ID: 955360134

View in Genome Browser
Species Human (GRCh38)
Location 3:58267134-58267156
Sequence ATCAGTAAGCTCTAGATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 204}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
955360134_955360136 16 Left 955360134 3:58267134-58267156 CCACTCATCTAGAGCTTACTGAT 0: 1
1: 0
2: 0
3: 8
4: 204
Right 955360136 3:58267173-58267195 TTCTCACCCCTTCCAGGTACTGG 0: 1
1: 0
2: 1
3: 15
4: 222
955360134_955360135 10 Left 955360134 3:58267134-58267156 CCACTCATCTAGAGCTTACTGAT 0: 1
1: 0
2: 0
3: 8
4: 204
Right 955360135 3:58267167-58267189 CTTTATTTCTCACCCCTTCCAGG 0: 1
1: 0
2: 1
3: 24
4: 266
955360134_955360144 30 Left 955360134 3:58267134-58267156 CCACTCATCTAGAGCTTACTGAT 0: 1
1: 0
2: 0
3: 8
4: 204
Right 955360144 3:58267187-58267209 AGGTACTGGCGGAGGACATTGGG 0: 1
1: 0
2: 1
3: 7
4: 83
955360134_955360139 22 Left 955360134 3:58267134-58267156 CCACTCATCTAGAGCTTACTGAT 0: 1
1: 0
2: 0
3: 8
4: 204
Right 955360139 3:58267179-58267201 CCCCTTCCAGGTACTGGCGGAGG 0: 1
1: 0
2: 0
3: 8
4: 154
955360134_955360137 19 Left 955360134 3:58267134-58267156 CCACTCATCTAGAGCTTACTGAT 0: 1
1: 0
2: 0
3: 8
4: 204
Right 955360137 3:58267176-58267198 TCACCCCTTCCAGGTACTGGCGG 0: 1
1: 0
2: 1
3: 30
4: 242
955360134_955360143 29 Left 955360134 3:58267134-58267156 CCACTCATCTAGAGCTTACTGAT 0: 1
1: 0
2: 0
3: 8
4: 204
Right 955360143 3:58267186-58267208 CAGGTACTGGCGGAGGACATTGG 0: 1
1: 0
2: 1
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
955360134 Original CRISPR ATCAGTAAGCTCTAGATGAG TGG (reversed) Intronic
901315029 1:8301260-8301282 ATCAATAACCTATAGCTGAGTGG + Intergenic
902126436 1:14216318-14216340 AACAGTAAGATCTAAAGGAGTGG + Intergenic
905099493 1:35506709-35506731 ATCAGGAAGCTTCAGAAGAGAGG - Exonic
905148656 1:35908497-35908519 ATCAATAAACTCTTGAAGAGAGG - Intronic
906879123 1:49570883-49570905 ATCAGTTGGCTGTAGATAAGTGG + Intronic
907088591 1:51702941-51702963 ATCAGTTAGTTGTAGATGTGTGG + Intronic
909812752 1:79952016-79952038 ATTACTAAGGTCTAGGTGAGTGG + Intergenic
910600770 1:89029830-89029852 ATCAGATAGTTCTAGATGTGTGG + Intergenic
915263486 1:154696891-154696913 TTCAGCAAGCTCTGGATCAGTGG + Intergenic
917257409 1:173130564-173130586 ATCAGATAGCTGTAGATGTGTGG + Intergenic
917638329 1:176958426-176958448 ATCACAAAGCTCTTGCTGAGGGG + Exonic
924867863 1:248005345-248005367 ATCAGTTAACTGTAGATGGGTGG + Intronic
1064118176 10:12596603-12596625 ATCTGAAACCTGTAGATGAGAGG + Intronic
1066173307 10:32875837-32875859 ATCAGTCAGTTTTAAATGAGAGG - Intronic
1068066744 10:52141477-52141499 ACCAGTAAGCTCTGGTTGGGTGG - Intronic
1068069314 10:52176313-52176335 ATCAGTTGGCTATAGATAAGAGG + Intronic
1070516339 10:77211298-77211320 ATCAGATGGCTCTAGATGTGCGG - Intronic
1071039870 10:81294227-81294249 ATCAATAAGCTGTAAATGAGTGG + Intergenic
1078048293 11:7938640-7938662 TTTCGTAAGCTATAGATGAGCGG + Exonic
1079060276 11:17242446-17242468 ATCTGTAATCTTTAGATGAATGG + Intronic
1079715360 11:23736729-23736751 ATCAGGTAGTTCTAGATGTGTGG - Intergenic
1080122377 11:28692359-28692381 ATGAGTAAGCTCTAGACCAGTGG - Intergenic
1081062782 11:38501718-38501740 ATCAGTTAGCTATAGATATGTGG + Intergenic
1081174552 11:39911606-39911628 GTAAGTAAGCTCTACTTGAGTGG + Intergenic
1084589169 11:70080082-70080104 TTAAGTAAGCTCCAGATGGGCGG - Intronic
1085810644 11:79677950-79677972 ATCAGGAAGATCTGGATGTGAGG - Intergenic
1087669032 11:101083597-101083619 ATCAGTATGCTCTGGATGTGAGG + Intronic
1088490636 11:110384082-110384104 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1088574247 11:111254221-111254243 ATCAGTAAGCTTTAAATTTGAGG + Intergenic
1089050205 11:115539123-115539145 ATAAGTCACCTCAAGATGAGTGG - Intergenic
1095227370 12:39694170-39694192 ATTAGAAAGATGTAGATGAGGGG + Intronic
1095607315 12:44084892-44084914 ATAAGTAAACTTTATATGAGAGG + Intronic
1096756105 12:53801125-53801147 AACTGTAGGCTCTAGAAGAGGGG + Intergenic
1099352340 12:81589463-81589485 ATCAGTAACGACTACATGAGGGG + Intronic
1099383543 12:81985553-81985575 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1106066454 13:26356526-26356548 ACCAGTAGGATCTAGATTAGAGG - Intronic
1107904686 13:45051193-45051215 AACAGAAAGCTATATATGAGGGG - Intergenic
1108186940 13:47897472-47897494 AGCAGTAAGTTCTACAAGAGAGG - Intergenic
1110381591 13:74857703-74857725 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1110798022 13:79662411-79662433 ATCACCAAGCTATAGATCAGTGG - Intergenic
1111622115 13:90737604-90737626 ATCAGATAGTTCTAGATGTGTGG - Intergenic
1112826853 13:103401386-103401408 ATCAGATAGCTGTAGATGTGTGG - Intergenic
1116190336 14:41657119-41657141 AGCAGAAAGATATAGATGAGAGG - Intronic
1116227191 14:42167358-42167380 ATCAGTTAGTTGTAGATGTGTGG + Intergenic
1118641359 14:67795354-67795376 ATGAGTAGGCTCTAGCTAAGTGG - Intronic
1119006673 14:70937431-70937453 ATCAGATAGCTGTAGATGTGCGG + Intronic
1120347979 14:83314599-83314621 ATTAGTTAGCTATAAATGAGGGG - Intergenic
1120360994 14:83502123-83502145 AACAGTTAGCAGTAGATGAGTGG - Intergenic
1120709325 14:87776756-87776778 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1122049654 14:99047368-99047390 ATAAGTTAGCTCCAAATGAGGGG - Intergenic
1122070246 14:99201363-99201385 TTCATCAGGCTCTAGATGAGAGG - Intronic
1123180376 14:106464023-106464045 AGCAGAAAGCCATAGATGAGTGG + Intergenic
1202946519 14_KI270726v1_random:32639-32661 AGCAGAAAGCCATAGATGAGTGG - Intergenic
1123784671 15:23658591-23658613 ATCAGTTGGCTCTAAATGAGTGG - Intergenic
1124992215 15:34686492-34686514 ATTAGAAAGTTTTAGATGAGGGG - Intergenic
1126330730 15:47528305-47528327 ATGAGCAAGATCTAGATGTGGGG - Intronic
1126537238 15:49779808-49779830 ATCAGATAGCTGTAGATAAGCGG + Intergenic
1133923862 16:10179164-10179186 ATCAGTTGGCTCTGAATGAGAGG - Intronic
1137650580 16:50116540-50116562 ATCAGTTGGCTGTAGATAAGTGG - Intergenic
1139187670 16:64825862-64825884 AGCATTAAGTGCTAGATGAGTGG - Intergenic
1139357312 16:66374333-66374355 ATCAGTCAGCTGTTGGTGAGGGG - Intronic
1141257941 16:82420762-82420784 ATCTGCATGCTATAGATGAGAGG - Intergenic
1141294917 16:82758596-82758618 ATCAGCAGCCTCTAGAGGAGAGG + Intronic
1142417369 16:89949754-89949776 AGCAGTGGGCTCTAGAGGAGGGG + Intronic
1144350628 17:14392170-14392192 ATCAGTTTGCTATAGATGTGTGG - Intergenic
1146141717 17:30373911-30373933 ATGAGAAAGCTGTTGATGAGAGG - Intergenic
1148478538 17:47945113-47945135 AACAGTAAGCTCTGTAGGAGTGG + Intronic
1150327785 17:64270511-64270533 ATCGGCAATTTCTAGATGAGGGG - Intergenic
1154039411 18:10838894-10838916 ATCAAGAAGCCCAAGATGAGAGG + Intronic
1155723563 18:29050255-29050277 ATCAGATGGCTCTAGATGTGTGG + Intergenic
1155753303 18:29456672-29456694 ATCAGTCACCACTAGATGACAGG - Intergenic
1156329626 18:36107482-36107504 CTCAGTAAGCCCTAGATGAAGGG + Intergenic
1156594992 18:38538475-38538497 ATCAGCCAGCTCTGAATGAGAGG - Intergenic
1157159988 18:45305153-45305175 AACAGCAAGGTCTAGGTGAGAGG + Intronic
1157798976 18:50603085-50603107 ATCTGTAACCTCCAGATTAGTGG - Intronic
1158061198 18:53345244-53345266 ATCAGTAAATTATAGTTGAGGGG - Intronic
1158738789 18:60115284-60115306 ATCAGTAAGCTGTAGGTATGTGG + Intergenic
1159997787 18:74983236-74983258 AGCAGCAAGCTCTGAATGAGGGG - Intronic
1164710330 19:30352656-30352678 CCCAGTAAGCTCTCGGTGAGTGG + Intronic
1166823108 19:45592563-45592585 GTGAGTAAGGTCTAGATCAGAGG + Exonic
927033699 2:19150343-19150365 ATCAGTGTGCTCTGGATGTGAGG - Intergenic
928046440 2:27938102-27938124 ATCAGTTAGCTGTAGAAGCGTGG + Intronic
928488000 2:31752153-31752175 ATCAGATAGCTGTAGATGTGTGG - Intergenic
928754692 2:34510085-34510107 ATCAGATAGCTGTAGATGTGTGG - Intergenic
929387121 2:41422586-41422608 ATCAGTTGACTATAGATGAGTGG + Intergenic
930453011 2:51567447-51567469 ATCAGTTGGCTCTTGATGTGTGG + Intergenic
930918744 2:56725196-56725218 ATCAGAAGGCTGTAGATGTGTGG + Intergenic
933475687 2:82787453-82787475 ATCAGTTAGATGTAGATAAGTGG - Intergenic
934519693 2:95012238-95012260 ATGAGGAAGCTTTAGAAGAGGGG - Intergenic
936264477 2:110992242-110992264 ATCAGTAAAACCTAGATGTGTGG - Intronic
937126797 2:119480012-119480034 CTCTGTAAGTTCTAGATGATTGG + Intronic
937801758 2:126088907-126088929 ATCAGATAGTTCTAGATGTGTGG - Intergenic
938576774 2:132611474-132611496 ATCAGTAAGCTCCAGAAGGCTGG + Intronic
938651085 2:133384354-133384376 ATCAGATAGCTATAGATGTGTGG + Intronic
939487212 2:142829522-142829544 ATCAGATAGCTGTAGATGTGTGG + Intergenic
942778757 2:179615861-179615883 ATCAGTAATCTCTGGGTGATGGG + Intronic
943391674 2:187277448-187277470 ATCAGTTGGCTCTCGATGTGTGG - Intergenic
943447837 2:188011151-188011173 ATAAGTAAGGTTTAGATGATAGG + Intergenic
944026452 2:195175236-195175258 ATCAGTTGGCTATAGATGTGTGG - Intergenic
944396828 2:199277728-199277750 ATGAGTAAGCTTTATATGAATGG - Intronic
944774615 2:202949995-202950017 ATCAGAAAACTTTAGCTGAGTGG - Intronic
946546401 2:220749197-220749219 TTCAGTAGGCTCCAGCTGAGAGG - Intergenic
946974006 2:225127618-225127640 ATCAGATGGCTATAGATGAGTGG + Intergenic
947389621 2:229625603-229625625 ATCTGTAAGCTTTTGATAAGAGG - Intronic
947544193 2:230999741-230999763 ATCAGAATGCTCTAGATCAATGG + Intronic
1169009556 20:2238785-2238807 ATCAGGAGGCTGGAGATGAGAGG + Intergenic
1177034466 21:16024710-16024732 ATCAATAAACTTTAGATGATTGG + Intergenic
1180583490 22:16864403-16864425 ATCAGTTAGCTGTAGATGTGTGG - Intergenic
1183075669 22:35425053-35425075 ATCAGTAAACTGGAGATGGGGGG + Exonic
949400623 3:3661977-3661999 ATCAGTCAGCTAGAGATGTGTGG + Intergenic
952971534 3:38653848-38653870 ATCTGTGAGCTCTAGATGGAGGG + Intergenic
953217061 3:40929379-40929401 ATGAGTAAGCTGTAAATGTGTGG - Intergenic
955360134 3:58267134-58267156 ATCAGTAAGCTCTAGATGAGTGG - Intronic
955624398 3:60901849-60901871 ATCAGTAGCAGCTAGATGAGTGG - Intronic
956668918 3:71668097-71668119 ATCAGATAGCTATAGATGTGTGG - Intergenic
959305200 3:104654901-104654923 ATCAGTTAGCTGTAAATAAGTGG + Intergenic
961340409 3:126213449-126213471 CTCAGTAAGCTGTAGCTCAGGGG - Intergenic
962650149 3:137480240-137480262 ATCAGTGAGCTCAAGGTGTGGGG - Intergenic
964062807 3:152544655-152544677 ATCAGTTAGCTATAGATACGTGG - Intergenic
964273622 3:154985559-154985581 ATCAGATAGCTGTAGATGTGTGG - Intergenic
966529063 3:180953748-180953770 ATCAGCACTCTGTAGATGAGGGG - Exonic
966663588 3:182445128-182445150 ATCAGTAAAGTCTACATGAAGGG - Intergenic
971939850 4:33200326-33200348 ATCAACAAGCCCTAGATGTGAGG + Intergenic
972128212 4:35797322-35797344 ATCAGTTAGCTGTAGATGTATGG - Intergenic
974862662 4:67542330-67542352 ATCAGTAAACTCTGGCTGATAGG - Intronic
976903146 4:90204490-90204512 ATCAGATGGCTCTAGATGTGTGG + Intronic
976930824 4:90564819-90564841 ATCAGTTTGCTCTAAATGTGTGG + Intronic
977082995 4:92556850-92556872 ATCAATAGGCTCGAGGTGAGGGG + Intronic
977765281 4:100790345-100790367 ATGAGTAATATTTAGATGAGGGG + Intronic
977793433 4:101133939-101133961 ATCAGATAGCTGTAGATGTGTGG - Intronic
978543232 4:109841566-109841588 ACCAGAAAACTCTAGATGTGGGG - Intronic
980204208 4:129697133-129697155 TTCAATAAGATCTTGATGAGGGG + Intergenic
980973315 4:139587191-139587213 CTCAGTGAGCCCTGGATGAGTGG - Intronic
981127488 4:141123289-141123311 CTCAGTAAGCTCCACAAGAGTGG - Intronic
983246087 4:165289075-165289097 GTCAGGAAGCACTAGATGACTGG - Intronic
984386851 4:179071804-179071826 ATCAGTAAAATCTAAAAGAGCGG - Intergenic
1202753232 4_GL000008v2_random:29162-29184 ATCAGATAGCTGTAGATAAGTGG - Intergenic
989235560 5:39144395-39144417 ATCAGCAAAATCTAGATGATGGG + Intronic
989442482 5:41489227-41489249 ATCAGATAGCTGTAGATAAGCGG + Intronic
990085361 5:51969850-51969872 ATCAGGAAGCTCTATCTAAGAGG + Intergenic
992276306 5:75123641-75123663 ATCAGTTAGCTATAGATATGTGG - Intronic
996689206 5:126319888-126319910 ATCAGTTAGTTCTAGCTCAGTGG - Intergenic
997432500 5:133850422-133850444 ATCAGTGAGCACTAAATGTGTGG - Intergenic
998249203 5:140538956-140538978 ATCAGCAAGCTGAGGATGAGAGG - Exonic
1002397560 5:178969931-178969953 ATCAGTCAGCTGGAGATGAGGGG - Intergenic
1004549684 6:16634953-16634975 ATTATTAAGCTCTAGAGCAGGGG + Intronic
1008343801 6:50401252-50401274 ATCAGTTAGCTCTAAATGTATGG + Intergenic
1008681000 6:53872221-53872243 ATCAGTTGGCTGTAAATGAGTGG + Intronic
1010869441 6:81020017-81020039 ATCAGAAAGCACTAGAAAAGGGG + Intergenic
1011181070 6:84621641-84621663 ATCAGTTGGCTGTAGATGTGTGG - Intergenic
1012082637 6:94780743-94780765 ATCAGAAGGCTGTAGATGTGTGG + Intergenic
1014934378 6:127369373-127369395 ATCAGTGGGCTGTAGATGTGTGG + Intergenic
1015248345 6:131100394-131100416 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1016483062 6:144503547-144503569 ATCAGTTAGTTATAGATGTGTGG + Intronic
1019101744 6:169636232-169636254 ATCACCAAACTCTTGATGAGAGG - Intronic
1020443514 7:8244251-8244273 ATCAGATAGCTGTAGATGTGTGG - Intronic
1021911948 7:25394830-25394852 GTCAGTAAGTTCTTGATGAAGGG - Intergenic
1022463503 7:30634605-30634627 ATCATTAAGCTCTTGATGCTAGG + Intergenic
1023730032 7:43182451-43182473 ATCAGTTGGCTGTAGATGTGTGG + Intronic
1024110670 7:46143237-46143259 ATTAGTTAGCTCTAGGTGTGTGG + Intergenic
1026467378 7:70666002-70666024 GTCAGTAAGCTCCAGCTCAGAGG - Intronic
1027671989 7:81112284-81112306 TTCAGTTAGCTCTAGATGTTTGG - Intergenic
1028282207 7:88945386-88945408 ATCAGTTAGTTGTAGATGTGTGG + Intronic
1030308191 7:108040604-108040626 ATCAGATAGTTCTAGATGTGTGG - Intronic
1030672279 7:112350839-112350861 TTCAGTAAGTTTTAGATGATGGG + Intergenic
1031010078 7:116517159-116517181 TTCAGTAAGCACGAAATGAGAGG - Intergenic
1031307002 7:120141148-120141170 ATCACAAAGCCATAGATGAGAGG - Intergenic
1031455232 7:121971100-121971122 ATCAGATAGCTGTAGATGTGTGG + Intronic
1033618001 7:143035756-143035778 ATCAGATAGCTATAGATGCGTGG - Intergenic
1040104703 8:43535073-43535095 ATGAGTGAGGTCTTGATGAGTGG + Intergenic
1040413865 8:47180812-47180834 ATCAGTTAAATCCAGATGAGAGG - Intergenic
1041747176 8:61220456-61220478 ATCAGATAGTTGTAGATGAGTGG + Intronic
1043820352 8:84855488-84855510 ATCATTAAACAGTAGATGAGTGG + Intronic
1044080866 8:87881657-87881679 ATCAGTAAAAGATAGATGAGGGG - Intergenic
1044342044 8:91056778-91056800 ATAAGCAATCTCTATATGAGAGG - Intergenic
1046887294 8:119381501-119381523 ATCAGATAGTTGTAGATGAGTGG - Intergenic
1046994576 8:120503312-120503334 AAAGCTAAGCTCTAGATGAGAGG - Intronic
1048037310 8:130689417-130689439 ATCTGTCAGTTCTAGAAGAGAGG - Intergenic
1048309112 8:133304733-133304755 AGCAGTAAGGTCCAGAGGAGAGG + Intergenic
1048699531 8:137072931-137072953 ATCAGTTAGCCCTAGATGTGTGG + Intergenic
1050202267 9:3157763-3157785 ATCAGTTGGCTGTAGATAAGTGG + Intergenic
1050603729 9:7278982-7279004 ATCAGATAGCTGTAGATGTGTGG + Intergenic
1050671568 9:8003671-8003693 ATCAGATAGTTCTAGATAAGTGG + Intergenic
1051569981 9:18544802-18544824 AGGAGTTAGCTCTAGCTGAGTGG - Intronic
1053425057 9:38004971-38004993 ACCAGCAAGTTCTGGATGAGGGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1186947169 X:14581448-14581470 ATCAGGCAGCTCTACATTAGTGG - Intronic
1188992122 X:36834157-36834179 ATCAGTTGACTGTAGATGAGTGG - Intergenic
1189422586 X:40869680-40869702 ATCAGTTGGCTGTAGATGTGTGG + Intergenic
1190585932 X:51942071-51942093 ATCAGTTGGCTGTAGATGTGTGG - Intergenic
1191165314 X:57384017-57384039 ATCAGATAGCTGTAGATGTGTGG - Intronic
1191193209 X:57689094-57689116 ATCAGATAGCTGTAGATGTGTGG - Intergenic
1191652059 X:63550016-63550038 ATCAGATAGTTGTAGATGAGTGG + Intergenic
1191653249 X:63565068-63565090 ATCAGATAGTTGTAGATGAGTGG + Intergenic
1191726557 X:64287659-64287681 ATCAGATAGCTGTAGATGTGTGG - Intronic
1192334158 X:70203681-70203703 AGAGGTAAGCACTAGATGAGGGG + Intronic
1192347523 X:70323252-70323274 ACAGGTAAGCACTAGATGAGGGG - Intronic
1192810175 X:74540351-74540373 GTCAGTAAGCTCTGGAACAGTGG - Intergenic
1193921525 X:87433581-87433603 ATCAGGAAGCTCTGGTTAAGTGG + Intergenic
1194248506 X:91543752-91543774 ATCAGATAGCTATAGATGTGTGG - Intergenic
1194900593 X:99505191-99505213 ATCAGTAAGCTCCAGGAAAGCGG + Intergenic
1194909834 X:99628427-99628449 ATCAGATAGCTCTAGGTGTGTGG - Intergenic
1195787514 X:108543405-108543427 ATCAGAAAGTTGTAGATGTGTGG + Intronic
1196015231 X:110932251-110932273 ATCAGTAATCTATATATGTGTGG - Intergenic
1196390574 X:115203688-115203710 ATCAGTGTGCTCTGGATGTGAGG - Intronic
1197273536 X:124451715-124451737 ATCAGATAGCTATAGATGTGTGG - Intronic
1198390252 X:136167095-136167117 AACAGTGAGTTCTATATGAGTGG + Intronic
1198390400 X:136168285-136168307 AGCAGTGAGTTCTATATGAGTGG + Intronic
1199479395 X:148281499-148281521 ATCAGTCATCTCTAAAGGAGTGG - Intergenic
1200789742 Y:7288709-7288731 ATCAGCAAGCTCTTTATGACCGG + Intergenic
1201684711 Y:16688053-16688075 ATCAGGTAGTTCTAGATGTGTGG - Intergenic
1202374984 Y:24226709-24226731 ATCAGATAGTTGTAGATGAGTGG - Intergenic
1202495796 Y:25443411-25443433 ATCAGATAGTTGTAGATGAGTGG + Intergenic