAAAGGG - Intergenic
1105971371 13:25431889-25431911 AGCTGGGAGACAGGGAGAAGGGG - Intronic
1106124424 13:26888848-26888870 AGGTGGGAGTAGGGGTGATGGGG - Intergenic
1106440948 13:29769536-29769558 AGATGGGGGTTGGGGAGAGAGGG + Intronic
1106816560 13:33414639-33414661 AGGTGGGGGTGGGAGGGAAGTGG + Intergenic
1106837781 13:33654456-33654478 AGCCTGGGGAAGGGGAGAATGGG + Intergenic
1107126856 13:36855937-36855959 GGCTGAGGGAAGCGGAGAAGGGG - Intronic
1107133556 13:36920481-36920503 GGCTGGGGGTGGGGAAGAGGCGG - Intronic
1107507597 13:41050167-41050189 AACTGGGGGTAAGGGAGAAAGGG - Intronic
1108132404 13:47316767-47316789 TGTTGGGGGGTGGGGAGAAGGGG + Intergenic
1108160963 13:47638711-47638733 GGATGGGGGAAGGGGAGATGGGG + Intergenic
1108183561 13:47865937-47865959 AGGTGGTGGTAGAGGAGAGGAGG + Intergenic
1108269088 13:48740983-48741005 AGGTGGGGGTGAGGGAGAAAGGG + Intergenic
1108299692 13:49061536-49061558 AGGAGAGGGGAGGGGAGAAGGGG - Intronic
1108327995 13:49353804-49353826 AGATGGGGATAGGGGAGGAGAGG - Intronic
1108510808 13:51153991-51154013 GGCTGGGGGTAGGGGAAAATGGG - Intergenic
1108575874 13:51790161-51790183 AGCTGGGGGTGGGGTAGTGGAGG - Intronic
1109972986 13:69794575-69794597 AGCTGGGGGAAGGAGAGAGAAGG + Intronic
1110159963 13:72363943-72363965 GGCTATGGGTAAGGGAGAAGAGG + Intergenic
1110705714 13:78601176-78601198 AGTATAGGGTAGGGGAGAAGGGG - Exonic
1110780193 13:79456302-79456324 AGGTGGGGATAGGAGAGATGAGG + Intergenic
1110857811 13:80315707-80315729 GGGTGGGGGCAGGGGAGATGAGG + Intergenic
1110869569 13:80434761-80434783 GGGTGGGGGTAGGGGGTAAGGGG - Intergenic
1111199078 13:84910097-84910119 ATCTGGGGGTTGGGGGCAAGGGG + Intergenic
1111968584 13:94886351-94886373 ACATGGGGGTAGGGGGGAGGGGG - Intergenic
1112095379 13:96126887-96126909 AGCTGGGGGTAGAGGAAAGGAGG - Intronic
1112124877 13:96454053-96454075 AGCTAGGGGTGGGGGAGTGGTGG - Intronic
1112423522 13:99275636-99275658 ACCTGGGGGGTGGGTAGAAGAGG - Intronic
1112489726 13:99851009-99851031 AGCTAGGGGCAGGGGAAAATAGG + Intronic
1112568578 13:100572387-100572409 AGCTGGGGGACGGGGAAAATGGG + Intronic
1113362588 13:109645096-109645118 AGATGGGGGTGGGGTGGAAGCGG - Intergenic
1113744331 13:112732390-112732412 AGCAGGGAGTAGGAAAGAAGAGG - Intronic
1113809249 13:113128065-113128087 AACTGGGGGGAGGGGGGAAATGG + Intronic
1113895495 13:113761425-113761447 AGCAGGTGGGATGGGAGAAGTGG + Intronic
1113909692 13:113836279-113836301 AGAAGGGGGAGGGGGAGAAGGGG + Intronic
1113909700 13:113836294-113836316 AGAAGGGGGAGGGGGAGAAGGGG + Intronic
1114522566 14:23348305-23348327 AGCTGGGGGCAGGGGGGAAGGGG + Exonic
1114664272 14:24368945-24368967 AGCCGGGGGAAGGGGGGCAGCGG - Intronic
1114668885 14:24398623-24398645 TGTTGGGGGTAGGGGGGAGGTGG + Intergenic
1114704729 14:24713622-24713644 AGCTGCGGATGGGGGAGAAGTGG + Intergenic
1114804165 14:25814878-25814900 CGCTGGGGGCTGGGGACAAGGGG + Intergenic
1115121894 14:29947092-29947114 GGCAGGGGGTTGGGGAGACGAGG + Intronic
1115217326 14:31026228-31026250 AGCTGGGGGAAGGGCCGGAGAGG + Exonic
1115389811 14:32842022-32842044 AGGAGGGGGGAGGGGAGGAGAGG - Intergenic
1115522115 14:34243310-34243332 AGGAGGGGGTAGGGAAGAAAGGG + Intronic
1115587931 14:34833680-34833702 AGCTGGGGGAAGGATAGAATGGG + Intronic
1116707049 14:48315720-48315742 AGCAGTGGGTAGGGAGGAAGGGG - Intergenic
1116857416 14:49965231-49965253 AGCTGGGGGAAGGGGAAATGCGG + Intergenic
1117054899 14:51901728-51901750 AAGTGGGGGTTGGGGAGAATGGG + Intronic
1117213180 14:53522766-53522788 ATCAGGGGGTAGGGGACAAGAGG + Intergenic
1117376781 14:55124792-55124814 GGCTGGGGGAAGTGGAGAATTGG - Intronic
1117911254 14:60640412-60640434 TGGTGGGGGGAGGGGAGCAGTGG - Intergenic
1117958630 14:61142078-61142100 TGCTGTGGGAATGGGAGAAGGGG + Intergenic
1118030274 14:61812331-61812353 AGCTCGAGGTAGGGATGAAGCGG + Intergenic
1118171946 14:63396212-63396234 AGATGGGGGAGGAGGAGAAGGGG + Intronic
1118179626 14:63479288-63479310 TGCTGTGGGTGGGGGAGGAGGGG + Intronic
1118191324 14:63583220-63583242 AGCTGTGGGTATGGTAGAAAGGG + Intergenic
1118350272 14:64968777-64968799 GGCTGGGGGTTGGTGCGAAGGGG - Intronic
1118439344 14:65798720-65798742 AGTCGGGGGTAGCTGAGAAGGGG + Intergenic
1118564750 14:67127098-67127120 GGGTGGGGGGAGGGGGGAAGGGG + Intronic
1118697765 14:68401437-68401459 AGCACAAGGTAGGGGAGAAGCGG - Intronic
1118749403 14:68795374-68795396 AGCTGGGGGGACCGGAGGAGGGG + Intronic
1118973149 14:70654235-70654257 AGCTGGGGGATGAGGGGAAGAGG - Intronic
1119186823 14:72649040-72649062 AACTGGGAGAAAGGGAGAAGAGG - Intronic
1119212327 14:72841514-72841536 AGTTGGGGTTAGGGGAGAGATGG + Intronic
1119532598 14:75373458-75373480 AGTTGGGGAGAGGGAAGAAGGGG + Intergenic
1119562555 14:75602663-75602685 AGCTGAGGGAAGGAGAGAATGGG + Intronic
1119729917 14:76944698-76944720 GGCTGGGGGCAGGGGCGAGGGGG - Intergenic
1119796563 14:77403415-77403437 AGATGGGGGTAAAGGAGTAGGGG - Intronic
1119857992 14:77915329-77915351 GGCTGGGGGTAGGGGGGAGGGGG - Intronic
1120498047 14:85260564-85260586 GGATGGTGGTAGTGGAGAAGTGG + Intergenic
1121078384 14:91088101-91088123 AGCTGGGAGCCAGGGAGAAGAGG + Intronic
1121165372 14:91791189-91791211 AGGGGAGGGGAGGGGAGAAGAGG + Intronic
1121331600 14:93052972-93052994 GGGTGGGGGGAGGGGGGAAGGGG + Intronic
1121483658 14:94297247-94297269 AGCTGGGTGAAGGGTAGATGTGG - Intergenic
1121821353 14:96970043-96970065 TGATGGTGGTAGGGGAGAATGGG + Intergenic
1122137621 14:99644131-99644153 AGCTGGGGGTGGATGAGATGCGG - Intergenic
1122359444 14:101150866-101150888 AGGGGAGGGGAGGGGAGAAGAGG - Intergenic
1122505126 14:102227283-102227305 ACCTGTGGGTAGGGGAGTGGTGG - Intronic
1122637683 14:103138085-103138107 AGCTGGGGGTGGGGGAGGGCAGG + Intergenic
1122828435 14:104383570-104383592 AGGTGGGGGCTGGGGAGGAGAGG - Intergenic
1122959348 14:105087460-105087482 GGCTGGGGGTTGGGGAGGCGCGG - Intergenic
1123450566 15:20357078-20357100 TGATGGGGGTGGGGGAGGAGGGG + Intergenic
1123508697 15:20972810-20972832 TGCTGGGGTTAGGGGAGGTGTGG + Intergenic
1123565921 15:21546559-21546581 TGCTGGGGTTAGGGGAGGTGTGG + Intergenic
1123602178 15:21983846-21983868 TGCTGGGGTTAGGGGAGGTGTGG + Intergenic
1123919416 15:25060076-25060098 CGCTGGGGGAAGGGCCGAAGAGG - Intergenic
1123983004 15:25621016-25621038 GGCTGGGGGAAGAGGAAAAGGGG + Intergenic
1124059671 15:26278289-26278311 GGCTGGAGGAAGGGGAGAAGGGG - Intergenic
1124204172 15:27703237-27703259 AGCTGGGGCCAGGGAAGCAGTGG - Intergenic
1124910980 15:33920341-33920363 TGCTAGGGGTTGGGGAGATGGGG - Intronic
1124949142 15:34300456-34300478 GGCTAGGGGTAGGGGAGTAGGGG - Intronic
1125006945 15:34827343-34827365 TGCAGGGGGTAGGGGGAAAGGGG + Intergenic
1125181819 15:36887454-36887476 AGGTGGGGGTGGGGGCGAAAGGG + Intergenic
1125242240 15:37588597-37588619 GGCAGGAGGTAAGGGAGAAGTGG - Intergenic
1125464052 15:39933930-39933952 TGCTGGGGGAAGGGGAGCAAAGG - Intergenic
1125582744 15:40798335-40798357 AGCTGGGGGGAGGAGGGAACAGG + Intronic
1125921221 15:43527031-43527053 AGCTGGGGAGAGGGGTGCAGGGG - Exonic
1126216722 15:46163923-46163945 AGTGAGGGGCAGGGGAGAAGTGG + Intergenic
1126341876 15:47650016-47650038 AGGTGGTGGTAGCTGAGAAGAGG - Intronic
1126468876 15:48985820-48985842 GGTTGGGGGGAGGGGTGAAGCGG + Intergenic
1126517741 15:49554655-49554677 TGCTGGGGGTTGGGGAGGGGTGG + Intronic
1126838151 15:52688559-52688581 GGATGGGGGTTGGGGAGAAAAGG + Intronic
1126846631 15:52766404-52766426 AGCTGAGGGAACGGGTGAAGTGG + Intronic
1126944275 15:53801475-53801497 AGCTGGGGCTAGAGGAAATGGGG + Intergenic
1127222883 15:56899004-56899026 AGTCGGGGGTAGGGGAGCGGGGG + Intronic
1127518767 15:59722291-59722313 GGCTGGGGCATGGGGAGAAGAGG + Intergenic
1127851908 15:62920730-62920752 AGCTGGGGATGAGGGTGAAGAGG - Intergenic
1127872676 15:63086576-63086598 ACTTGGGGGTTGGGGAGAATGGG - Intergenic
1128391544 15:67185921-67185943 AGCAGATGGTAGTGGAGAAGTGG + Intronic
1128450957 15:67805601-67805623 AGCTGGGGGGAGCGAGGAAGCGG + Intronic
1128456149 15:67832510-67832532 AGTTGGGGGTAGGGGTGAAAGGG + Intronic
1128530440 15:68441536-68441558 AGCTGGGGGCAGAGGCCAAGTGG + Intergenic
1128577086 15:68783681-68783703 TGCTGGTGGCAAGGGAGAAGGGG + Intronic
1128716781 15:69914348-69914370 AGCAGGGGAAAGAGGAGAAGAGG - Intergenic
1129203880 15:74023796-74023818 ACCTGGGGTTACGGTAGAAGGGG + Intronic
1129442248 15:75589787-75589809 AGTGGGGGGTGAGGGAGAAGTGG + Intergenic
1129465359 15:75721693-75721715 CCCTGGGGGTGGGGGAGAGGGGG + Intergenic
1129674304 15:77624273-77624295 AGCTGGGGGCCGGGGAGTGGGGG - Intronic
1129701833 15:77772772-77772794 AGCTGGAGGTGGGGGGAAAGAGG - Intronic
1129722390 15:77884894-77884916 AGCTGAGGGTAGGGGAAGAAAGG - Intergenic
1129857563 15:78835493-78835515 AGCTGGGCGTAGGCCAGGAGTGG - Intronic
1130947891 15:88562673-88562695 TTCTGGGGGTAAGGGAAAAGGGG + Intergenic
1130954487 15:88617640-88617662 AGGTGGGGTTAGGGGGTAAGGGG - Intergenic
1131006792 15:88984967-88984989 TGCAGGGGGTAGGGGAAAAGGGG + Intergenic
1131111046 15:89765683-89765705 AGAGGAGGGGAGGGGAGAAGAGG + Intronic
1131570101 15:93525941-93525963 GTCAGGGGGTAGGGGAGAGGAGG - Intergenic
1131715926 15:95110906-95110928 AATTGGGGGTTGGGGAGAGGTGG - Intergenic
1131739252 15:95369691-95369713 AGTAGGGGGTAAGGGAGAACAGG - Intergenic
1132010088 15:98267863-98267885 AGCAGGGGGAAGGGGACAAGGGG - Intergenic
1132012266 15:98286437-98286459 GGCTGGGGGCAGAGGAGAAGAGG - Intergenic
1132026085 15:98405521-98405543 AGCCTGGGGCAGGGGAGGAGGGG - Intergenic
1132147213 15:99436150-99436172 AGCTGAGGATAGAGCAGAAGGGG - Intergenic
1132214768 15:100054336-100054358 AGCTGGGGTTAGGGGTGGAGGGG + Intronic
1132259607 15:100410967-100410989 GGCTGGGGAAAGGGGAGAAGTGG - Intronic
1132411712 15:101583861-101583883 CGTTGGGGGTCGGGGACAAGGGG - Intergenic
1202974285 15_KI270727v1_random:273652-273674 TGCTGGGGTTAGGGGAGGTGTGG + Intergenic
1132652878 16:1029408-1029430 AGCTCGGGGTAGGGGGAGAGTGG - Intergenic
1132715840 16:1289432-1289454 AGCTGGGAGTGGGGGGGAGGGGG + Intergenic
1132829681 16:1921357-1921379 GGCTGTGGGAAGGGGAGAAGAGG - Intergenic
1132847164 16:2005934-2005956 AGCTGGGGGTGGAGGAGCTGCGG + Intronic
1132888107 16:2191244-2191266 AGCTGAGGGCAGGGGAGTTGAGG + Intronic
1132931645 16:2461822-2461844 GGACGGGGGTAGGGGAGAACCGG + Intronic
1132941225 16:2509271-2509293 AGCTTGGGGTGAGCGAGAAGGGG + Intronic
1132987179 16:2773505-2773527 AGCTTGGGGGAGGGGAGAGGCGG + Intronic
1133112286 16:3555425-3555447 GGCTGGGGAAAGGGGAGAATGGG + Intronic
1133224546 16:4334677-4334699 AGGTAGGGGCTGGGGAGAAGAGG + Intronic
1133292964 16:4734758-4734780 GGCTGGGGGTGGGTGAGAGGAGG + Intronic
1133756741 16:8767544-8767566 AGCTGGAGGTAGGCGGGCAGTGG + Intronic
1133994481 16:10737902-10737924 AGCGGGTGGGAGGGGATAAGGGG - Intergenic
1134078697 16:11309967-11309989 AGCTGGGGGGAGGGAAGAGAGGG - Intronic
1134098694 16:11436407-11436429 AGCAGTGGGGAGGGGAGCAGTGG + Intronic
1134240762 16:12504400-12504422 GGCTGGGGGTTGGGGAGAAATGG - Intronic
1134246181 16:12541821-12541843 AGCTGGGAGAAGAGGGGAAGAGG - Intronic
1134556449 16:15169764-15169786 AGCTGCGGAGAGGGAAGAAGAGG + Intergenic
1134917029 16:18081477-18081499 AGCTGCGGAGAGGGAAGAAGAGG + Intergenic
1135294769 16:21269757-21269779 GGGTGGGGGTGGGAGAGAAGAGG - Intronic
1135558224 16:23454615-23454637 ATTTGGGGGGAGGGGAGAGGAGG + Intergenic
1135597290 16:23754548-23754570 TCCTGGGGGGAGGGGGGAAGAGG - Intergenic
1135724759 16:24845939-24845961 AGCTGGAGGAAGGGGAGGGGAGG - Exonic
1135842210 16:25887122-25887144 ACCTGGGGGTGGGGGAGAAAAGG + Intronic
1135926504 16:26698418-26698440 AGCTGGGGATGAGGGAGTAGTGG - Intergenic
1136067353 16:27768083-27768105 AGGTGGGGGTGGGGGGGAATGGG + Intronic
1136097389 16:27966970-27966992 AGCTGGGGGCAGAGCAGTAGTGG - Intronic
1136135721 16:28255827-28255849 GGCTGGGGGGAGGCGGGAAGGGG + Intergenic
1136395359 16:29989546-29989568 AGATGGGGGCAGCGGGGAAGAGG - Intronic
1136418314 16:30116846-30116868 GGCTGGGGGCAGGGGAGCAGGGG - Intronic
1136556447 16:31010341-31010363 AGCTTGGGGGTGGGGAGAATGGG - Intronic
1137877905 16:52014810-52014832 AGCAGAGGGGAGGAGAGAAGAGG - Intronic
1138112211 16:54333040-54333062 AACTGGGAGTGAGGGAGAAGTGG - Intergenic
1138242186 16:55436156-55436178 GGGTGAGGGAAGGGGAGAAGAGG + Intronic
1138256303 16:55565690-55565712 GGGTGGGGGAAGGGGAGAATGGG + Intronic
1138270301 16:55691209-55691231 AGAGGGGGGGAGGGGAGAGGGGG + Intronic
1138303507 16:55954025-55954047 AGCGGGGAGCAGGGGAAAAGTGG - Intronic
1138363967 16:56457379-56457401 AGCTGGGGGGAGGAGAGAAGAGG + Intronic
1138486552 16:57348876-57348898 AGTTGGGGATAGGGGAAAACGGG + Intergenic
1138806887 16:60100557-60100579 ACCTGGGGATAGGGGAGAAGTGG + Intergenic
1138885609 16:61074319-61074341 GGCTGGAGGGAGGGGAGAATGGG - Intergenic
1139807995 16:69585846-69585868 AGCTGGGGGTTGGGGAGGAATGG + Intronic
1140200618 16:72891778-72891800 GGCTGGGGGTTGGGGACAGGTGG - Intronic
1140734787 16:77888682-77888704 CGCTGGCGGTACGGGAGTAGAGG - Intronic
1140831420 16:78755044-78755066 GTCTGGGGGTAGGGGGAAAGGGG + Intronic
1141107170 16:81243076-81243098 GGCTGGGGTAAGGGGAGAAGGGG + Intronic
1141124716 16:81392897-81392919 TGCTGGGGGTCGGGGGGAGGTGG - Intergenic
1141138105 16:81479786-81479808 AGCCGGGGGTAGGGGGAAAGAGG - Intronic
1141316615 16:82968425-82968447 AGCTGGTAGTAGGGATGAAGGGG + Intronic
1141513028 16:84524943-84524965 AGCTGGGGTAAGGTGAGGAGGGG - Intronic
1141701424 16:85643950-85643972 AGCTGTGAGTAGGGGAAATGTGG - Intronic
1141758353 16:86010148-86010170 ATCAGGGGGTGGGGGACAAGGGG + Intergenic
1141766689 16:86063761-86063783 AGATGGGGGGAGGGAAGAAGAGG + Intergenic
1141787275 16:86210006-86210028 AGCTGGGGGCTGGGGAGAGGTGG - Intergenic
1141952940 16:87350756-87350778 AGCTGAGGGGAGGGGATAGGAGG - Intronic
1141973091 16:87495821-87495843 AGATGGGGGTAGGGGAGGGGTGG - Intergenic
1141978512 16:87534511-87534533 AGGTTGGGGTTGGGGAGCAGGGG + Intergenic
1142157445 16:88539133-88539155 AGCTGGGGGGAGTGGGGAGGGGG - Intergenic
1142161377 16:88559328-88559350 GGCTGGGGGGAGGGGAGGAGAGG + Intergenic
1142359267 16:89619066-89619088 AGCTGCAGGGAGGGGAGCAGGGG - Intronic
1142359279 16:89619096-89619118 AGCTGCAGGGAGGGGAGCAGGGG - Intronic
1142359461 16:89619490-89619512 AGCTGCAGGGAGGGGAGCAGGGG - Intronic
1142597026 17:1034856-1034878 CGCCGGGTGTGGGGGAGAAGGGG + Intronic
1142624974 17:1186257-1186279 AGCAGAGGGCAGGTGAGAAGAGG - Intronic
1142688853 17:1592841-1592863 GGCTGGGGGTTGGGGAGCAGGGG + Intronic
1142759418 17:2034518-2034540 AGCAGGGGATGGGGGAGCAGGGG - Intronic
1142831757 17:2554302-2554324 GGCTGGGGGGAGGGGAGAATGGG - Intergenic
1142937312 17:3345937-3345959 AAGTGGGGATGGGGGAGAAGGGG + Intergenic
1143003194 17:3808632-3808654 AGCAGAGGGCAGGGGAGATGGGG + Intergenic
1143164206 17:4889844-4889866 ATCTGGGGGTGGGGGAGAGAAGG - Intronic
1143173475 17:4943521-4943543 TGAGGGGGTTAGGGGAGAAGAGG + Intronic
1143173941 17:4945862-4945884 AGCTGTGGGGAGCGGTGAAGGGG + Exonic
1143216600 17:5229820-5229842 AGATGGGGGAAGGGGAGGGGAGG - Intronic
1143268650 17:5659320-5659342 AGTTGGGGGAAGGAGAGGAGAGG - Intergenic
1143514389 17:7412085-7412107 AGATGGGGGTCGGGGGGAGGTGG - Intronic
1143514897 17:7414642-7414664 ACCTGGGAGTAGAGAAGAAGAGG - Exonic
1143554365 17:7651466-7651488 GGCGGGGGGTTGCGGAGAAGCGG - Exonic
1143598939 17:7931641-7931663 AGCTGGGGTTTGGAGAGGAGGGG + Intronic
1143642501 17:8207123-8207145 AGCTGGGGGTGAGGGAGCAGAGG + Intronic
1144136464 17:12300182-12300204 AGATGGGGGTAGGGAAGAGGAGG - Intergenic
1144481114 17:15629828-15629850 AGCAGGGGGCTGGAGAGAAGTGG - Intronic
1144517655 17:15929857-15929879 GGCTGGGGGAAGGGGAAAATGGG + Intergenic
1144556400 17:16286362-16286384 AGCTGGGGAGAGGAAAGAAGGGG + Intronic
1144739016 17:17570859-17570881 ATCCGGGGGCAGGTGAGAAGAGG + Intronic
1144777024 17:17789979-17790001 ACCTGGGGGCAGGGAAGAAGTGG - Intronic
1144852359 17:18250521-18250543 AGCTGAGAGTAGGGTGGAAGGGG - Intronic
1144917195 17:18733909-18733931 AGCAGGGGGCTGGAGAGAAGTGG + Intronic
1145096852 17:20036692-20036714 AACTAGGGGTAGGGGGGCAGTGG - Intronic
1145246889 17:21275456-21275478 AGCTGACGGGAGAGGAGAAGCGG + Intergenic
1145318031 17:21746470-21746492 AGCAGGGGCTAGGGAACAAGTGG + Intergenic
1145370485 17:22302963-22302985 AGGGGGCGGCAGGGGAGAAGGGG - Intergenic
1145773243 17:27508559-27508581 AACTGAGGGTTGGAGAGAAGAGG - Intronic
1145779542 17:27553239-27553261 AGCTGAGGGTAAGAGAGAGGTGG - Intronic
1145825354 17:27872926-27872948 GGCTGGGGGTAGGGGTGGGGAGG - Intronic
1145843288 17:28014485-28014507 GGCTGGGGGCAGGAGAGAATAGG - Intergenic
1146113184 17:30110585-30110607 GGCTGGGGGTAGGGGAAAGTGGG - Intergenic
1146208828 17:30926228-30926250 AGCTAGGGTGAGGGCAGAAGTGG - Intronic
1146256947 17:31397185-31397207 GGCTGGAGGAAGGGGTGAAGGGG + Intronic
1146283702 17:31560430-31560452 AGCTTGGGGGTGGGGAGAACGGG + Intergenic
1146511810 17:33456064-33456086 AGCTGGGGGTTGGGGGGAGTTGG - Intronic
1146589979 17:34120524-34120546 TTCAGGGGGTAGGGGAGAAGAGG + Intronic
1146794652 17:35772785-35772807 AGTTGGGGGTGGGGGAGCAGTGG + Intronic
1146795600 17:35778290-35778312 GGCTAGGGGAGGGGGAGAAGGGG + Intronic
1146834492 17:36099255-36099277 GGTTGAGGGTGGGGGAGAAGGGG + Intergenic
1146849103 17:36206441-36206463 GGTTGAGGGTGGGGGAGAAGGGG + Intronic
1146911198 17:36649607-36649629 TGGTGGGGGTTGGGAAGAAGGGG + Intergenic
1146953644 17:36923236-36923258 AGGAGAGGGGAGGGGAGAAGAGG + Intergenic
1147023390 17:37558284-37558306 TGCTAGGGGTAGGGGAGAGAAGG - Intronic
1147376500 17:40025524-40025546 AGCTGGAGGGAGGGGAAAATAGG + Intronic
1147383913 17:40070955-40070977 AGATGGGGGATGGGGAGAAGGGG - Intronic
1147769738 17:42859246-42859268 TGCTGGGGGAAGGGGAGCAAAGG + Intergenic
1147935462 17:44008096-44008118 AGCAGGGTGTAGGGGTGAGGGGG - Intronic
1147944876 17:44075240-44075262 AGCTGGGGGTCGGGGTGGGGAGG + Intronic
1147996545 17:44363107-44363129 TGAAGGGGGGAGGGGAGAAGGGG - Intronic
1148018503 17:44538917-44538939 GGGTGGGGGTAGGGGAGGGGAGG - Intergenic
1148104494 17:45112189-45112211 AGCTCGGGGTCGGGGCCAAGTGG + Exonic
1148218662 17:45847701-45847723 AGCTGGGGGAGGGGGAGGGGTGG + Intergenic
1148561672 17:48610113-48610135 AGCTGGGAAGGGGGGAGAAGGGG + Intronic
1148567743 17:48643505-48643527 AGCTGGGGAAAGGGCAGAGGAGG + Intergenic
1148605830 17:48928225-48928247 AGCTGGGGGCACGGGGGAGGCGG - Exonic
1148661264 17:49334956-49334978 AGCTGGGAGTAGGGAGGAGGGGG + Intronic
1148691966 17:49533836-49533858 AATTATGGGTAGGGGAGAAGTGG - Intergenic
1148698211 17:49573743-49573765 AGCTGGGGGCAGGGGCGAGAGGG - Intergenic
1148769132 17:50056774-50056796 TGCTGGGGGTTGGCGGGAAGTGG + Intronic
1149020322 17:51955823-51955845 ATCAGGGGGTAGGGGGAAAGGGG + Intronic
1149201513 17:54191073-54191095 AGTTGGGGGTAGGAAGGAAGTGG - Intergenic
1149576380 17:57716303-57716325 GGCTGGGGGGATGGGAGATGGGG - Intergenic
1149596993 17:57870096-57870118 AGTTGGGGGTGGAGGAGCAGAGG - Intronic
1149603338 17:57907467-57907489 AAGTGGGGGTAAGGGATAAGAGG + Intronic
1149750939 17:59144759-59144781 CGCTGGGGGGAGGGGAAAAGAGG + Intronic
1149864433 17:60142802-60142824 AGTTGGGGGTTGGGGGGATGGGG - Intergenic
1149897645 17:60441367-60441389 AGCTGGGGATAGGGGAAAATGGG - Intergenic
1150302572 17:64058790-64058812 ATCTGGGGGGAGGGGTGAAATGG - Intronic
1150422985 17:65055898-65055920 AGCAGGGGATGGGGGTGAAGCGG + Intronic
1151116471 17:71740968-71740990 AGCTGGGGGAAGGGGAGAGGGGG - Intergenic
1151259850 17:72907874-72907896 AGCGGGGCGTAGGGGAGAAGTGG + Intronic
1151316136 17:73323917-73323939 GCCTGGGGGTGGGGGACAAGGGG - Intergenic
1151386377 17:73757802-73757824 AGGTAGGGGAAGGGGAGGAGAGG - Intergenic
1151451341 17:74200135-74200157 GGCAGGGGGTCGGGGAGAAGAGG - Intergenic
1151627841 17:75288727-75288749 GGGTGGGGGTGGGGGAGGAGGGG + Intronic
1151652107 17:75476415-75476437 GGCGGGAGGGAGGGGAGAAGAGG - Intronic
1151676618 17:75602045-75602067 AACTGGGGGTGGGGGAGCGGGGG + Intergenic
1151939901 17:77286002-77286024 AGACGGGGCTGGGGGAGAAGAGG - Intronic
1152134065 17:78493860-78493882 AGCTGGGGGCCGAGGAGGAGGGG - Intronic
1152155730 17:78631666-78631688 AGAAGAGGGGAGGGGAGAAGAGG + Intergenic
1152155740 17:78631696-78631718 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1152155750 17:78631726-78631748 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1152155775 17:78631786-78631808 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1152232827 17:79123393-79123415 AGCTGGGGGTAGAGGGGGTGGGG - Intronic
1152337872 17:79708256-79708278 TGATGGGGGTGGGGGAGGAGGGG - Intergenic
1152569972 17:81117497-81117519 AGCTGGGGGCAGGGCAGCACAGG - Exonic
1152908380 17:82982931-82982953 AGCTGGGGGTGGAGGAGATGGGG + Intronic
1153192962 18:2562760-2562782 AGCTGGGGGACGGGGGGATGGGG + Intronic
1153207035 18:2714845-2714867 TGCTGGGGGTAGGGGGCAGGGGG - Intronic
1153314687 18:3710356-3710378 AGCTGGGTGTGGAGGAGAAAGGG - Intronic
1153807731 18:8723980-8724002 GGCTGGGGAGAGGGGAGAAGCGG + Intronic
1154393568 18:13965988-13966010 GGCTGGGGGATGGGGAAAAGGGG + Intergenic
1155041070 18:22066084-22066106 AGCTGGGGGTAGGTGGGGTGGGG - Intergenic
1155058252 18:22204416-22204438 AGAGGGGGGGAGGGGAGGAGAGG - Intergenic
1155090857 18:22509481-22509503 TGCTGGGGGTGGGGGGGAGGCGG - Intergenic
1155144079 18:23069107-23069129 AGGAGGGGGTGGGGGGGAAGAGG + Intergenic
1155149732 18:23113516-23113538 GGCTGGGGGGAGGAGGGAAGGGG - Intergenic
1155215493 18:23639897-23639919 GGCTGGGGGAAGGGGAGTATGGG + Intronic
1155217174 18:23653618-23653640 AGGGGAGGGGAGGGGAGAAGAGG - Intronic
1155502771 18:26503841-26503863 AGCTGGGGGTGGGGGTGGGGTGG + Intronic
1155663478 18:28279254-28279276 AGCTGGAGGTTGGGGGGATGAGG - Intergenic
1156457280 18:37301911-37301933 AGCAGGGGGAAGGGGAAAGGTGG - Intronic
1156504018 18:37577647-37577669 AGCTGGGGGCAGTGCAGATGAGG + Intergenic
1156828775 18:41465944-41465966 TGTTGGGGGTAGGGTAGAATGGG - Intergenic
1157124024 18:44938062-44938084 AGCAGGGAGTGGGGGAGCAGGGG + Intronic
1157127518 18:44971014-44971036 GGGTGGGGGAAGGGGAGAGGGGG - Intronic
1157194086 18:45606234-45606256 AGATTGGGGCAGGGGAGAGGAGG - Intronic
1157214522 18:45771627-45771649 GGGTGGGGGTAGGGGTGATGTGG - Intergenic
1157233409 18:45940443-45940465 AGGTGGGGAAAGGGCAGAAGCGG + Intronic
1157363751 18:47044317-47044339 GGCTGGGGGCAGGGGAGATGTGG + Intronic
1157499791 18:48181584-48181606 AGCTGTGGGTAGGGAGGCAGGGG - Intronic
1157516692 18:48316347-48316369 GGCTGGGGGTGGAGGAGGAGTGG - Intronic
1157704740 18:49795466-49795488 AGATGGAGGAAGGGAAGAAGTGG - Intronic
1157774967 18:50386476-50386498 AACTGTGTGCAGGGGAGAAGCGG - Intronic
1158410083 18:57197855-57197877 AGCTGGGGTGATTGGAGAAGTGG - Intergenic
1158488997 18:57893344-57893366 AGCAAGGTATAGGGGAGAAGGGG - Intergenic
1158508995 18:58073692-58073714 GGCTGGTGGGAGGGGAGAATAGG + Intronic
1158741022 18:60142297-60142319 AGCTGGGGGAAGGGGAAAATGGG + Intergenic
1158809917 18:61020506-61020528 GGGTGGGGGTAGGGGAGATTTGG + Intergenic
1158811498 18:61042607-61042629 GGCTGGGAGTAGGGGAAAATGGG - Intergenic
1158922312 18:62206802-62206824 AGCTGCGGGGCGGGGAGAGGGGG - Intronic
1159014174 18:63088314-63088336 TGCTGGGGGCAGTGGGGAAGGGG - Intergenic
1159075208 18:63673509-63673531 GGCTGGGGGAATGGGAGAATAGG + Intronic
1159145664 18:64451318-64451340 GGGTGGGGGGAGGGGGGAAGGGG - Intergenic
1159379877 18:67643402-67643424 AGGAGAGGGGAGGGGAGAAGAGG - Intergenic
1159930514 18:74308215-74308237 AACAGGGAGTAGGGGAAAAGTGG + Intergenic
1160089290 18:75811109-75811131 GGCTGGGAGTAGGGAAGAAAAGG + Intergenic
1160335324 18:78033851-78033873 AGCTGCCGGGAGGGGAGAGGAGG - Intergenic
1160659557 19:291643-291665 AGCGGCGGGCAGGGGAGCAGCGG + Intergenic
1160701029 19:507505-507527 AGATGGCGGCAGTGGAGAAGCGG + Exonic
1161030777 19:2056820-2056842 AGGAGGGGGAAGGGGAGGAGGGG - Intergenic
1161138234 19:2633307-2633329 TGCTGGGGGCAGGGGACATGGGG - Intronic
1161396463 19:4047352-4047374 GGCTGGGGGGAGGGTAGACGTGG - Exonic
1161397408 19:4052035-4052057 AGCACGGGGTGGGGGAAAAGAGG + Intronic
1161564283 19:4991251-4991273 AGATGGGGGTAGGGCAGGGGGGG - Intronic
1161849461 19:6731110-6731132 AGCTGGGGGACGGGGCGGAGTGG + Exonic
1161915464 19:7224922-7224944 AGGTGGGGGTGGGGGAACAGAGG + Intronic
1161961587 19:7526418-7526440 AGCTGGGGAGAGGGTAGTAGAGG - Exonic
1162079640 19:8210234-8210256 CGCTGTGGGTAGGAGAGATGGGG + Intronic
1162084626 19:8241011-8241033 GGGTGGGGTGAGGGGAGAAGAGG + Intronic
1162545032 19:11324142-11324164 TGCTGGGGGTTGGGCGGAAGGGG - Exonic
1162601175 19:11670985-11671007 AGCTGGGGGGAAGGGAGACTGGG - Intergenic
1162605864 19:11707503-11707525 ACCTGGGGGTGGGAGAGAATAGG + Intergenic
1162739359 19:12765315-12765337 AGCTGTGGGATGGGAAGAAGTGG - Intronic
1162770132 19:12944368-12944390 TCCTGGGGGCAGGGGAGAAAGGG - Exonic
1162877076 19:13628321-13628343 AGGAGAGGGGAGGGGAGAAGAGG + Intergenic
1162917860 19:13883772-13883794 AGCCGAGGGGAGGGGAGAAGCGG - Intronic
1163096676 19:15063205-15063227 AGGAGGGGGGAGGGGAGAGGGGG - Intergenic
1163206964 19:15810653-15810675 GGCTGGGGTGAGGGGAGAATGGG + Intergenic
1163334448 19:16661548-16661570 AGCTGGGGGAGGGGAAGGAGAGG + Intronic
1163371894 19:16905785-16905807 TGCTGGGGGTAGGGGTGGAGTGG + Intronic
1163507794 19:17718567-17718589 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1163642658 19:18470320-18470342 AGATGGGGGTTGGGGATGAGGGG + Intronic
1163701870 19:18790207-18790229 GGCGGGGGGTGGGGGGGAAGGGG - Intronic
1163747984 19:19059341-19059363 TGCTGGGGGCAGGGGAGACGGGG - Intronic
1163910155 19:20182408-20182430 AGCTGTGGGGAGGGCACAAGAGG - Intronic
1163930603 19:20387286-20387308 AGCTGTGGGGAGGGCACAAGAGG - Intergenic
1164234784 19:23322822-23322844 AGGAGGAGGTGGGGGAGAAGTGG - Intronic
1164234792 19:23322845-23322867 AGGAGGAGGTGGGGGAGAAGTGG - Intronic
1164234800 19:23322868-23322890 AGGAGGAGGTGGGGGAGAAGTGG - Intronic
1164476445 19:28579373-28579395 GGCTGGGGTTGGGGGAGAGGGGG - Intergenic
1165001568 19:32767671-32767693 AGCTGGGGGGCAGGGAGAAGAGG + Intronic
1165156546 19:33792322-33792344 GGGTGGGGGTTGGGGAGGAGAGG - Intergenic
1165743519 19:38217378-38217400 AGCTGGGGGTGGGGGTGGGGGGG - Intronic
1166015308 19:39974834-39974856 AGCTCGGGGCAGGGGCGAAAGGG - Intronic
1166109617 19:40614123-40614145 AGGTAAGGGGAGGGGAGAAGCGG - Intronic
1166352091 19:42204077-42204099 AGGTGGGGGTGGGGGACAAGAGG - Intronic
1166684807 19:44789983-44790005 AGCTGGGGGAAGGGAAGAGAGGG - Exonic
1166732856 19:45068399-45068421 GGCTGGGGAGGGGGGAGAAGAGG - Exonic
1166759960 19:45218151-45218173 AGGTGGGGGTGGGGGAAAAGAGG - Intronic
1166788254 19:45382468-45382490 AGTTGGGGGTTGGGGAAAAGGGG - Intronic
1166975697 19:46603945-46603967 GGCTGGGGGTGGGGGCGAGGAGG - Intronic
1166996306 19:46721220-46721242 AGCAGGGACTTGGGGAGAAGAGG + Intronic
1167075055 19:47243369-47243391 AGCTGGAGGTGAGGGAGACGGGG - Intergenic
1167198156 19:48044945-48044967 AGGTAGGGTTAGGGGAGGAGGGG + Intergenic
1167230329 19:48278980-48279002 AGCTGGGTGAAGGGGAGAATGGG + Intronic
1167287010 19:48603910-48603932 AGCTGGGGGTCGGGGAGTAGGGG + Exonic
1167297852 19:48662269-48662291 GGCTGGGGACAGGGCAGAAGAGG + Intronic
1167345679 19:48944336-48944358 AGCTGGAGGGAGAGAAGAAGTGG - Exonic
1167449022 19:49556285-49556307 TGCTGGGGGAAGGGGAGGGGTGG + Intronic
1167462931 19:49635851-49635873 ACCTGGGGGTAGGGGGGACACGG + Exonic
1167503652 19:49860593-49860615 ACCTGGGGGCAGGGGTGCAGTGG - Exonic
1167605818 19:50480863-50480885 GGCTGGGGCAAGGGGAGAGGAGG - Exonic
1167648884 19:50719268-50719290 GGCTGGGGGTACGGGTGAGGTGG - Intronic
1167660883 19:50795167-50795189 AGCTGGGGGTAGGGAAGCCCTGG - Exonic
1167900358 19:52617029-52617051 ATCAGGGGGTAGGGGGCAAGGGG + Intronic
1168241764 19:55092325-55092347 AGCTGGGGGTCAGGTAGAGGAGG + Exonic
1168261356 19:55196840-55196862 AACTGGGGGTAGGGGTGGAGGGG - Intronic
1168615581 19:57834381-57834403 TGCTGGGGGATGGGGAGGAGTGG + Intronic
1168621203 19:57881066-57881088 TGCTGGGGGATGGGGAGGAGTGG - Intronic
925267518 2:2576532-2576554 AGGGGAGGGAAGGGGAGAAGTGG + Intergenic
925622435 2:5807207-5807229 AGATGGGGGTGGGGGAGGTGGGG - Intergenic
926170409 2:10549622-10549644 AGCTGGAAGAAGGGGAGAAGAGG + Intergenic
926682616 2:15675386-15675408 AGGTGGAGGGAGGGGAGATGAGG + Intergenic
926846613 2:17147866-17147888 AGCACAGGGAAGGGGAGAAGGGG + Intergenic
927038415 2:19204191-19204213 AGCAGGGGGTGAGGGAGAGGAGG - Intergenic
927218859 2:20688127-20688149 TCTTGGGGGGAGGGGAGAAGGGG + Intronic
927219512 2:20694294-20694316 CTCTGAGGGGAGGGGAGAAGTGG - Intronic
927395351 2:22643983-22644005 GTCTGGGGGTAGGGGGCAAGGGG + Intergenic
927428612 2:23007987-23008009 AGCTGTGGGTGGGGCTGAAGGGG + Intergenic
927438457 2:23090602-23090624 AGGAGAGGGGAGGGGAGAAGAGG + Intergenic
927553242 2:24016694-24016716 AGCCAGGAGCAGGGGAGAAGTGG - Intronic
927809213 2:26172758-26172780 AGCTGGCGGGAGGGGAGGCGGGG + Intergenic
927880660 2:26687910-26687932 TGCTGTGGGTTGGGGAGAAAGGG - Intergenic
927917195 2:26944851-26944873 GGATGGGGGTCTGGGAGAAGTGG + Intronic
928105820 2:28470035-28470057 AGGAGGGGGAAGGGGAGGAGGGG + Intronic
928282194 2:29957687-29957709 GTCTGGGGGAGGGGGAGAAGTGG - Intergenic
928391847 2:30916507-30916529 AGCTGGGGGCTGAGGAGGAGGGG + Intronic
929003229 2:37368380-37368402 AGCTGGGGTTAGTGAAGACGTGG - Intronic
929145936 2:38707084-38707106 AGTTGTGAGTAGGGGAGGAGGGG + Intronic
929215064 2:39403779-39403801 AGCTGGGGTTAGGGGAGGGGTGG - Intronic
929301374 2:40307376-40307398 GGCTGGGAGAAGGGGAAAAGGGG + Intronic
929444593 2:41992189-41992211 AGGAGAGGGTAGGGGAGAGGAGG + Intergenic
929546940 2:42861979-42862001 AGCGGGGGGTGGGGGAGATGGGG - Intergenic
929564449 2:42975663-42975685 AGCTGGGGCTTGGGGAGGAGGGG + Intergenic
929565188 2:42979548-42979570 AGCTGCGGGTTGCAGAGAAGAGG + Intergenic
929857248 2:45647652-45647674 AGCTGGAGGAAGCGGGGAAGGGG - Intergenic
929885130 2:45871421-45871443 ATCTGGGGTCAGGGGTGAAGGGG + Intronic
929963791 2:46518340-46518362 GGGTGGGGGTAGGGGAAATGGGG + Intronic
930109739 2:47668262-47668284 AGGTGGGTGTGGGGGAGGAGGGG + Intergenic
930133734 2:47879765-47879787 AGCTAGGGGAAGGGGAAAAAGGG - Intronic
930233385 2:48865364-48865386 AGCTGGGGTTAAAGGAGAACTGG + Intergenic
930346531 2:50189361-50189383 TGCTGGGGGTTGGGGGGTAGGGG + Intronic
930602443 2:53457748-53457770 AGTTGGGGGTAGAGGTGAAATGG - Intergenic
931528396 2:63185394-63185416 ATTTGGGGGTGGGGGAGAGGGGG - Intronic
931551193 2:63448850-63448872 TGCTAGGGGTAGGGGAAATGGGG + Intronic
931643109 2:64398681-64398703 AGCTGAGGGAAGGAGGGAAGTGG + Intergenic
931651181 2:64470270-64470292 AGTTGGGGGTAGGAGAGAGGGGG + Intergenic
931703016 2:64924204-64924226 AGATGGGGATGGGGAAGAAGAGG + Intergenic
931810018 2:65845592-65845614 AGCAGGAAGTAGGGGAGAGGTGG - Intergenic
931963224 2:67504477-67504499 ATCATGTGGTAGGGGAGAAGAGG + Intergenic
932090050 2:68798369-68798391 AGCTGAGGGCAGGAGAGATGAGG - Intronic
932208199 2:69902876-69902898 AGAGGGAAGTAGGGGAGAAGCGG - Intronic
932263684 2:70347786-70347808 ACCTGGGGGCAGGGGAGCTGGGG + Intergenic
932269003 2:70392487-70392509 CAGTGGGGGAAGGGGAGAAGAGG + Intergenic
932375300 2:71230103-71230125 GGCTGGGGTAAGGGGAGAATGGG - Intergenic
932418934 2:71590135-71590157 AGCTGGGGCTCGGGGGGAGGTGG - Intronic
932440543 2:71731877-71731899 AGGTGTGGGTAGGAGAGAGGGGG - Intergenic
932475943 2:72005988-72006010 AGGTGGGGGTAGGAGAGGAGAGG - Intergenic
932488515 2:72103582-72103604 AGCAGAGGGTAGGGGTGAGGGGG - Intergenic
932773515 2:74514400-74514422 GGCTGGGGGTAGGGCAGGGGCGG - Intronic
932891078 2:75598000-75598022 AACTGGGGGGAGGGGCGAGGAGG - Intergenic
933328187 2:80864557-80864579 AGGTGGAGGAAGAGGAGAAGAGG - Intergenic
933657144 2:84898307-84898329 GGCTGGGGGAAGGGGAGAATGGG - Intronic
933747801 2:85583651-85583673 AGCTTGGAGTAGTGGAGAACAGG + Intergenic
933879097 2:86650447-86650469 ATCTGTGGGGAGGGGAGAATGGG + Intronic
933898583 2:86833488-86833510 AGCGGAGGGGAGGGGAGGAGAGG - Intronic
933990540 2:87631072-87631094 GGCTGGGGAGAGGGGAGAATGGG + Intergenic
934518319 2:95003440-95003462 AGCTGGAAGCAGGAGAGAAGTGG + Intergenic
934562643 2:95321000-95321022 GGCTGGGGGTCAGGGAGGAGAGG - Intronic
934574322 2:95390776-95390798 AGTTGGGGGCTGGGGAGAGGTGG + Intergenic
934963798 2:98702174-98702196 AGCTGAGGGCAGGGCAGATGAGG - Intronic
935174905 2:100641195-100641217 GGCTCGGGGGAGGAGAGAAGTGG + Intergenic
935210366 2:100934748-100934770 AGCTGTGGTTGGGGGAGATGGGG + Intronic
935215061 2:100969343-100969365 GGGTGGTGGTAGGGGACAAGTGG - Intronic
935367523 2:102309968-102309990 AGGTGGGGGTGGGGGAGGTGAGG + Intergenic
935595616 2:104874991-104875013 GGCTGGGGGCAGGGGAAAATGGG - Intergenic
936076344 2:109404114-109404136 AGCTGGTGGTGGGTAAGAAGTGG + Intronic
936250695 2:110866247-110866269 AGCTGGAGGCAGGAGAGGAGGGG + Intronic
936279771 2:111128095-111128117 AGCTGGGGGGAGGGGGAAATGGG - Intronic
936303306 2:111319752-111319774 GGCTGGGGAGAGGGGAGAATGGG - Intergenic
937064679 2:119009021-119009043 GGCTGGGGGTGGGAGATAAGAGG - Intergenic
937078654 2:119125130-119125152 GGCTGGGGGCAGGTGAGATGTGG - Intergenic
937277933 2:120697771-120697793 TGCTGGGGGCTGGGGAGATGGGG + Intergenic
937317825 2:120943277-120943299 AACTGGGGGAAGGGATGAAGAGG + Intronic
937365495 2:121257957-121257979 TGCTGGGGGTAGGGGTGACCTGG - Intronic
937811171 2:126200980-126201002 AGATGGGGCTGGGGGACAAGAGG + Intergenic
937938129 2:127262628-127262650 AGCTGGGGGTTGGGAACAAGAGG + Intronic
937986835 2:127641800-127641822 AGCAGGGGGAAGAGGAGAGGTGG + Intronic
938102219 2:128504948-128504970 AGGTGGGAGGAGGGGATAAGGGG - Intergenic
938190706 2:129277618-129277640 AGCTGAGGGTAGGTGACCAGTGG - Intergenic
938584512 2:132676339-132676361 AGCTGGGGGAAGGGAAATAGGGG - Intronic
938604197 2:132875352-132875374 AGCAGCGGGTAGGTGAGCAGAGG - Intronic
938619120 2:133031231-133031253 TGCTGGGGGTAGGGGAGGGATGG - Intronic
939476007 2:142687142-142687164 AGCAGAGGGGAGGGGAGGAGAGG + Intergenic
939504312 2:143026910-143026932 AGCTGGGCATCGGAGAGAAGTGG - Intronic
939528633 2:143328580-143328602 GTCAGGGGGTAGGGGAGTAGGGG + Intronic
939622007 2:144431821-144431843 TGCTGGGGGTAGGGGGGAGTGGG + Intronic
939957293 2:148537890-148537912 AGTGGGGGGTGGGGGGGAAGGGG - Intergenic
940049629 2:149448536-149448558 AGGTGGGGGTAGGGGTGGAGAGG - Intronic
940374025 2:152936901-152936923 GGTTGGGGGTAGGGGGGCAGTGG - Intergenic
940659073 2:156524133-156524155 AGGTGGGGGTGGGTGGGAAGAGG - Intronic
941097408 2:161254679-161254701 AGCTGAGGGAAGGGGACAATGGG + Intergenic
941828157 2:169922598-169922620 AGCTGGGGGAAGAGGAAATGGGG - Intronic
942042961 2:172083128-172083150 AGGTGGGGGAAGGGGAGAGACGG - Intergenic
942201991 2:173580548-173580570 AGCCTGGGGGAGGGGAGAATGGG - Intergenic
942300073 2:174552746-174552768 GGCTAAGGGTAGGGGGGAAGTGG - Intergenic
942362649 2:175188518-175188540 GGGTGGGGGTAGGAGAGAAGGGG - Intergenic
942940147 2:181606478-181606500 AGGAGAGGGTAGGGGAGACGAGG + Intronic
942940166 2:181606516-181606538 AGGAGAGGGTAGGGGAGAGGAGG + Intronic
942940186 2:181606554-181606576 AGGAGAGGGTAGGGGAGAAGGGG + Intronic
943052453 2:182932442-182932464 GGCTGGGGATGGGGGAGAAGTGG + Intronic
943207717 2:184921757-184921779 AGCTGGGGGTAGGGTAAGTGGGG - Intronic
943382605 2:187170586-187170608 AGCTGGACGTTGGAGAGAAGTGG - Intergenic
943887232 2:193234726-193234748 TGCTGGGGATAGGGAAGAGGAGG + Intergenic
943979042 2:194523382-194523404 TGTTGGGGGTAGGGGAAAAGGGG - Intergenic
944247428 2:197545766-197545788 GGCTGGGGGAAGGAGAGAATGGG + Intronic
944271168 2:197786179-197786201 ACCTGGCGGGTGGGGAGAAGCGG + Exonic
944375898 2:199041875-199041897 AGCTAGGGATAGGGGATAAAGGG - Intergenic
944376127 2:199044219-199044241 AGCTGAGGCTATGGAAGAAGAGG - Intergenic
944770195 2:202906375-202906397 GGCTTGGGGTGGGGGAGGAGGGG - Intronic
944935185 2:204560635-204560657 AGGAGGAGGTTGGGGAGAAGAGG + Intronic
945180799 2:207089038-207089060 AGCTTGTGGTAGGAGGGAAGGGG - Intronic
945444020 2:209914549-209914571 GGCTGGGGGATGGGGAGAGGGGG - Intronic
945487021 2:210407897-210407919 GGCTGGGGGAAGGGGAAAAATGG - Intergenic
945817910 2:214628024-214628046 AACTGGGGGGAGGGGAAAATGGG + Intergenic
945822262 2:214679100-214679122 AGCTGGGGGTAGGAGGAATGAGG + Intergenic
945990342 2:216390805-216390827 AGCTGAGGACAGGGAAGAAGTGG + Intergenic
946040809 2:216781310-216781332 AGGGGAGGGCAGGGGAGAAGAGG - Intergenic
946040820 2:216781335-216781357 AGCGGAGGGGAGGGGAGCAGAGG - Intergenic
946079217 2:217102725-217102747 AGGTGAGGGCAGGGGAGAGGAGG - Intergenic
946311440 2:218884327-218884349 AGCTGGGGGGACGGGTGGAGGGG + Intronic
946325457 2:218982523-218982545 ACTTGGGGGTTGGGGGGAAGGGG + Intronic
946397552 2:219450993-219451015 AGCAGGGACTTGGGGAGAAGAGG - Intronic
946967416 2:225052148-225052170 TGCTGGGGGGTGGGGAGATGGGG + Intergenic
947003567 2:225486021-225486043 AAATGGGGGTAGGAGAGAAGTGG - Intronic
947338332 2:229110424-229110446 AGGTGAGGGAAGAGGAGAAGAGG + Intronic
947489396 2:230580830-230580852 TGCTGGGGGTAAGGGAAGAGAGG - Intergenic
947739957 2:232480487-232480509 AGCGGGGTGGAGGGGAGGAGGGG + Intronic
947744133 2:232498952-232498974 AGCTGGGGGAGGGGGGCAAGGGG + Intergenic
947774150 2:232694727-232694749 AGTTGCAGGTTGGGGAGAAGTGG + Intergenic
947905350 2:233757288-233757310 AGCTGGGGGTTGGGGGACAGGGG + Intronic
947936567 2:234009640-234009662 AGCAAGGGGAAAGGGAGAAGGGG - Intronic
948048094 2:234958686-234958708 AGATGGGGGTAGGGGGAGAGGGG + Intronic
948090673 2:235292127-235292149 AGCGGAGGGGAGGGGAGGAGTGG + Intergenic
948091841 2:235301919-235301941 AGGAGGGGGAAGGGGAGAGGAGG - Intergenic
948205123 2:236159478-236159500 GGATGGGGGGCGGGGAGAAGGGG + Intergenic
948300978 2:236907177-236907199 AGGTGGGGTTGGGGGACAAGGGG + Intergenic
948454248 2:238097389-238097411 TGCTGGCAGCAGGGGAGAAGTGG + Intronic
948483873 2:238267778-238267800 AGCCAGGGAAAGGGGAGAAGGGG + Intronic
948902996 2:240965551-240965573 AGCTGGGCGTCGGGGAGCAGAGG + Intronic
948907607 2:240987148-240987170 TGCTGGGGGTGGAGGAGCAGGGG + Intronic
948916228 2:241036094-241036116 GGGTGGGGGTTGGGGAGTAGAGG + Intronic
949027171 2:241771783-241771805 AGCAGGGGAGAGGGGAGAAGGGG + Intergenic
1169293882 20:4376023-4376045 AGCTGTGGGTGGGTGGGAAGAGG + Intergenic
1169521003 20:6372834-6372856 GACTGGGGGAAAGGGAGAAGTGG + Intergenic
1169559868 20:6787967-6787989 AGCTGGGGGTGGGGTAGTGGGGG + Intergenic
1169585856 20:7084596-7084618 GGCTGGGGGCAGGGGAGAATAGG - Intergenic
1169750077 20:8982535-8982557 GGCTGGGGGCAGGGGAAATGGGG + Intergenic
1170193096 20:13663147-13663169 GGTGGGGGGTAGGGGACAAGAGG - Intergenic
1171010214 20:21505580-21505602 GGCAGAGGGTAGGGGACAAGGGG - Intergenic
1171045029 20:21802407-21802429 ATCAGGGGGTTGGGGACAAGGGG + Intergenic
1171199106 20:23226817-23226839 AGCTGGGGTTGGGGGAGAAGAGG - Intergenic
1171239276 20:23551854-23551876 AGTTGGGGGTAGGGGTGGAAGGG + Intergenic
1171317141 20:24205297-24205319 AGCAGAGGGCAGGGGAGGAGAGG + Intergenic
1172178463 20:32986577-32986599 AGCTGGGGCCAGGGGAGATGAGG + Intronic
1172323494 20:34016340-34016362 TGATGGGGGTAGGGGAGGACTGG + Intronic
1172357459 20:34290213-34290235 TGCAGGGGGATGGGGAGAAGAGG - Intronic
1172428473 20:34872192-34872214 AGCAGAGGGTCTGGGAGAAGCGG - Intronic
1172441307 20:34968562-34968584 AGCCGAGTGTAAGGGAGAAGGGG - Intergenic
1172628228 20:36360849-36360871 GGGTGGGTTTAGGGGAGAAGGGG + Intronic
1172651600 20:36506819-36506841 GGCTGGGGGTAGGAGGGAATGGG - Intronic
1172729962 20:37078755-37078777 GGCTGGGGGTAAGGGTGAAATGG + Intronic
1172786753 20:37473599-37473621 GGTGTGGGGTAGGGGAGAAGAGG - Intergenic
1172949740 20:38715255-38715277 AGCTGAGGGGATGAGAGAAGGGG + Intergenic
1173182646 20:40816358-40816380 AGCTGGGGGTGAGGGAGTGGGGG - Intergenic
1173232679 20:41213192-41213214 GACTGAGAGTAGGGGAGAAGGGG + Intronic
1173244260 20:41324397-41324419 GGCTGGGGGGAAGGGAGAATTGG + Intergenic
1173257926 20:41408219-41408241 AGCTGGGGGTGGGGGTGGGGAGG + Intronic
1173818457 20:46005330-46005352 GGCTGGGGGAAGTGGGGAAGGGG + Intergenic
1173820761 20:46018837-46018859 AGCTCGGGGCAGGGGAGAGGAGG - Intergenic
1174137548 20:48391018-48391040 AGGAGGGGGTAGGGGAGAGGAGG + Intergenic
1174317197 20:49712834-49712856 AGGTGGGGGGGGGGGAGATGGGG + Intronic
1174483872 20:50849370-50849392 TGGTGGGGGTAGGGGTGAACAGG - Intronic
1174486330 20:50863707-50863729 AGCTGTTGGTATGGGATAAGGGG + Intronic
1174938470 20:54898047-54898069 GTCTGGGGTTGGGGGAGAAGTGG - Intergenic
1175468298 20:59207981-59208003 CTCTGGGGGTTGGGGAGCAGAGG - Intronic
1175531518 20:59676447-59676469 AGGTGGGGGTGGGGGTGAGGAGG - Intronic
1175657843 20:60787149-60787171 AGAGGGAGGTGGGGGAGAAGAGG - Intergenic
1175788142 20:61724597-61724619 AGCCCGGGGTCGGGGCGAAGGGG - Intronic
1175816407 20:61885293-61885315 AGCTGGGGGTAAGGGAGTCGAGG - Intronic
1175998539 20:62821905-62821927 AGGTGGGGTTGGGGGAGAAAGGG - Intronic
1176024997 20:62981370-62981392 TGCTGGGGGGAGGGGGGAAGGGG - Intergenic
1176060718 20:63171584-63171606 ATCTAGGGGCAGGGGAGGAGAGG - Intergenic
1176127924 20:63484238-63484260 AGGTGGGGGTAGGGGGGTGGGGG - Intergenic
1176304122 21:5114468-5114490 AGCTGGGAGTGGTGGAGAAATGG + Intergenic
1176371981 21:6067703-6067725 AGCTGGGGGCAGGGGTAATGGGG + Intergenic
1176844819 21:13868678-13868700 AGGTGGGGATTGGGGAGAATGGG - Intergenic
1176847557 21:13888241-13888263 AGGTGGGGATTGGGGAGAATGGG - Intergenic
1177047029 21:16183764-16183786 AGGGGAGGGGAGGGGAGAAGAGG - Intergenic
1177533279 21:22391375-22391397 AGGTGGGGGTTGGGGAGGAAGGG + Intergenic
1177947172 21:27485040-27485062 GGCTGGGGGTAAGGGAAATGGGG + Intergenic
1177959572 21:27645893-27645915 ACATGGGGGAAGGGGAAAAGAGG - Intergenic
1178183976 21:30198363-30198385 AACTGGGGGTAGGGTGGAGGTGG + Intergenic
1178628092 21:34235039-34235061 GGCTGGGAGGAGGGGAGAATGGG + Intergenic
1178631912 21:34268733-34268755 AGCCGGGGGTGGGGCAGGAGAGG + Intergenic
1178806699 21:35845462-35845484 AGGGGGAGGTGGGGGAGAAGGGG - Intronic
1178826736 21:36023805-36023827 AGATGGGGGTAGGGGGGTGGGGG - Intergenic
1178995138 21:37392294-37392316 AGAAGGAGGCAGGGGAGAAGTGG + Intronic
1179135843 21:38678959-38678981 AGGGGAGGGGAGGGGAGAAGTGG + Intergenic
1179161856 21:38905718-38905740 GGGGGGGGGTAGGGGAGATGGGG - Intergenic
1179181324 21:39047531-39047553 AGGTAGGGGGAGGGGAGAGGAGG + Intergenic
1179385351 21:40936808-40936830 AGCAGGTGGCAGGGGAGGAGCGG - Intergenic
1179714675 21:43280741-43280763 AGGTGGGGGGAGGGGAGGGGAGG + Intergenic
1179751538 21:43470836-43470858 AGCTGGGGGCAGGGGTAATGGGG - Intergenic
1179852934 21:44147562-44147584 AGCTGGGAGTGGTGGAGAAATGG - Intergenic
1180649933 22:17369441-17369463 AGATGGGGCTAGGGGCGGAGGGG - Exonic
1181002661 22:19995094-19995116 GGCTGGAGGGATGGGAGAAGAGG + Intronic
1181044382 22:20207680-20207702 AGCCAGGGGAAGGGCAGAAGGGG - Intergenic
1181160007 22:20954313-20954335 AGCTGGGAGTAGGAGAGACAAGG - Intergenic
1181316009 22:21971259-21971281 AGCTGGGGGTACAGGAGCACGGG + Intronic
1181340868 22:22178861-22178883 TGCTGGGGGTTGGGAAGAAAAGG + Intergenic
1181387713 22:22557894-22557916 AGATGGGGGTGGGGAAGGAGGGG + Intronic
1182009061 22:26985242-26985264 AGCTGGGGGAAGGGGAAAATGGG - Intergenic
1182192716 22:28479743-28479765 AGTTAGGGGTAGGGGAGAATGGG - Intronic
1182249922 22:28992157-28992179 GGCGGGGGGTTGGGGGGAAGAGG - Intronic
1182263011 22:29089434-29089456 AGCTGTGGGGTGGTGAGAAGTGG - Intronic
1182351928 22:29704306-29704328 AGGTGGGGGGAGGGGAGGGGAGG - Intergenic
1182388694 22:29970955-29970977 GTCTGGGGGTGGGGGGGAAGAGG - Exonic
1182433151 22:30312649-30312671 AGATGGGACTAGGGGAGAAAGGG - Intronic
1182574172 22:31261874-31261896 AGATGGGAGTAGGAGAGATGAGG + Intronic
1182661130 22:31926024-31926046 TGATGGGGGGAGGGGAGGAGTGG + Intergenic
1182775558 22:32828818-32828840 AGCGGTGGGGAGGGGAGTAGGGG + Intronic
1182781886 22:32874884-32874906 ATCTGGGGGAAGGGGACAAAGGG + Intronic
1182919634 22:34067445-34067467 TGCTGGAGGTTGGGGAGAGGTGG + Intergenic
1183341327 22:37283555-37283577 ATCTGGGGGTGGGGAGGAAGGGG - Intronic
1183474913 22:38030855-38030877 AGCTGGGGGTGGGGTGGGAGAGG - Intronic
1183494699 22:38136159-38136181 GGCTGTGGGGAGGGGAGAATCGG + Intronic
1183528800 22:38340960-38340982 GGCTGGGGGGAGGGCTGAAGTGG - Intronic
1183543162 22:38441437-38441459 GGCTGGGGGTGGGGGTGAGGTGG + Intronic
1183687979 22:39372941-39372963 ACCAGGGAGTGGGGGAGAAGAGG + Intronic
1184077404 22:42190744-42190766 AGCTGAGGGTGGGGAATAAGTGG - Intronic
1184089885 22:42287056-42287078 GGCTGGGGGGAAGGGAGGAGGGG + Intronic
1184274787 22:43404169-43404191 AGCTGGGGGAGGGACAGAAGAGG - Intergenic
1184460091 22:44632944-44632966 TGCTGGGGGTATGGGGGAAGGGG + Intergenic
1184685099 22:46093047-46093069 AGCTGGGGCTCGGAGAGGAGAGG + Intronic
1184711040 22:46249754-46249776 AGCGGGGGGTTGGGGAGCGGGGG + Intronic
1184770667 22:46594813-46594835 AGCTGGGGTTGGGGGTGAGGAGG + Intronic
1184791648 22:46703853-46703875 GGCTGGGGGTGGGGGTGGAGGGG - Intronic
1184976462 22:48065902-48065924 AGCTGGGGGAGGCGGAGGAGAGG + Intergenic
1185320254 22:50197416-50197438 GGCTGGGTGTTGGGGAGCAGTGG - Intronic
949203602 3:1411138-1411160 TGTTGGGGGTGGGGGACAAGGGG - Intergenic
949250866 3:1982217-1982239 AAAGGGGAGTAGGGGAGAAGGGG + Intergenic
949521593 3:4860163-4860185 AGCTGCAGGTAGGGGAGAAAGGG + Intronic
949999342 3:9644742-9644764 GGCTGGGGGTAGGGGTGGAAAGG + Intergenic
950043756 3:9936718-9936740 AGCCGAGGGAAGGGGAGAATAGG - Intronic
950389102 3:12682680-12682702 GTCTGAGAGTAGGGGAGAAGTGG - Intergenic
950488900 3:13290172-13290194 AGATGGAGGGAGGGGGGAAGGGG + Intergenic
950617389 3:14172047-14172069 AGTTGAGGGGTGGGGAGAAGAGG - Intronic
950658222 3:14450516-14450538 ATCTGGGGCTAGGGGTGCAGGGG - Intronic
950675264 3:14550711-14550733 AGCTGGGGATGGAGGTGAAGGGG - Intergenic
951590850 3:24262793-24262815 AGTAGGGGGTAGGGGAAAATAGG - Intronic
951646368 3:24896198-24896220 GGCTGGAGGAAGGGGAGAAAGGG + Intergenic
952665374 3:35897821-35897843 AAATGGGGGGAGGTGAGAAGGGG - Intergenic
953235482 3:41102804-41102826 AGCTGGTGGGATTGGAGAAGGGG - Intergenic
953265286 3:41381017-41381039 AGCTGGGGGCAGAGGGGCAGGGG - Intronic
953329815 3:42043491-42043513 GGCTGGGGGTAGGGGTGGAGGGG - Intronic
953571768 3:44076730-44076752 AGGTGGGGGGAGGGGAGTCGGGG + Intergenic
953701530 3:45199597-45199619 AGCATGGGGTTGGGGAGAGGTGG + Intergenic
953864841 3:46575398-46575420 GGATGGGGGGTGGGGAGAAGGGG - Intronic
953877391 3:46674092-46674114 GGCTGAGAGTAGGGGAGAGGAGG - Intronic
953932599 3:47013189-47013211 AGATGGGGGTAGGGGAGCACCGG - Intergenic
953977814 3:47395573-47395595 AGGTGGGAGAAGGTGAGAAGGGG - Intronic
954110581 3:48430693-48430715 AGCTGGTGGGAGGTGGGAAGAGG - Intergenic
954349956 3:50035038-50035060 AGAGGGGAGTAGGGGAGGAGAGG - Intronic
954430764 3:50469868-50469890 AGCTTGGAGTGGGAGAGAAGCGG - Intronic
954617009 3:51974311-51974333 AGCTGGGGATAAGGGGGATGGGG - Intronic
955252744 3:57300914-57300936 TGCTGGGGGGAGGGCAGAGGGGG + Intronic
955359943 3:58265029-58265051 AGCTGGGGGTAGGGGAGAAGTGG - Intronic
955419825 3:58724940-58724962 TGATGGAGGTAGGGGAGCAGAGG + Intronic
955613507 3:60782009-60782031 GGCTGGGAGTAGGGGAAATGGGG - Intronic
956561195 3:70576841-70576863 AGGTGGGTGAGGGGGAGAAGAGG + Intergenic
956850246 3:73222199-73222221 AAATGGGGGTTGGGAAGAAGGGG - Intergenic
957083106 3:75655568-75655590 GGCTGGGGGAGGGGGAGGAGGGG + Intergenic
957161296 3:76612545-76612567 TGTTTGGGGTAGGGGACAAGGGG + Intronic
958464706 3:94443228-94443250 AGCTGGGGGTTGGTGAGCAAGGG - Intergenic
958617492 3:96514599-96514621 AGCTGGGGATAGGGGAGTGGTGG - Intergenic
958620300 3:96550104-96550126 ATCAGGGGGTGGGGGACAAGGGG + Intergenic
958760098 3:98296568-98296590 ACCTGGGGTTGGGGGAGGAGTGG - Intergenic
958927682 3:100176773-100176795 GGCTCGGGTTAGGGGAGCAGGGG + Intronic
958963947 3:100537310-100537332 AGCTGAGGGGTGGGGAGAACCGG + Intronic
959343433 3:105161118-105161140 AGGGGAGGGGAGGGGAGAAGCGG - Intergenic
959497518 3:107068686-107068708 AGCTCGGGGAAGGGGAAAAAGGG + Intergenic
959539738 3:107524799-107524821 AGGTGGGGGGGGGGGCGAAGGGG + Intronic
959643187 3:108664645-108664667 AGCTGAGGGAAGGGGGGAAAAGG - Intronic
959818131 3:110700647-110700669 AGGAGTGGGTAGGGGACAAGCGG - Intergenic
959969442 3:112392649-112392671 GTCTGGGGTTAGGGAAGAAGAGG - Intergenic
960038075 3:113121598-113121620 AGTTGAGAGGAGGGGAGAAGGGG + Intergenic
960223944 3:115147808-115147830 AGTAGGGGGTGGGGGAGATGGGG - Intergenic
960269904 3:115661991-115662013 TGGTGGGGGTCGGGGGGAAGGGG + Intronic
960404078 3:117238396-117238418 GCCTGGGGCTGGGGGAGAAGTGG - Intergenic
960582954 3:119295748-119295770 AGATGGGGGTAGGGGGGAGTTGG + Intronic
960684524 3:120283795-120283817 AGCTGGGGGTGGAAGAGAAGGGG + Intronic
960796304 3:121492017-121492039 AGGTGGGGGTAGGGGGGTGGTGG - Intronic
960806183 3:121586001-121586023 ACCTGGGAGTAGGGGAAGAGGGG - Exonic
961006904 3:123411581-123411603 GGCTGGGGGTTGGGGATAAGAGG - Intronic
961055651 3:123786518-123786540 GGGTGGGGGTGGGGGAGGAGGGG + Intronic
961197860 3:125018359-125018381 GGCTGGGAGGAGGGGAGAATGGG + Intronic
961241393 3:125414921-125414943 AGCTGGGGGTGGGTGAGAAGAGG + Intergenic
961331830 3:126147164-126147186 AGCTGGGGGTTGAGGTGAGGTGG - Intronic
961364950 3:126393911-126393933 AGCTGGGGGTGGGAGTGAGGAGG - Intergenic
961533156 3:127552331-127552353 GGCTGGGGGTGGTGGAGTAGGGG - Intergenic
961787023 3:129353456-129353478 AGCTGGGGATGGGGGACAGGTGG - Intergenic
961906723 3:130270577-130270599 AGCAGGAGGCAAGGGAGAAGAGG - Intergenic
962255763 3:133869101-133869123 GGCTGTGGGTGGGGGTGAAGGGG + Intronic
962354387 3:134681176-134681198 AGCTGGGGGTCGGGGGGTGGTGG + Intronic
962367514 3:134796032-134796054 AGCTGGGCGTTGGGGAGAAAGGG + Intronic
962732716 3:138298691-138298713 AGCTGGTGGTAGTGGAGATGGGG - Intronic
962835544 3:139185527-139185549 GGCAGGGGGTGGGGGAGATGGGG + Intronic
962875831 3:139535514-139535536 AGCTGGGAGTAGGAAAGCAGTGG - Intronic
963742922 3:149097862-149097884 AGCTGGGGAAGGGGGAGAGGTGG + Intergenic
963790310 3:149576490-149576512 AGGTGGGAGTAGCGGGGAAGTGG - Intronic
963922648 3:150920772-150920794 AGCTGGGGGTAAGGCAAGAGGGG + Intronic
964181141 3:153887799-153887821 GGCTGGGGGAAGGGGAAAATAGG + Intergenic
964205639 3:154171862-154171884 AGTTGGGGGTGGGGGAGGACTGG + Intronic
964349741 3:155791010-155791032 ACCTGGGGTTAGGAGAGAGGTGG - Intronic
964514173 3:157489251-157489273 AGATGAGGTTAGGAGAGAAGTGG - Intronic
964809028 3:160642256-160642278 CACTGAGGGCAGGGGAGAAGAGG + Intergenic
965005558 3:163018803-163018825 CGATGGGGACAGGGGAGAAGTGG + Intergenic
965418871 3:168431595-168431617 AGCTGGGGGGATGGAGGAAGCGG - Intergenic
965486113 3:169280629-169280651 AGCTGGAGGTATGGATGAAGGGG + Intronic
965602646 3:170470201-170470223 AGCCTGGGGGAGGGGAGAGGAGG - Intronic
965736718 3:171828219-171828241 AGCTGGGGGAAGGGCAGGCGCGG + Intergenic
965742455 3:171890165-171890187 ACCTGGGGTTGGGGGAGTAGTGG + Intronic
966552323 3:181219059-181219081 TGCTGGGGTTGGGGGAGGAGGGG + Intergenic
966620974 3:181963851-181963873 AACTGGGAGTAGGGGAGAGAGGG + Intergenic
966692688 3:182758055-182758077 AGATGGGAGAAAGGGAGAAGAGG + Intergenic
966874962 3:184316225-184316247 GGCTGTGGGGAGGGGAGTAGGGG + Intronic
966876739 3:184326578-184326600 AGCTGGGGCAAGGGCAGCAGCGG + Exonic
967006106 3:185384095-185384117 AGCTGGGAAGAGTGGAGAAGAGG - Intronic
967033693 3:185631562-185631584 GGGTGGGGAAAGGGGAGAAGGGG - Exonic
967088033 3:186111299-186111321 AGGTGGGGGCAGGGGAGGATTGG + Intronic
967364467 3:188670098-188670120 TGTTGGGGGTTGGGGAGAGGAGG + Intronic
967592372 3:191293860-191293882 AGCCGGGGGTGGGGGAGTCGGGG + Intronic
967824391 3:193867066-193867088 AGCTGGGGAGAAGGAAGAAGTGG + Intergenic
968002937 3:195220083-195220105 AGCTGGGGGGAGGGGAGGCTGGG + Intronic
968029922 3:195474898-195474920 AGAGGGGGGGAGGGGAGGAGAGG + Intergenic
968150820 3:196335501-196335523 GGGTGGGGGTAGGAGAGAGGTGG + Intronic
968310671 3:197681012-197681034 GGATGGGGGGAGGGGACAAGAGG + Intronic
968382489 4:108137-108159 AGCAGGGGACAGGCGAGAAGAGG + Intergenic
968411246 4:392537-392559 ATCTGTGGGGAGGGGAAAAGTGG - Intergenic
968531531 4:1094400-1094422 AGCTGGGGGTGGGGGAGGCTTGG + Intronic
968887192 4:3341262-3341284 AGATGGGGGTATGGGGGGAGGGG + Intronic
968887217 4:3341327-3341349 AGATGGGGGTATGGGGGAGGAGG + Intronic
969179775 4:5430261-5430283 TGGTGGGGGATGGGGAGAAGAGG - Intronic
969269390 4:6088862-6088884 GACTGGGCGTATGGGAGAAGGGG - Intronic
969365883 4:6694098-6694120 AGCGGGGGCTGGGGAAGAAGGGG + Intronic
969370306 4:6727616-6727638 AGGAGGGGGAAGGGGAGGAGGGG - Intergenic
969406679 4:6997849-6997871 TGCTAGGGGTTGGGGAGACGGGG + Intronic
969454780 4:7294855-7294877 AGCTGGGGAGAAGGGAGAGGAGG - Intronic
969454867 4:7295081-7295103 AGCTGGGGAGAAGGGAGAGGGGG - Intronic
969628394 4:8320488-8320510 AGCTGGGGGTAGCAGAGACAAGG - Intergenic
969666128 4:8558438-8558460 ATCTGGGGGCAGTGGAGAGGCGG + Intergenic
969833292 4:9816373-9816395 AGATGAGGGAAGGGGAGAAATGG + Intronic
970378846 4:15484848-15484870 ATCTGGTGGTTGGGGAGAGGTGG + Intronic
970497039 4:16636679-16636701 ATGTGGGGGTGGGGGACAAGAGG + Intronic
970631180 4:17947396-17947418 GGCTGGGGGTATGGGAAATGGGG + Intronic
970810366 4:20086373-20086395 AGCTTGGGCTAGGAAAGAAGTGG - Intergenic
971076087 4:23151541-23151563 GGCTGGATGTAGGAGAGAAGTGG + Intergenic
971873998 4:32280744-32280766 TTCTGGGGGTGGGGGGGAAGGGG + Intergenic
971923572 4:32976000-32976022 AGGTGGGGGTAGGGGATTACTGG + Intergenic
972097385 4:35364772-35364794 ACCTGGGGGAAGGGGTGAAATGG - Intergenic
972655275 4:41057966-41057988 TGCTGGGGGTAGGTCAGAAAGGG - Intronic
972688570 4:41374200-41374222 AGCTGGGGGCAGGAGGGTAGAGG + Intronic
972774323 4:42227514-42227536 AGCAGGGGGTGAGGGAGAGGAGG - Intergenic
972775149 4:42233321-42233343 AACTGGGGGTGGGGTAGGAGAGG + Intergenic
973103979 4:46308378-46308400 GAGTGGGGGTAGGGAAGAAGAGG + Intronic
973152066 4:46900485-46900507 AACTGGTGGCAGGGGAGGAGGGG + Intronic
973288599 4:48447188-48447210 AGCTGGGGGGAGGGGAAATTGGG - Intergenic
973807890 4:54543064-54543086 AGGATGGGATAGGGGAGAAGTGG + Intergenic
974012780 4:56622955-56622977 GGCTGGGGTTAGGGGATAATGGG + Intergenic
974103589 4:57443391-57443413 GGCTGGGGGCAGGGGGGAAAGGG - Intergenic
974120073 4:57627455-57627477 AGGTGGAGGGAGGGGAGGAGTGG + Intergenic
974558970 4:63492718-63492740 TGCTGGGGGAAGGAGAGAGGGGG - Intergenic
974559066 4:63493851-63493873 AGTTGGGAGAAGGGAAGAAGAGG - Intergenic
975504500 4:75123053-75123075 AGATGAGGGTAGGGGAGAGGAGG + Intergenic
976217784 4:82731150-82731172 AGCTGGGGGTAGGGGCAGAGAGG + Intronic
976316765 4:83666909-83666931 AGATGGGGCTAGGTGGGAAGGGG + Intergenic
976377598 4:84363081-84363103 ACCAAGGGGGAGGGGAGAAGAGG - Intergenic
976569778 4:86594608-86594630 AGCCTGGGGAGGGGGAGAAGAGG - Exonic
976775245 4:88699251-88699273 GGCTGGGGGTGGGTGGGAAGAGG - Intronic
977259727 4:94783967-94783989 AGCTGGAGGTAGGGAAGGAGGGG + Intronic
977542494 4:98334317-98334339 AGGTGGGGGAAGGGTAAAAGAGG - Intronic
977794438 4:101145637-101145659 AGTTGGGGGTAAGGAAAAAGTGG + Intronic
978484728 4:109238924-109238946 TGGTGGGGGTAGGAGAGTAGAGG + Intronic
978605060 4:110470928-110470950 AGCAGGGGGTTGGGGGGCAGGGG + Intronic
978713961 4:111819545-111819567 AGCTGGGGAGAGGGGAAAATGGG + Intergenic
978985948 4:115013067-115013089 GGGTGGGGGTAGGGGGAAAGTGG + Intronic
979317509 4:119281968-119281990 GGCTGGGAGGAGGGGAGAATGGG - Intronic
979487119 4:121282966-121282988 AGCTTGGGGAAGGGGTGATGTGG - Intergenic
979618174 4:122768196-122768218 AGCTGGGGGGAGGGGGAAAGGGG + Intergenic
979688485 4:123537693-123537715 GGGTGAGGGTAGGGGAGATGGGG - Intergenic
980081347 4:128347721-128347743 AGCTGTGGGTAGGGGAGGATGGG - Intergenic
980162364 4:129181360-129181382 GGCTGGAGGGAGGGGAAAAGGGG - Intergenic
980243516 4:130206923-130206945 GGGTGGGGGGAGGGGAGAGGAGG - Intergenic
980857712 4:138460013-138460035 TGTTGTGGGGAGGGGAGAAGGGG - Intergenic
980859135 4:138479036-138479058 GGGTTGGGGGAGGGGAGAAGGGG - Intergenic
981028044 4:140095825-140095847 AGCTGGGTGAAGGGGAGGAGGGG - Intronic
981066256 4:140489495-140489517 ATCTGGGGGTAGGGAGGAAGGGG - Intronic
981215559 4:142161996-142162018 AGTTGAGGTTAGGGAAGAAGAGG - Intronic
981314433 4:143328064-143328086 AGCTGGGGGCAGGGCAGGAAGGG + Intergenic
981529254 4:145736033-145736055 AGAGGGGGTTAGGGGAGGAGAGG - Intronic
981558727 4:146023879-146023901 TGCTGGGGCTGGGGGAGGAGAGG + Intergenic
981907269 4:149935937-149935959 ACCTGGGGATAGGGGAAATGGGG - Intergenic
982167861 4:152631547-152631569 TACTGGGGGAAGGGGAGATGAGG - Intronic
982258070 4:153468737-153468759 AGGAGGGGGTGGGGGAGAGGGGG - Intronic
982374385 4:154673583-154673605 AGCAGGGAGAAGGGGACAAGAGG + Intronic
982575321 4:157102337-157102359 GGCTGGGGGTAGGGAAAATGGGG - Intronic
982727720 4:158922748-158922770 GGCTGGAGGAAGGGGAGAATGGG - Intronic
982777387 4:159455755-159455777 AGCTGGGGGGCGGGGGGAGGGGG - Intergenic
982854933 4:160369709-160369731 AGATGGGAGTAGGGGAGCAAGGG + Intergenic
982874925 4:160635401-160635423 GGGTGGGGGTAGGAGGGAAGTGG - Intergenic
983212016 4:164968141-164968163 AGGGGAGGGGAGGGGAGAAGAGG + Intronic
983888067 4:173002958-173002980 ACCAGGGGTTGGGGGAGAAGGGG + Intronic
983999653 4:174224966-174224988 AGGGGAGGGGAGGGGAGAAGAGG - Intergenic
984628920 4:182039934-182039956 AGGGGAGGGAAGGGGAGAAGAGG + Intergenic
984628945 4:182040000-182040022 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
984628976 4:182040075-182040097 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
984629016 4:182040175-182040197 AGGGGAGGGAAGGGGAGAAGAGG + Intergenic
984629027 4:182040200-182040222 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
984629048 4:182040250-182040272 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
984661686 4:182381553-182381575 AGGGGAGGGGAGGGGAGAAGAGG - Intronic
984793434 4:183635377-183635399 AGGTGGGAGTGGGTGAGAAGCGG - Intergenic
985109890 4:186538162-186538184 AGCTGGGGCTGTGGGAGATGGGG - Intronic
985143148 4:186863708-186863730 AGCTGGTGGTGGAGGAGAGGTGG - Intergenic
985485851 5:148238-148260 AGTGGGGGGTGGGGGAGAAGAGG + Intronic
985624653 5:978862-978884 AGCTGAGAGGAGGTGAGAAGAGG + Intergenic
985865297 5:2509638-2509660 GGCTTGGGGTAGGGGAGAAGGGG - Intergenic
986240797 5:5958007-5958029 GGCTGAGGGTAGGGGAAAATGGG - Intergenic
986379296 5:7166813-7166835 AGGTGGGGCTTGGGGAGCAGAGG - Intergenic
986622090 5:9686596-9686618 AGATGGGGGGAAGGGAGGAGAGG + Intronic
986769654 5:10960649-10960671 GGCTGGGGGAAGGGGAAATGGGG + Intergenic
987009909 5:13751850-13751872 AGATGTGGGTGGGGCAGAAGGGG + Intronic
987142235 5:14958221-14958243 AGGAGAGGGAAGGGGAGAAGAGG - Intergenic
987799829 5:22680097-22680119 ACCTAGGGGGAAGGGAGAAGGGG + Intronic
988610884 5:32723852-32723874 AGGTGAGAGGAGGGGAGAAGAGG - Intronic
988735878 5:34020815-34020837 ACCTGTGGGAAGGAGAGAAGGGG - Intronic
988838316 5:35056431-35056453 ATCTTGGGGTAAGGGAGCAGTGG - Exonic
989088232 5:37699137-37699159 AGGTGGAGTTAGGGGAGAAGAGG + Intronic
989164757 5:38423427-38423449 AGGTGGGGGTAGGGGAGGGGAGG - Intronic
989445397 5:41522703-41522725 GTGTGGGGGCAGGGGAGAAGGGG - Intergenic
989673116 5:43942906-43942928 AACTGGGGGTGTGGGGGAAGAGG + Intergenic
989710367 5:44389572-44389594 AGAAGGGGGTGGGGGAGCAGGGG + Intronic
990352592 5:54933803-54933825 AGAAGGGGAGAGGGGAGAAGGGG - Intergenic
990553534 5:56908589-56908611 ATCTGGGTGTTGGGGAGGAGCGG + Intergenic
990993522 5:61708217-61708239 AGATGGGGGCAGGGGTGTAGTGG + Intronic
991331105 5:65493019-65493041 GGCAGGGGGTTGAGGAGAAGTGG + Intergenic
991447911 5:66719708-66719730 AGCAGGGGGTGGGGAACAAGGGG - Intronic
992185676 5:74242108-74242130 GGCTGGGGGTAGGTGGGAAATGG - Intergenic
992244700 5:74808470-74808492 AGATGGGGGTAGGGGAAAAGGGG + Intronic
992325261 5:75654186-75654208 AGATGGAGGGAGGGGAGACGAGG - Intronic
992659859 5:78948145-78948167 GGGTGAGGGTAGGGGGGAAGTGG + Intronic
992745395 5:79815584-79815606 AGCCGAGGGGAGGGGAGAAGAGG - Intergenic
993010866 5:82480721-82480743 AGGTGGGAGTAGGGAAGGAGTGG + Intergenic
993065597 5:83094322-83094344 AGCGGAGGGAAGGGGAGGAGAGG - Intronic
993243903 5:85426898-85426920 AGTTGGGGGTGGGGGAAAAAGGG + Intergenic
993267496 5:85744676-85744698 ACCTGGGGTTAGGAGAGGAGTGG + Intergenic
993391554 5:87324731-87324753 AACTTGAGGAAGGGGAGAAGAGG - Intronic
993862437 5:93152541-93152563 AGAGGGAGGGAGGGGAGAAGGGG - Intergenic
994083032 5:95729672-95729694 GGCTGGGGAGAGGGGAAAAGGGG - Intronic
994238539 5:97393223-97393245 AGCTAGGGCTAGTGGATAAGGGG - Intergenic
994297188 5:98104758-98104780 AACTGAGGGTAGGGAAGAAAGGG + Intergenic
995157282 5:108930502-108930524 AGGGGAGGGGAGGGGAGAAGAGG - Intronic
995292534 5:110473969-110473991 GGCTGGGGGTGGGGGAGAGTAGG + Intronic
995487246 5:112651644-112651666 GGATGGAGGTGGGGGAGAAGCGG - Intergenic
995608997 5:113889348-113889370 AGGGGAGGGGAGGGGAGAAGAGG - Intergenic
996105399 5:119496105-119496127 AACTGGGAGTAGGGGTGAGGAGG + Intronic
996849655 5:127937997-127938019 AGCAGGGGGCAGGGGTGGAGGGG - Intergenic
997197357 5:131988920-131988942 AGGCGGGGGTGGGGAAGAAGGGG + Intronic
997519637 5:134514537-134514559 GGTTGGGGGTAGGGGAGAAGTGG - Intergenic
997639506 5:135439496-135439518 AGCTGGGGGAAGGTGGGAGGTGG + Intergenic
997670985 5:135671852-135671874 GGGTGGGGGTGGGGGAGTAGAGG - Intergenic
998165588 5:139841043-139841065 GGCTGGAGGGAGGGGAGAATGGG - Intronic
998238215 5:140418552-140418574 GGCTGGGGGAAGGTGAGAATGGG - Intronic
998374746 5:141682925-141682947 GGGTGGGAGTTGGGGAGAAGGGG - Intergenic
998546687 5:143034574-143034596 AGCTGGGGGAAGGGAAGACATGG + Intronic
998977552 5:147664723-147664745 AGCCTGCGGTAGGGTAGAAGAGG - Intronic
999058017 5:148601969-148601991 AGCTGGGGGTTGGAAAGATGAGG + Intronic
999099310 5:149009513-149009535 AGCTAGGGGTGGGGAAGAACAGG - Intronic
999240537 5:150124902-150124924 GGCCGGGGGTAGGGGAGTGGGGG - Intronic
999248608 5:150168246-150168268 AGCTGGGGTAAGGGGAGGAGGGG - Intronic
999406736 5:151313118-151313140 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
999426038 5:151488409-151488431 ACCTGAGGGCAGGGGAGAGGTGG + Exonic
999516873 5:152310525-152310547 TGCGGGGAGGAGGGGAGAAGTGG + Intergenic
999853520 5:155568424-155568446 TGCTTGGGGAAGAGGAGAAGAGG + Intergenic
999997898 5:157109847-157109869 CTCTTGGGGTAGGGGAGAGGGGG - Intronic
1000142165 5:158416131-158416153 AGGCGGGGGTAGGGAAGAATGGG + Intergenic
1000159983 5:158587620-158587642 TGCTGGGGGTTGGGGAGGGGTGG + Intergenic
1001101857 5:168820929-168820951 GGCTGGTGGTGGTGGAGAAGCGG - Intronic
1001174271 5:169450930-169450952 ATCTGGGAGTAGGAGAGAATGGG - Intergenic
1001241075 5:170070174-170070196 AGCTGGCGGGAGGTGAGCAGTGG + Intronic
1001422163 5:171596386-171596408 GGCCGGGGGTGGGGGAGGAGGGG - Intergenic
1001579785 5:172790711-172790733 AGCGGGGGGTAGCTGAGTAGAGG + Intergenic
1001712319 5:173788816-173788838 TGCTGGGGGTAGGGGGGTTGAGG + Intergenic
1001761476 5:174211575-174211597 GGCTGTGTGTAGGGGAGGAGAGG + Intronic
1001798323 5:174520518-174520540 AGCTGGGGGTCAGGGAGAGGCGG - Intergenic
1001831764 5:174794897-174794919 AGCGGGGGGCAGGGGGGACGGGG - Intergenic
1001894881 5:175369925-175369947 AGCTGGGGGAAGGAGGGAGGGGG + Intergenic
1002075550 5:176706187-176706209 GGCTGGGGGAAGGGCAGAGGAGG + Intergenic
1002081571 5:176740614-176740636 GGCTGGGGGTAGGGGCGGAGTGG + Intergenic
1002095253 5:176826985-176827007 GGCTGGGGCAAGGGGAGAATGGG - Intronic
1002160336 5:177311056-177311078 GGCTGGGGAGAGGAGAGAAGAGG + Intronic
1002203800 5:177548701-177548723 AGCTTGGGGCAAGGGAGAGGTGG + Intronic
1002428101 5:179187587-179187609 TGCTGGGGGGAGGGGAGGGGAGG - Intronic
1002447298 5:179297462-179297484 AGCAGGGAGTGGGGCAGAAGGGG - Intronic
1002479219 5:179488433-179488455 AGCTTCATGTAGGGGAGAAGAGG - Intergenic
1002527053 5:179820736-179820758 AGCGAGGGGTAGCGGGGAAGGGG + Intronic
1002579489 5:180199063-180199085 AGGTGGGGGTTGGGGAGGAGAGG - Intronic
1003086637 6:3065527-3065549 AGATGGGTGTGGGGGAGGAGGGG + Intronic
1003281502 6:4696117-4696139 GGCTGAGGGGAGGGGAGATGGGG + Intergenic
1003410412 6:5857010-5857032 AGCTGGGGGCAGGGGGGAATAGG - Intergenic
1003594580 6:7462820-7462842 AGCTGGGGGGAAGGGAGAATGGG + Intergenic
1003840502 6:10114278-10114300 AGCAGGGGGTACAGGAGGAGGGG - Intronic
1004057477 6:12154635-12154657 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1004303432 6:14478639-14478661 GGGTGTGGGTAGGGGAGGAGAGG + Intergenic
1004366707 6:15019084-15019106 GGCTGGGGGTGGGGGAGAATAGG + Intergenic
1004400965 6:15288300-15288322 AGGTGGGGGTTGGAGAAAAGGGG + Intronic
1004759670 6:18652587-18652609 AGTTGGAGGGAGTGGAGAAGGGG + Intergenic
1005355105 6:24974981-24975003 AGCTGGGGTGAAAGGAGAAGTGG + Intronic
1005871393 6:29976515-29976537 AGCTGGAGGTAGGGTAGAGGGGG - Intergenic
1006163613 6:32051915-32051937 GGCTGGGGCAAGGGGAGAATGGG + Intronic
1006271220 6:32968812-32968834 GGCGGGGGGTGGGGGGGAAGCGG + Intronic
1006271742 6:32970864-32970886 GGCCGGGGGGAGGGGAGGAGGGG + Intronic
1006457760 6:34141796-34141818 AGCCAGGTGGAGGGGAGAAGTGG + Intronic
1006512535 6:34529376-34529398 AGCTGTGGGGAGGGGGGAATAGG - Exonic
1006526088 6:34606377-34606399 GGCTGGGGAAACGGGAGAAGGGG + Intronic
1006648885 6:35534852-35534874 AGCTGGGGGTTTGGGGGAAGAGG - Intergenic
1007171133 6:39864521-39864543 AGGTGGGGGCAGGGCAGGAGAGG - Intronic
1007371096 6:41427601-41427623 GGCCGGGGGGAGGGGCGAAGGGG - Intergenic
1007381467 6:41492802-41492824 CGATGGGGTCAGGGGAGAAGAGG + Intergenic
1007385526 6:41518004-41518026 AGCTGGGGGTAGTGGAGACTAGG - Intergenic
1007396076 6:41578645-41578667 AGCTGGAGGGAAGGGAGAAGGGG - Intronic
1007474199 6:42107890-42107912 AGATGGGGGGTGGGGACAAGAGG + Intronic
1007486088 6:42181722-42181744 AGCTGGGTGTGGGGGAGGTGTGG + Intergenic
1007515062 6:42404476-42404498 GGGTGGGGGTAGGGGAGAAAAGG - Intronic
1007627305 6:43253825-43253847 AGGAGGGGCTTGGGGAGAAGAGG - Intronic
1007757776 6:44111541-44111563 AGCTGGTGGGAGGGGAGACATGG - Intergenic
1008019678 6:46561885-46561907 GGCTGGGGTTAGGGGAGTTGGGG + Intronic
1008153583 6:47987252-47987274 GGGTGGGGGGAGGGGGGAAGGGG + Intronic
1008177741 6:48288975-48288997 TGCTGGGGGTGGGGGAGGGGTGG + Intergenic
1008437647 6:51495231-51495253 AGCAGGAGGTAGGGGACATGTGG + Intergenic
1008749010 6:54709270-54709292 AGGAGAGGGGAGGGGAGAAGAGG + Intergenic
1008749017 6:54709290-54709312 AGGAGAGGGGAGGGGAGAAGAGG + Intergenic
1008847375 6:55983931-55983953 GGCGGGGGGTGGGGCAGAAGGGG + Intergenic
1009593701 6:65708674-65708696 AGGAGGGGGGAGGGGAGAGGAGG - Intergenic
1009891889 6:69695005-69695027 ATCTGAGGGTAGGCAAGAAGTGG - Intronic
1009948215 6:70364574-70364596 AGCTGGATGTCGGGGAGAAGCGG - Intergenic
1010225610 6:73486376-73486398 GGCTGGGGGAAGGAGAGAAAGGG - Intronic
1011148850 6:84246170-84246192 GGCTGGGGATAGGAGAGAATGGG + Intergenic
1011362287 6:86540252-86540274 AGCAGGGGGAGGGGGAGAGGAGG + Intergenic
1011366174 6:86584879-86584901 AGCTTGGGGAAGGGGTGAATTGG - Intergenic
1011410301 6:87059872-87059894 AGGTGGGGGGAGGGGAGGCGGGG + Intergenic
1011506867 6:88054973-88054995 AGCTGGGAGGAGGGGGGAACAGG - Intronic
1011643404 6:89434884-89434906 ACATGGGGGAAGGGTAGAAGAGG + Intronic
1011703860 6:89981912-89981934 ATATGGGGGTAGGGCAGGAGGGG + Intronic
1012171684 6:96024327-96024349 AGCTGAGATTATGGGAGAAGGGG + Intronic
1012528492 6:100205756-100205778 AGGTGGGGCAGGGGGAGAAGTGG + Intergenic
1012626758 6:101414288-101414310 TGCTGGGGGCAGTGGAGAAAAGG - Intronic
1012672138 6:102066688-102066710 AGCAGTGGGGAAGGGAGAAGAGG + Intronic
1012722752 6:102767668-102767690 AGTTGAGGGTAGGGGGCAAGAGG - Intergenic
1012871434 6:104677048-104677070 GGCAGGGGGTAGGGGGCAAGGGG + Intergenic
1013457349 6:110342706-110342728 GGCTGGGGGTAGAGGGGAATGGG - Intronic
1013503714 6:110777970-110777992 TGCTGGGGGAAGGGGAGAATGGG + Intronic
1013575878 6:111483228-111483250 CACTGGGGGGAGGGGAGAGGGGG + Exonic
1013911780 6:115284202-115284224 AGCCAGGGGTAGGGTAGAAAAGG + Intergenic
1014177926 6:118350305-118350327 AGCAGGGAGCAGGGGATAAGAGG + Intergenic
1014581338 6:123141117-123141139 GGCTGGGAGTAGGGTAGACGGGG - Intergenic
1014693967 6:124595918-124595940 AGCTGGGGCTTGGGGAGCACGGG + Intronic
1014795509 6:125719843-125719865 AGTTGGGGGTAGGGGCAAAGAGG + Intergenic
1014862450 6:126486178-126486200 GGCTGGGGGTAGGGGAAATAGGG - Intergenic
1015111665 6:129598920-129598942 AGGTAGGGGTAGGGGTGTAGGGG + Intronic
1015179346 6:130345229-130345251 AGGTGGAGGTAGAGGACAAGTGG + Intronic
1015270566 6:131333843-131333865 AGATTGGAGTAGTGGAGAAGAGG + Intergenic
1015509398 6:134023059-134023081 ATCTGGGGGTTGGGGCAAAGGGG - Intronic
1015572663 6:134637447-134637469 AGCAGGGGGAAGGAGAGAAGAGG + Intergenic
1015640719 6:135328568-135328590 ACCTGGTGGTAGGGGGTAAGAGG - Intronic
1015733107 6:136368124-136368146 ACCTAGGGGTAGGTGAGCAGAGG + Intronic
1015779044 6:136844647-136844669 GGCTGGGGGTGGGGGAAATGGGG - Intronic
1015903649 6:138094290-138094312 GGCTGGGGGGAGGGAAGAATGGG - Intronic
1016792394 6:148079362-148079384 ACCTGGGGCTAGGTCAGAAGGGG - Intergenic
1017065318 6:150523588-150523610 GTCTGGGGGTGGGGGACAAGGGG + Intergenic
1017770060 6:157638097-157638119 AGGTGGAGGCAGGGGAGTAGAGG + Intronic
1017890221 6:158631642-158631664 AACTGGGGGTCAGGGAGAGGAGG + Intronic
1018959931 6:168441083-168441105 AGGTGGGGCTGGGGGAGGAGAGG + Intergenic
1019108993 6:169694721-169694743 AGCTGAGGGTTGGGGAGACCAGG - Intronic
1019470734 7:1219158-1219180 AGCTGGGTGTGGGGGAGTAGGGG + Intergenic
1019512330 7:1423957-1423979 AGCTGGGAGTGAGGGGGAAGAGG + Intergenic
1019514812 7:1434983-1435005 AGCTGGGGGTGGGGGGGGGGCGG - Intronic
1019703816 7:2488078-2488100 GGCTGGGGGCGGGGGAGAGGGGG - Intergenic
1019813543 7:3182800-3182822 AGGTGGGGAGAGGGGAGGAGGGG - Intergenic
1019815648 7:3197854-3197876 TTCAGGGGGGAGGGGAGAAGCGG - Intergenic
1020338437 7:7083584-7083606 GTCTGGGGGTAGGGGGGTAGGGG - Intergenic
1020401978 7:7789612-7789634 GTCTGTGGGGAGGGGAGAAGGGG - Intronic
1020509464 7:9035199-9035221 AGCTGGCGGTAGGGAAAAAGTGG + Intergenic
1020708090 7:11570787-11570809 AGCAGTGGGTAGGGGTGGAGAGG + Intronic
1020847623 7:13306919-13306941 AGTTGGGGGATGGGGAGAAGGGG + Intergenic
1021046076 7:15924780-15924802 GGCTGGGGCTAGGGGAGGTGTGG - Intergenic
1021123668 7:16825955-16825977 TGCTGGGGTTGGGGGAGAGGTGG - Intronic
1021210421 7:17845100-17845122 AAGTGGAGGGAGGGGAGAAGAGG + Intronic
1021528843 7:21620377-21620399 AGCCGGGGGGAGGGGGCAAGAGG - Intronic
1021563487 7:21992538-21992560 AGCTGGGATAAGGGGAGATGGGG + Intergenic
1021639198 7:22721781-22721803 AGACGGGGGTCGGGGAGAGGTGG - Intergenic
1021890185 7:25180006-25180028 AGCTGCGGGGAGGGGAGGGGAGG - Intronic
1022230492 7:28408950-28408972 GGATGGGGGTAGGGGAGAGGTGG - Intronic
1022385696 7:29896986-29897008 GGCTGGGGGAAGAGGAGAATGGG - Intronic
1022455591 7:30555657-30555679 AGCTGGAGGAAGGGGAGAATGGG - Intergenic
1022482881 7:30755448-30755470 AGCTGCGGGCAGCGGTGAAGCGG + Exonic
1022513210 7:30956274-30956296 AGGTGAGGGGAGGGGAGATGAGG - Intronic
1023557506 7:41438430-41438452 GGTTGGGGGTGGGTGAGAAGGGG + Intergenic
1023592705 7:41796312-41796334 AGCTGGGGGGAGGGGAGCTTTGG + Intergenic
1023907036 7:44530375-44530397 GGCTGAGGGGAGGGGAGAATGGG + Intronic
1023992092 7:45134467-45134489 AGGTGGGAGGAGAGGAGAAGGGG + Intergenic
1024194637 7:47047124-47047146 AGCTGTGGGCTGGGCAGAAGAGG + Intergenic
1024541662 7:50479916-50479938 AGGTGGGGAGAGGGGAGAGGTGG - Intronic
1024947944 7:54830480-54830502 GGCTGGAGGGAGAGGAGAAGGGG + Intergenic
1025004916 7:55345702-55345724 TGCTGGGGGTGAGGGGGAAGGGG - Intergenic
1025144622 7:56493055-56493077 AGATGGGCTTGGGGGAGAAGTGG - Intergenic
1025152660 7:56572206-56572228 TGGTGGGGGTTGGGAAGAAGCGG - Intergenic
1025814338 7:64897088-64897110 GGCTGGGGGTGGAGGAGATGTGG + Intronic
1026634864 7:72073238-72073260 AACTGGGGGGAAGGGAGAATGGG + Intronic
1026681207 7:72467874-72467896 AGCTAGGGGTAGAGGGGAACGGG - Intergenic
1026709300 7:72723104-72723126 CCCTGGGGGTAGGGGGCAAGAGG - Intronic
1026769632 7:73187178-73187200 GGGTGGGGGTGGGGCAGAAGAGG + Intergenic
1026949965 7:74340548-74340570 AGCTGGGACTAGTGGAGAAGAGG - Intronic
1026968396 7:74454219-74454241 GGGCGGGGGTGGGGGAGAAGGGG - Intronic
1027010501 7:74740564-74740586 GGGTGGGGGTGGGGCAGAAGAGG + Intronic
1027077541 7:75205480-75205502 GGGTGGGGGTGGGGCAGAAGAGG - Intergenic
1027142728 7:75670579-75670601 GGCTGGGGAGAGGGGAGAATGGG - Intronic
1027305215 7:76887739-76887761 AGGTGGGGGCAGGAGGGAAGTGG - Intergenic
1027430017 7:78102193-78102215 GGCTGGGGGTTGGGGAAAAGGGG + Intronic
1028071984 7:86461512-86461534 AGGTGGGGGTGGGGGGGCAGTGG - Intergenic
1028185808 7:87784696-87784718 ATGTGGTGGTAGGGGAGATGTGG + Intronic
1028193329 7:87876616-87876638 AGCTGGCGGAAGGAGAGAGGCGG + Exonic
1028306901 7:89277488-89277510 GGGTGGGGGTAGGGGGGAGGGGG - Intronic
1028596663 7:92553418-92553440 AGCATGGGGCAGTGGAGAAGGGG - Intergenic
1028986456 7:97012899-97012921 AGCTGGGGGTGGGGTAGAGGAGG + Intergenic
1029248155 7:99217521-99217543 AGCTGGGGTTGGGGGTGGAGAGG + Intergenic
1029441624 7:100590008-100590030 AGCTTGGGGTTGAAGAGAAGAGG + Exonic
1029443941 7:100602739-100602761 AGGTGGGGGAATGGGAGCAGTGG - Intronic
1029495220 7:100892817-100892839 ACCTGGGGGTGAGGGAGAGGGGG + Exonic
1029736772 7:102469543-102469565 GGGGTGGGGTAGGGGAGAAGTGG - Intronic
1029877304 7:103767889-103767911 AGCTGGATGGAGGGGGGAAGAGG - Intronic
1029992274 7:104973248-104973270 AGGGGAGGGGAGGGGAGAAGAGG + Intergenic
1030080493 7:105773855-105773877 AAGTGAGGGTCGGGGAGAAGTGG + Intronic
1030091251 7:105861083-105861105 GGCAAGGGGAAGGGGAGAAGGGG + Intronic
1030250340 7:107436438-107436460 GGCTGAGGGTGGGGGAGAATGGG + Intronic
1030550207 7:110948989-110949011 TGGTGGGGGCAGGGGAGCAGTGG - Intronic
1030651032 7:112116170-112116192 TGCTGGGGGCTGGGGAGAGGAGG - Intronic
1030674542 7:112370770-112370792 AGCTGGGGGTGGATGAGATGGGG - Intergenic
1030783085 7:113625760-113625782 AGGAGAGGGGAGGGGAGAAGGGG - Intergenic
1032021279 7:128408317-128408339 AGATGGGGGAAGGGCAGAAAAGG + Intronic
1032327822 7:130948411-130948433 AGCTGGGGGGAGGAGGGAATGGG + Intergenic
1032587796 7:133163744-133163766 GGCTGGGGGAAGGGGATATGGGG + Intergenic
1032843140 7:135729847-135729869 GGCAGGGGGAAGGGGAAAAGAGG + Exonic
1032851785 7:135801648-135801670 GGCGGGGGTTAGGGGAGAGGCGG - Intergenic
1032856795 7:135841811-135841833 CGCTGGGGAGAGGAGAGAAGAGG - Intergenic
1033176487 7:139128575-139128597 AGCAGGTGGAAGGGGAGGAGAGG - Intergenic
1033241181 7:139681302-139681324 AGCTGGTGGCAGGAGAGAGGTGG + Intronic
1033322457 7:140352228-140352250 AGGTGGGGGTGGGGGAGAGGTGG + Intronic
1033462020 7:141555296-141555318 AGCTGAGGCCAGAGGAGAAGTGG + Intronic
1033472261 7:141660681-141660703 AGCTGGGGGTAGGTGGTTAGAGG - Exonic
1033740727 7:144273915-144273937 AGCTGGGGGTGGGGGAAGATGGG - Intergenic
1033753179 7:144375698-144375720 AGCTGGGGGTGGGGGAAGATGGG + Intronic
1033851164 7:145497263-145497285 AGCTGGAGGCAGGCTAGAAGTGG - Intergenic
1033881801 7:145893534-145893556 AGCTGCAGGTAGAGGATAAGTGG - Intergenic
1033916137 7:146328684-146328706 AGCTGGGGGCTGGAGAGAAGAGG - Intronic
1034014394 7:147566356-147566378 GGGAGGGGGAAGGGGAGAAGGGG + Intronic
1034209702 7:149352631-149352653 GGCTGGGGGCAGTGGAGAATGGG + Intergenic
1034461135 7:151198661-151198683 ACCTGGGGGTAGAGGAGAAAAGG + Intronic
1034462258 7:151204450-151204472 AGCTAGCGGGAGGGGAGAGGTGG - Intronic
1034629926 7:152523017-152523039 AACTGGGGGTGGGGGAGACTGGG - Intergenic
1034959140 7:155353571-155353593 AGCTGCTTGTAGGGGAGATGGGG + Intergenic
1034963080 7:155374332-155374354 AGCTGGGGGAGCGGGAGCAGGGG + Intergenic
1035111571 7:156486637-156486659 AGCAGGGTGGAGGGGAGAAGGGG - Intergenic
1035184023 7:157111877-157111899 AGCTGGATGTTGGAGAGAAGTGG - Intergenic
1035375506 7:158404657-158404679 AGCTGGGGGCCGGGGAGCTGAGG - Intronic
1035375545 7:158404760-158404782 AGCTGGGGGCCGGGGAGCTGAGG - Intronic
1035375562 7:158404805-158404827 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375644 7:158405023-158405045 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035375652 7:158405038-158405060 AGCTGGGGGCCGGGGAGCTGGGG - Intronic
1035390738 7:158502743-158502765 GGCTGGGGGTGAGGGAAAAGTGG - Intronic
1035550430 8:519570-519592 GGCTGAGGGTGGGGGAGAGGGGG - Intronic
1035914303 8:3601981-3602003 AGATGTGGGTAGGGGAGGATGGG + Intronic
1036033387 8:4994716-4994738 GGCTGCGGGAGGGGGAGAAGCGG + Exonic
1036392554 8:8336903-8336925 AGGTGGGGGGAGGGGGGAAAGGG - Intronic
1036576807 8:10035162-10035184 AGAAGGGGGAAGGGTAGAAGTGG + Intergenic
1036911472 8:12760905-12760927 GGGTGGTGGTGGGGGAGAAGGGG - Intergenic
1037417049 8:18662948-18662970 AGGTGGGGGAAGGGGAGCAATGG + Intronic
1037635535 8:20698520-20698542 GGCAGGGTGGAGGGGAGAAGGGG - Intergenic
1037698352 8:21248212-21248234 GGCTGGGTGGAGGGGAGAATGGG + Intergenic
1037703490 8:21295981-21296003 AGCTGGGGGGAGAGGGAAAGAGG - Intergenic
1037861732 8:22410175-22410197 AGCCCAGGGTAGGGGAGGAGGGG - Intronic
1037938503 8:22931387-22931409 GGCTGGGGGTAGGGAGGAATGGG - Intronic
1037961098 8:23098918-23098940 AGGTGGTGGGTGGGGAGAAGGGG + Intronic
1037962555 8:23109124-23109146 AACTGGGGGTTAGGGAGATGGGG + Intronic
1038257966 8:25968520-25968542 AGCTGGGGGGAGGGGAAAATGGG + Intronic
1038434746 8:27527543-27527565 GGCTGGGAGGAGGGGAGATGAGG - Intronic
1038764409 8:30414097-30414119 AGGAGGGGGTGGGGGAGGAGGGG - Intronic
1038770236 8:30471838-30471860 AGTTGGGGGTAGTGGAAATGAGG + Intronic
1038975934 8:32696062-32696084 ACCTGGGGCTGGGGGTGAAGAGG - Intronic
1039089335 8:33811979-33812001 AAGTGGGGGTAGAGGAGAGGAGG - Intergenic
1039291085 8:36095136-36095158 AGGAGGAGGAAGGGGAGAAGAGG + Intergenic
1040520845 8:48174668-48174690 GGCTGGGTGTAGTGGAGAAGGGG + Intergenic
1040550320 8:48432409-48432431 AGCTGAGGGAAGGGGAGACCAGG - Intergenic
1040628015 8:49174876-49174898 TGCCAGGGGTTGGGGAGAAGTGG - Intergenic
1040913158 8:52541846-52541868 AGGTGGGGGTAGGGAGGGAGGGG - Intronic
1041744898 8:61197938-61197960 TGCTGGGGATAGGGGAGGGGTGG + Intronic
1042262907 8:66878023-66878045 AGATGGGGGCGGGGGAGAAAAGG - Intronic
1042619289 8:70687090-70687112 AGCAGGGAGTAAGGCAGAAGTGG - Intronic
1042670398 8:71256533-71256555 AATTGGGGGGAGGGGAGAATGGG + Intronic
1042926303 8:73971898-73971920 AGTTTGGGGGAGGGGAGAAGAGG - Exonic
1043019621 8:74984421-74984443 AGGTGGGGGTGGGCGAGGAGGGG + Intergenic
1043431798 8:80202081-80202103 AGGGGAGGGGAGGGGAGAAGTGG + Intronic
1043724419 8:83591214-83591236 TGCTGGGAGTGGGGGAGAAGTGG + Intergenic
1043785448 8:84392766-84392788 AGCTGGCGGGTGGGGAGAAGAGG + Intronic
1043794428 8:84518333-84518355 AGCTAAGGGGAAGGGAGAAGTGG + Intronic
1043983600 8:86668332-86668354 ATCGGGGGGTGGGGGACAAGGGG + Intronic
1044351290 8:91169662-91169684 GGGTGGGGGTAGGGGGGGAGGGG - Intronic
1044756035 8:95462001-95462023 AGGTGGGGAGAGGAGAGAAGAGG - Intergenic
1044904778 8:96989464-96989486 AGCGGAGGGGAGGGGAGGAGAGG + Intronic
1045303922 8:100940179-100940201 ATCCTGGGGGAGGGGAGAAGAGG - Intronic
1045368364 8:101496569-101496591 TGTTGGGGGTGGGGGAAAAGGGG + Intronic
1045369244 8:101505156-101505178 AGTTGGGAGTGGGAGAGAAGGGG - Intronic
1045399689 8:101800947-101800969 AGAAGAGGGGAGGGGAGAAGAGG + Intronic
1046178994 8:110618300-110618322 AGGAGGGGCAAGGGGAGAAGGGG - Intergenic
1047358016 8:124141715-124141737 AGCCAGGGGTAGGGGGGCAGAGG - Intergenic
1047461662 8:125071617-125071639 TGCTTGGGATAGGGGAGCAGAGG - Intronic
1047702016 8:127458113-127458135 AGTTGGGGGTGGGGGAGGAATGG + Intergenic
1047962428 8:130020391-130020413 GGCTGGGAGGAGGGGAGAATGGG + Intergenic
1047992194 8:130297721-130297743 AGCGGGGGGGCGGGGAGCAGAGG + Intronic
1048050709 8:130813384-130813406 GGCTGGAGGGAGGGGAGAATTGG - Intronic
1048370342 8:133771476-133771498 AGCTGGCGGATGGTGAGAAGAGG + Intergenic
1048881676 8:138877105-138877127 GGCTGGGGGTGGGGGAGGGGAGG - Intronic
1049032620 8:140048840-140048862 AGCTGGGAGTAGGGGAGCAGGGG - Intronic
1049135420 8:140893620-140893642 GGCTGGGGGTAGGGCAGAGTTGG + Intronic
1049292713 8:141812988-141813010 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292721 8:141813012-141813034 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292778 8:141813173-141813195 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292802 8:141813243-141813265 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292858 8:141813401-141813423 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292866 8:141813425-141813447 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049292952 8:141813652-141813674 TGCTGGGGGTCAGGGAGATGAGG - Intergenic
1049325102 8:142017582-142017604 AGCTGGGGGTGGAGCACAAGGGG + Intergenic
1049477948 8:142805589-142805611 GGGTGAGGGTAGGGGGGAAGTGG - Intergenic
1049609883 8:143549996-143550018 AGCTGGGTGTTGGGGAGGGGAGG - Intergenic
1049610546 8:143552955-143552977 GGGTGGGGGTAGGGGAGGGGAGG + Intergenic
1049665837 8:143842046-143842068 AGCTGCGCGGAGGGGAGGAGCGG - Intergenic
1049672225 8:143875042-143875064 AGCTGAGGGTAGGTGGGAGGAGG - Intronic
1049762986 8:144339179-144339201 TGCTGGGGGTGAGGGGGAAGGGG - Intergenic
1049824570 8:144660323-144660345 AGATGGGGTTAGGGGAGGAAAGG - Intergenic
1050003939 9:1108315-1108337 TGCAGGGGGTGGGGGACAAGGGG - Intergenic
1050032304 9:1399337-1399359 TGTTGGGGGTAGGGGGCAAGGGG + Intergenic
1050040741 9:1490719-1490741 AGTTTGGGGCCGGGGAGAAGAGG + Intergenic
1050303298 9:4281443-4281465 TGCTGGGAGTTGGGGAGAAGGGG - Intronic
1050575713 9:6993166-6993188 AGTTGGTGGTGGTGGAGAAGAGG + Intronic
1050829520 9:9992795-9992817 TGCTGGGGGATGGGGAGAGGGGG + Intronic
1051547705 9:18294709-18294731 ACTTGGGGGTATGAGAGAAGGGG - Intergenic
1051614365 9:18993265-18993287 ATCTGGGGGTGGGGGGCAAGGGG - Intronic
1051637718 9:19196158-19196180 AGCTGGGATTTGGAGAGAAGTGG - Intergenic
1051756136 9:20402844-20402866 AGCTGGGGATATGGGATATGAGG + Intronic
1051803244 9:20961150-20961172 AGCGGAGGGGAGGGGAGGAGTGG - Intronic
1051858223 9:21594103-21594125 GGCTGGGGGTAGGGAAAATGGGG - Intergenic
1051893989 9:21969806-21969828 GGCGGGGGGGAGGGGAGGAGGGG + Intronic
1052381103 9:27772005-27772027 AGCTGGAGGATGGGGGGAAGGGG - Intergenic
1052573821 9:30265186-30265208 ACCTGGGGTTGGGGGAGAGGTGG + Intergenic
1052926297 9:34019504-34019526 GGCTGGGGGTAGGGGAAGAATGG + Intronic
1053003196 9:34589250-34589272 AGCTGAGGGGTGGGGAGAACAGG + Intronic
1053015992 9:34662519-34662541 AGCTGGGGGTCTGGGTGAATGGG - Intronic
1053078562 9:35155297-35155319 ACCTGGGAGGAGGGGAGAGGAGG + Intergenic
1053157774 9:35792243-35792265 TGCTGGGGGCCGGGGAGAGGAGG - Exonic
1053161145 9:35814392-35814414 CCCTGGGGCTAGGGGAGCAGAGG - Intronic
1053161253 9:35814888-35814910 CGCGGGGGGCAGGTGAGAAGTGG - Exonic
1053265878 9:36713123-36713145 AGCTGGGAGGAGGGGAGAATGGG - Intergenic
1053281114 9:36820289-36820311 AGCTGGGTGGAGGGGCCAAGAGG - Intergenic
1053316822 9:37059154-37059176 TGTTGGGGGTGGGGGAGGAGGGG - Intergenic
1053470866 9:38345494-38345516 AGATTTGGGAAGGGGAGAAGGGG - Intergenic
1053562343 9:39209657-39209679 AGAAGGGGGGAGGGGGGAAGGGG - Intronic
1053663556 9:40301365-40301387 AGGTGGGGATTGGGGAGAATGGG + Intronic
1053828147 9:42047645-42047667 AGAAGGGGGGAGGGGGGAAGGGG - Intronic
1054375679 9:64447599-64447621 AGGTGGGGATTGGGGAGAATGGG + Intergenic
1054521059 9:66074920-66074942 AGGTGGGGATTGGGGAGAATGGG - Intergenic
1054602411 9:67139805-67139827 AGAAGGGGGGAGGGGGGAAGGGG + Intergenic
1055577534 9:77675007-77675029 GGCGGGGGGTAGGGGAGGATGGG + Intergenic
1055834127 9:80419094-80419116 AGCTGGGGTTCCGGGGGAAGAGG + Intergenic
1055876361 9:80946772-80946794 AAGTGGGGGTTGGGGAGAAGAGG + Intergenic
1056272293 9:84958081-84958103 AGATGGGGGCAGGGAAGAATGGG + Intronic
1056592469 9:87974496-87974518 AGCGTGGGGTGGAGGAGAAGTGG - Exonic
1056806189 9:89730810-89730832 AGCTGGGGGTGGTGGAGCGGCGG + Intergenic
1056929246 9:90861072-90861094 AGCTGTGGAGAGGGGAGAATGGG + Intronic
1057187825 9:93067077-93067099 AGCTGGGGGAAAGGGAAAACTGG - Intronic
1057516604 9:95727264-95727286 AGAAGGGGGGTGGGGAGAAGTGG - Intergenic
1057545582 9:96018076-96018098 CGCTGGAGGGAGGGGAGAAAGGG + Intergenic
1057587723 9:96344708-96344730 AGCTGGGGGTGGGGGAGGGATGG + Intronic
1057909043 9:99004091-99004113 AGCCAGGGGTCGGGGAGAAATGG + Intronic
1057940849 9:99282253-99282275 AGCAGAGGGGAGGGGAGAGGAGG - Intergenic
1058111096 9:101030953-101030975 AGCAGGGGGTGGGGGGGAATTGG + Intronic
1058237517 9:102510028-102510050 AGCTGAGGGGAGGGGAAAACAGG + Intergenic
1058411433 9:104737482-104737504 GGCTGGGGGAAGGGGAGAATGGG + Intergenic
1058934939 9:109761520-109761542 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1059113985 9:111584285-111584307 AGCCAGGTGTAGGGGAGAAGAGG - Intronic
1059144404 9:111885307-111885329 AGCTGGGGGGAGGGGAAATGGGG + Intergenic
1059448159 9:114352075-114352097 GGCTGGGGGCAGGAGGGAAGTGG + Intronic
1059470724 9:114503330-114503352 AGGTCGGGGGAGGGGGGAAGGGG + Intronic
1059495809 9:114708529-114708551 GGGTGGGGGGAGGGGGGAAGTGG - Intergenic
1059543187 9:115151016-115151038 TGCTGGGGGCAGATGAGAAGAGG - Intronic
1059633752 9:116153481-116153503 AGGAGGGGGTGGTGGAGAAGCGG + Intergenic
1059729130 9:117039424-117039446 TGTTGGGGGTTGGGGAGAAAGGG + Intronic
1059804828 9:117787390-117787412 AGCTGGAGGGATGGAAGAAGGGG - Intergenic
1059900681 9:118921759-118921781 GGCTGGGGTTGGGGAAGAAGTGG + Intergenic
1060171940 9:121469015-121469037 CGCTGGGGGTAGCTGGGAAGTGG - Intergenic
1060882338 9:127126138-127126160 AGTTGGGGGTAGGGGTGGGGTGG - Intronic
1061003407 9:127915394-127915416 AGCTGGGGGTGGGGAGGAGGCGG - Intronic
1061022206 9:128023194-128023216 AGGAAGGGGTAGGTGAGAAGGGG - Intergenic
1061041416 9:128142868-128142890 ATCTGGGGTGTGGGGAGAAGGGG + Intergenic
1061237552 9:129351542-129351564 GGCTGGGGTAAGGGGAGAAGAGG + Intergenic
1061307665 9:129741456-129741478 ATCTGGGGGAAAAGGAGAAGAGG - Intronic
1061346236 9:130027997-130028019 AGGTGGGGGTAGAGGTGAGGGGG - Intronic
1061389057 9:130307187-130307209 TGCTGGGGGCGAGGGAGAAGCGG + Intronic
1061403760 9:130382658-130382680 GGCTGGGGGTGGGGGAGAGGGGG - Intronic
1061409546 9:130411797-130411819 GGCTGCAGGGAGGGGAGAAGGGG + Intronic
1061445612 9:130635657-130635679 GGGTGGGGGTGGGGGAGAAGGGG - Intronic
1061661530 9:132133417-132133439 AGATGGGGTTAAGGGAGAAAAGG + Intergenic
1061805034 9:133133151-133133173 AGGTGGGGGCAGGGGAGATATGG - Intronic
1061806288 9:133139457-133139479 AGCTGGGGGTAGTGGGCAGGTGG - Intronic
1062207712 9:135346592-135346614 AGCTGGTGGGAGGGGAGAAACGG - Intergenic
1062234843 9:135502810-135502832 AGCCGGGGGTAGGGGAGATGTGG + Intronic
1062255792 9:135620023-135620045 AGGGGGAGATAGGGGAGAAGAGG - Intergenic
1062308308 9:135921864-135921886 AGCTGGGGGCACGGGAGCAAAGG - Intergenic
1062612337 9:137380644-137380666 AGAGGGGGGTTGGGGAGGAGGGG - Intronic
1062615494 9:137394169-137394191 GGCTGGGGTTAGGGAAGCAGAGG - Intronic
1203663925 Un_KI270754v1:8449-8471 AACCGAGGGTAGGGGAGAGGTGG - Intergenic
1185506991 X:638977-638999 AGGTGGTGGTGGGGGAGAGGAGG + Intronic
1185525036 X:771843-771865 GGCAGGGGGTGGGGGAGAGGGGG - Intergenic
1185528452 X:798138-798160 TACTGGGGGAAGGGGAGAATTGG + Intergenic
1185608536 X:1380652-1380674 AGGGAGGGGTAGGGGGGAAGGGG + Intronic
1186223203 X:7371444-7371466 AGAAGGTGGTAGGGGAGATGAGG + Intergenic
1186631707 X:11356258-11356280 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1186770968 X:12817881-12817903 GCCTGGGGGGAGGGGAGAATAGG + Intronic
1186797224 X:13058652-13058674 ATTTGAGGGTCGGGGAGAAGAGG + Intergenic
1186875878 X:13817216-13817238 AGTTGGGGGTAGGGGGGTGGGGG + Exonic
1186894564 X:13992918-13992940 AGGTGGTGGGATGGGAGAAGTGG + Intergenic
1186945128 X:14557716-14557738 AACAGGGGGTGTGGGAGAAGTGG + Intronic
1187077196 X:15947035-15947057 CGGTGGGGGTAGGGGGGAGGCGG + Intergenic
1187253866 X:17623482-17623504 GGATGGGGGTAGGGGGGAGGTGG + Intronic
1187256549 X:17648266-17648288 AGATGGGGGTAGGGGACAACTGG + Intronic
1187388732 X:18872079-18872101 AGCTGGGGGCAGGGGGGCGGGGG - Intergenic
1187429578 X:19209877-19209899 AGATGGTGGAAGGGGAGAATTGG + Intergenic
1187610720 X:20939863-20939885 TGCTGGGGGTAAGGGAGGGGTGG + Intergenic
1187693591 X:21896360-21896382 GGCTGGGGGGAAGGGAGGAGTGG - Intergenic
1187778045 X:22786081-22786103 AGATGGAGGGATGGGAGAAGGGG - Intergenic
1188061096 X:25603149-25603171 AGTTGGGGGTCGGGGTGAGGCGG - Intergenic
1188227640 X:27621156-27621178 GGCTGGGGAGAGGGGAGAATGGG + Intronic
1188917705 X:35933204-35933226 AATTGGGGGTGGGGAAGAAGGGG - Intronic
1189117898 X:38362126-38362148 AGTTGGGAGTGGGGGAAAAGGGG + Intronic
1189212008 X:39291444-39291466 AGCTGGGGGTCTGGGAGAGCAGG + Intergenic
1189281858 X:39824721-39824743 AGGTGCGGGTATGGGAGAAGAGG - Intergenic
1189528485 X:41853013-41853035 ATCTGGGGGTGGGGAAGCAGAGG - Intronic
1189852174 X:45188739-45188761 GGCTGAGGGGAGGGGAGAATTGG - Intronic
1190066477 X:47244995-47245017 GGCTGGGGGTGAGGGAGAGGTGG - Exonic
1190122457 X:47673202-47673224 GTCAGGGGGTAGGGGACAAGGGG - Intergenic
1190316870 X:49156965-49156987 AACTGGGGGGAGGGGAGCTGGGG - Intergenic
1190317893 X:49163254-49163276 AACTGGGGGGAGGGGAGCTGGGG + Intronic
1190911317 X:54774844-54774866 AGCTGAGGGAAGGGGAGGGGAGG + Intronic
1191227263 X:58056294-58056316 AGCTAGAGGTAGGTGAGAATGGG - Intergenic
1191910481 X:66144133-66144155 GGCTTGGGGGAAGGGAGAAGTGG + Intergenic
1192165752 X:68826819-68826841 AGGTGGGGGATGGGGAGATGAGG - Intergenic
1192218392 X:69179819-69179841 AGCAGGGGAGAGAGGAGAAGGGG - Intergenic
1192276689 X:69638928-69638950 GGCTGGGGGGAGGGGAGAGTAGG - Intronic
1192450885 X:71244233-71244255 AGGAGGGGAAAGGGGAGAAGGGG - Intronic
1192521341 X:71804156-71804178 TGCTGGGGTTAGGGGAGCCGTGG - Intergenic
1192736037 X:73850680-73850702 AGAGGGGGGTAGGGGGGTAGGGG + Intergenic
1193096698 X:77556406-77556428 AGGTGGGGGTGGGGGAGAGAGGG + Intronic
1193117016 X:77785570-77785592 AGCGGGGGGAGGGTGAGAAGAGG - Intronic
1193260653 X:79403275-79403297 TGCTGGGGATAGGAGAGCAGTGG - Intergenic
1193335633 X:80285382-80285404 AGGTTGGGGGAGGGGTGAAGTGG - Intergenic
1193451149 X:81669583-81669605 AGCTGGAAGTAGAAGAGAAGAGG - Intergenic
1193546827 X:82841815-82841837 GGCTATGGGCAGGGGAGAAGAGG - Intergenic
1193754936 X:85397161-85397183 AGGAGGGGGTAGAGGAGAGGTGG - Intergenic
1193902083 X:87192860-87192882 ATCTGGGGGTGGGGGGCAAGGGG - Intergenic
1194522196 X:94932424-94932446 AGCTGGGGGTAGGGGTGTGAAGG + Intergenic
1195048878 X:101079212-101079234 AGGTGGGGATAGGGGCTAAGGGG - Intronic
1195097572 X:101519319-101519341 AGCTGGGTGTAGGGGGAAATGGG - Intronic
1195696600 X:107672182-107672204 GGCTAGGGGGAGGGGAGAATGGG + Intergenic
1195853234 X:109305644-109305666 AGTTGGTAGAAGGGGAGAAGTGG - Intergenic
1195900654 X:109794097-109794119 GGCTGGGGGAAGGGGAAAAGGGG + Intergenic
1195995942 X:110731800-110731822 AGCTGGGGGAAGGGGAGAATGGG + Intronic
1195998272 X:110753383-110753405 ACCAGGGGCTAGGGGAAAAGGGG + Intronic
1196023926 X:111020388-111020410 AGCTGAGAGGAGGGGAGAATGGG + Intronic
1196120437 X:112044845-112044867 TGCTGGAGGAAGGGGAGAATAGG + Intronic
1196635658 X:117999538-117999560 TGCTGGGGGGTGGGGAGATGGGG + Intronic
1196845898 X:119896469-119896491 AGCGGAGGGGAGGGGAGAGGAGG + Intronic
1196854932 X:119973851-119973873 GGCTGGGGATGGGGGAGAAAAGG + Intergenic
1196857337 X:119996581-119996603 GGCTGGGGATGGGGGAGAAAAGG + Intergenic
1197112656 X:122795146-122795168 AATTGGGGGTTGGGGTGAAGTGG - Intergenic
1197645946 X:129016671-129016693 AGAAGGGGGTAGGGGTGGAGGGG - Intergenic
1197747151 X:129939338-129939360 AGTGTGGGGTGGGGGAGAAGAGG - Intergenic
1198208321 X:134491169-134491191 TGCTGGGGGAAGGGGAAATGGGG - Intronic
1198213846 X:134538630-134538652 AGGAGCGGGTAGGGGAGAAGCGG - Intergenic
1198241950 X:134796307-134796329 AGCTGGGGGCGGGGGCTAAGGGG + Intronic
1198666894 X:139034370-139034392 AGCTGGGTGAATGGGGGAAGTGG + Intronic
1198792623 X:140362117-140362139 AGCTAGGGGGAGGGGATAATTGG + Intergenic
1198811554 X:140541154-140541176 AGGTGGGGGAAGTGGGGAAGGGG - Intergenic
1199078011 X:143546085-143546107 AGCTGGGGGTGGTGGGGGAGGGG + Intergenic
1199358184 X:146885852-146885874 TGCTGGGGGTCGGGGAGGGGTGG - Intergenic
1199590948 X:149468096-149468118 AGGTGGGGGTGAGGGAGCAGAGG - Intergenic
1199599798 X:149535204-149535226 AGGAGGGGGTGGGGGAGGAGTGG - Intergenic
1199637480 X:149826931-149826953 GGGTGGGGGGAGGGGGGAAGGGG + Intergenic
1199650842 X:149945048-149945070 AGGAGGGGGTTGGGGAGGAGTGG + Intergenic
1199697279 X:150351696-150351718 AGCTGGGGCTTTGGGGGAAGTGG + Intergenic
1199851279 X:151726352-151726374 AGCTGGTGGAAGGTGGGAAGAGG + Intergenic
1199895897 X:152127693-152127715 AGGTGGGGGTAGGGTAGGACAGG - Intergenic
1200087302 X:153613657-153613679 AAGTGGGGGTAGGGGACATGGGG - Intergenic
1200096970 X:153669075-153669097 AGCTGGGGCTCTGGGAGCAGTGG - Intergenic
1200099781 X:153684816-153684838 AGCTGGGGGGAGGGCAGGGGAGG - Intronic
1200119613 X:153784134-153784156 AGCAGGAGGCAGGAGAGAAGAGG - Exonic
1200249189 X:154543184-154543206 CACTGTGGGTAGGGGACAAGGGG - Intronic
1200376909 X:155791637-155791659 AGCTGGGGGTTGGGAGGAGGCGG + Intergenic
1200712446 Y:6499718-6499740 TGTTGGGGGTAGGGGACTAGTGG - Intergenic
1200795109 Y:7333565-7333587 AACAGGGGGAAGGGGAGTAGAGG - Intergenic
1201077885 Y:10200448-10200470 TGGTGGGGGTGGGGGGGAAGGGG - Intergenic
1201567366 Y:15380394-15380416 AGCTGAGGGTAGGGGGAAATGGG + Intergenic
1202045558 Y:20734403-20734425 AGAGGAGGGGAGGGGAGAAGAGG + Intergenic